ID: 1085515228

View in Genome Browser
Species Human (GRCh38)
Location 11:77107689-77107711
Sequence CCTGGGATGTGATCCACCAA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 241
Summary {0: 1, 1: 1, 2: 0, 3: 13, 4: 226}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085515228_1085515235 -8 Left 1085515228 11:77107689-77107711 CCGTTGGTGGATCACATCCCAGG 0: 1
1: 1
2: 0
3: 13
4: 226
Right 1085515235 11:77107704-77107726 ATCCCAGGGGGTTATCAGGGAGG 0: 1
1: 0
2: 1
3: 4
4: 113
1085515228_1085515241 27 Left 1085515228 11:77107689-77107711 CCGTTGGTGGATCACATCCCAGG 0: 1
1: 1
2: 0
3: 13
4: 226
Right 1085515241 11:77107739-77107761 CCAGTCCTTGCCTTGCTGCCAGG 0: 1
1: 1
2: 2
3: 23
4: 275
1085515228_1085515238 -5 Left 1085515228 11:77107689-77107711 CCGTTGGTGGATCACATCCCAGG 0: 1
1: 1
2: 0
3: 13
4: 226
Right 1085515238 11:77107707-77107729 CCAGGGGGTTATCAGGGAGGCGG 0: 1
1: 0
2: 2
3: 26
4: 257

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085515228 Original CRISPR CCTGGGATGTGATCCACCAA CGG (reversed) Intronic
902921210 1:19666763-19666785 CCTGGCATGTGATGCCGCAATGG - Intronic
905455929 1:38087847-38087869 TCTGGGATGTGAGCCCCCGATGG + Intergenic
906053907 1:42899616-42899638 CCTGTGATGTGAACCATCTATGG + Intergenic
906459792 1:46028495-46028517 TCTGGCATGTGATCCCACAATGG - Intronic
907015026 1:51004383-51004405 CCTGAGATGTCATCCAGGAATGG + Intergenic
908175052 1:61547340-61547362 CCTGTGATGTGAACCATCTATGG + Intergenic
908380753 1:63594429-63594451 CCCGGGATCTGTTCCACCGACGG + Intronic
909673645 1:78214862-78214884 CCTGTGATGTGAGCCATCTATGG - Intergenic
909810949 1:79931291-79931313 CCTCTGCTGTGATTCACCAATGG - Intergenic
909948303 1:81689008-81689030 CCTGTGATGTGAACCATCTATGG + Intronic
913383477 1:118233987-118234009 CCTGTGATGTGATCCATCTTTGG - Intergenic
913972986 1:143430228-143430250 CCTGTGATGTGAACCATCTATGG + Intergenic
914067370 1:144255835-144255857 CCTGTGATGTGAACCATCTATGG + Intergenic
914111783 1:144710519-144710541 CCTGTGATGTGAACCATCTATGG - Intergenic
917319046 1:173759525-173759547 CCTGTGATGTGAACCATCTATGG - Intronic
917461635 1:175235218-175235240 CCTGTGATGTGAACCATCTATGG - Intergenic
918158419 1:181873067-181873089 CCTGTGATGTGAACCATCTATGG - Intergenic
919598485 1:199593602-199593624 CCTGTGATGTGAACCATCTATGG - Intergenic
920511339 1:206554591-206554613 CCTGAGATGTGATCGCACAAAGG - Intronic
922604580 1:226881656-226881678 CCTGGGATGTGAGTCACCTCAGG + Intronic
923648288 1:235846174-235846196 CCTGTGATGTGAACCATCTATGG - Intronic
923661683 1:235962553-235962575 CCTGTGATGTGAACCATCTATGG - Intergenic
1063346636 10:5318158-5318180 CCAGGGATGTGAGGGACCAAGGG - Intergenic
1063605949 10:7522995-7523017 CTTGGGCTGTGGGCCACCAAGGG + Intergenic
1065965762 10:30769359-30769381 CCTGGCATGGGATCCACTAGGGG - Intergenic
1066044868 10:31586291-31586313 TCTGGGATGAGATCCACTAAAGG + Intergenic
1066343983 10:34564056-34564078 GCAGGTATGTGATCCTCCAAAGG - Intronic
1066747154 10:38612074-38612096 CCTGTGATGTGAACCATCTAGGG - Intergenic
1068480833 10:57586080-57586102 CCTGTGATGTGAACCATCTATGG - Intergenic
1070569772 10:77632151-77632173 CCTGTGATGTGGCCCTCCAAAGG + Intronic
1075660556 10:124192921-124192943 CCTGTGATGTGAACCATCCATGG + Intergenic
1077263789 11:1638589-1638611 CCTGGGCTGGGCTCCACCACAGG + Intergenic
1077434805 11:2533877-2533899 CCTGGTATGTTCACCACCAAAGG - Intronic
1082903957 11:58285734-58285756 CCTGTGATGTGAACCACCTGCGG - Intergenic
1082916921 11:58446965-58446987 CCTGTGATGTGAACCATCTATGG - Intergenic
1084772331 11:71351556-71351578 CCTGGAATGTGAACTGCCAAGGG + Intergenic
1085515228 11:77107689-77107711 CCTGGGATGTGATCCACCAACGG - Intronic
1086903803 11:92396553-92396575 CCCTGGATGTTCTCCACCAATGG - Intronic
1087137040 11:94731417-94731439 CCTGGGATGAGATCCAAGAAAGG + Intronic
1088730436 11:112677046-112677068 CCTGTGATGTGAACCATCTATGG + Intergenic
1090281295 11:125458270-125458292 CCTAGGAGTTGATCCACCCATGG - Intronic
1090560794 11:127929941-127929963 CCTGTGTTGGGTTCCACCAAGGG - Intergenic
1090881456 11:130835092-130835114 CTTGGGATTTGAACCACAAAAGG + Intergenic
1090894957 11:130964066-130964088 CCTGTGATGTGAACCACAGATGG + Intergenic
1091040872 11:132280141-132280163 CCTCGGTTGAGATCCATCAAGGG - Intronic
1091596198 12:1880621-1880643 CCTTGGATGAGATCAACTAAAGG + Intronic
1094808600 12:34115288-34115310 CCTGTGATGTGAGCCATCTATGG - Intergenic
1095248123 12:39946195-39946217 CCTGTGATGTGAACCGCCTATGG + Intronic
1095285889 12:40409669-40409691 CCTAGAATGTGATCCAGAAAGGG + Intronic
1095932133 12:47637473-47637495 CCTGTGATGTGAACCATCTATGG - Intergenic
1098982621 12:76973896-76973918 CCTGTGATGTGAACCATCTATGG + Intergenic
1099777362 12:87151012-87151034 CCTGTGATGTGAACCATCTATGG + Intergenic
1102510232 12:113410219-113410241 ACTGGGAGGTGCTCCAGCAATGG - Intronic
1103761045 12:123250693-123250715 CCTGTGATGTGAACCATCTATGG + Intronic
1104504450 12:129318482-129318504 CCTGTGATGTGATCCATCTATGG + Intronic
1104850115 12:131868684-131868706 CCTGGGATGTGGTCCAGCCTTGG - Intergenic
1105908318 13:24835474-24835496 CCTGTGATGTGAACCACCTATGG - Intronic
1107184884 13:37506150-37506172 CCTGTGATGTGAACCATCTATGG - Intergenic
1107755936 13:43622585-43622607 CCTGTGATGTGAACCATCTATGG + Intronic
1107826346 13:44332098-44332120 CCTGGGCTGGGATCCAACAGGGG + Intergenic
1108927823 13:55775402-55775424 CCTGGGATTTGTTCCACAGAGGG - Intergenic
1110627624 13:77668864-77668886 CCTGTGATGTGAACCACCTGTGG - Intergenic
1110844748 13:80181544-80181566 CCTCCAATGTGATCCCCCAACGG - Intergenic
1110852567 13:80262341-80262363 CCTGTGATGTGAACCATCTATGG + Intergenic
1114030730 14:18577725-18577747 CCTGTGATGTGAACCATCTATGG + Intergenic
1114651303 14:24286313-24286335 CCTGGGATGTGATGCAGTGAAGG - Intergenic
1115041012 14:28927805-28927827 CAAGGAATGTGATTCACCAATGG - Intergenic
1115527178 14:34293080-34293102 CCTGTGATGTGAACCATCTATGG + Intronic
1117639895 14:57786568-57786590 CCTGTGATGTGAACCATCTATGG - Intronic
1120537533 14:85715395-85715417 CCTGTGATGTGAACCACCTGTGG + Intergenic
1120545718 14:85809017-85809039 CGTGTGATGTGAACCACCTATGG + Intergenic
1121009266 14:90510350-90510372 ACTGGGCTGTGCGCCACCAAAGG - Intergenic
1121435712 14:93917864-93917886 CCTGGGATGGGAGCTTCCAAGGG - Intergenic
1122625808 14:103084872-103084894 CCTGGGATGGGATCCAGAAGAGG + Intergenic
1123765384 15:23472700-23472722 CCTGTGCTGTGATTCACCTAAGG + Intergenic
1123940506 15:25214371-25214393 CCTGGCGTGTGATGCACAAATGG + Intergenic
1124387032 15:29218087-29218109 CCTGTGATGTGAACCGTCAATGG + Intronic
1125055874 15:35358722-35358744 CCTGTGATGTGAACCATCTATGG + Intronic
1125269348 15:37921305-37921327 CCTGTGATGTGAACCATCTATGG + Intergenic
1130104392 15:80918638-80918660 CCGATGATGTCATCCACCAAGGG - Intronic
1131871426 15:96768626-96768648 CTTGGGATGTGATTTACCCACGG - Intergenic
1132601008 16:772943-772965 CCTGGGAGGTGATGCTCCACTGG + Exonic
1134490707 16:14693768-14693790 CCTGAGATGTGAGACACCAGAGG - Intronic
1134496088 16:14732886-14732908 CCTGAGATGTGAGACACCAGAGG - Intronic
1136154714 16:28374944-28374966 CCTGAGATGTGAGACACCAGAGG + Intergenic
1136208378 16:28740314-28740336 CCTGAGATGTGAGACACCAGAGG - Intergenic
1136264466 16:29106990-29107012 CCTGAGATGTGAGACACCAGAGG - Intergenic
1136735913 16:32467570-32467592 CCTGTGATGTGAACCATCTATGG + Intergenic
1139487971 16:67269944-67269966 CCTGGGCTTTGTCCCACCAAAGG + Intronic
1139557732 16:67723423-67723445 CCTGAGTTGTGAGCAACCAAAGG + Exonic
1139649697 16:68356124-68356146 CCTGAGCTGTGATCCAACAAGGG - Intronic
1140056100 16:71526963-71526985 CCTGGGTTCTGATCCAGAAAAGG + Intronic
1140525129 16:75616500-75616522 CCTGAGTTGTTATCCACAAAAGG + Intronic
1141838478 16:86558935-86558957 CCTGGGATTTGAACCAGCCAGGG - Intergenic
1203017162 16_KI270728v1_random:362004-362026 CCTGTGATGTGAACCATCTATGG - Intergenic
1203035497 16_KI270728v1_random:635162-635184 CCTGTGATGTGAACCATCTATGG - Intergenic
1144139610 17:12336222-12336244 CCTGTGATGTGAACCATCTATGG + Intergenic
1146583456 17:34060146-34060168 CCTGTGATGTGAACCATCTATGG - Intronic
1146751390 17:35384588-35384610 CCTGTGATGTGAACCATCTATGG + Intergenic
1149679431 17:58495070-58495092 CCACGGATGTGATCCAGCATAGG - Exonic
1151963297 17:77418778-77418800 CCTGGGCAGTGATCCCCAAAAGG - Intronic
1152734601 17:81991269-81991291 CCTGGGAAGAGATCCAGCCAGGG - Intronic
1156011318 18:32501040-32501062 CCTGTGATGTGAACCATCTATGG + Intergenic
1156079038 18:33313061-33313083 ACTGGGATGCGCTTCACCAAAGG + Intronic
1156976866 18:43232867-43232889 CTCTGGATGTGATCCAACAAGGG + Intergenic
1159287780 18:66375405-66375427 CCTCTGCTGTGATTCACCAATGG - Intergenic
1159787144 18:72727509-72727531 CCTGTGATGTGAACCATCTATGG - Intergenic
1160086174 18:75779522-75779544 GATGGGATGTGATCTACCTACGG - Intergenic
1166107264 19:40603605-40603627 CCTGGGAGGAGATCGACTAAAGG - Intronic
1168458350 19:56533453-56533475 CCTGTGATGTGAACCACCTATGG + Intergenic
926560243 2:14408804-14408826 CCTGTGATGTGAACCATCTATGG - Intergenic
931649133 2:64453444-64453466 CCTGGGAAGTACTCCACAAAGGG + Intergenic
931993083 2:67810124-67810146 CCTGTGATGTGAACCATCTATGG - Intergenic
932270432 2:70404096-70404118 CCTGGGATGTGAACCGTCTATGG - Intergenic
934177683 2:89591184-89591206 CCTGTGATGTGAACCATCTATGG + Intergenic
934187080 2:89756680-89756702 CCTGTGATGTGAACCATCTATGG + Intergenic
934287982 2:91665485-91665507 CCTGTGATGTGAACCATCTATGG + Intergenic
934309555 2:91851245-91851267 CCTGTGATGTGAACCATCTATGG - Intergenic
936489141 2:112955586-112955608 CCTGGGCTGGGAACCACCAGAGG - Intergenic
940618626 2:156083470-156083492 CCTGTGATGTGAACCATCTATGG + Intergenic
942204599 2:173607695-173607717 GCTGGGATGTGACCCACCCAGGG - Intergenic
943513244 2:188852558-188852580 CCTGGCAGGTGGTCCATCAAAGG - Intergenic
944873988 2:203943495-203943517 CCTGTGATGTGAACCATCTATGG + Intronic
946036519 2:216746602-216746624 CCTGTGATGTGAACCATCTATGG - Intergenic
946994484 2:225375784-225375806 TCTGGGATCTGATCCAACAAGGG - Intergenic
947457014 2:230264812-230264834 CCTGTGATGTGAACCATCTATGG + Intronic
1170573653 20:17647055-17647077 CCTGGGATGGGCCCCACAAAAGG + Intronic
1177174376 21:17688871-17688893 CCTGTGATGTGAACCATCTATGG + Intergenic
1179653363 21:42829624-42829646 CCTGGCCTGTGATCATCCAAGGG + Intergenic
1180454844 22:15504781-15504803 CCTGTGATGTGAACCATCTATGG + Intergenic
1180536649 22:16398382-16398404 CCTGTGATGTGAACCATCTATGG - Intergenic
1181767135 22:25100099-25100121 TCTGGGACGTGATTCCCCAAGGG - Intronic
1183048306 22:35240092-35240114 CCTGTGATGTGAACCATCTATGG + Intergenic
949814324 3:8041446-8041468 CCTGTGATGTGAACCATCTATGG - Intergenic
950592343 3:13947543-13947565 CCTGTGATGTGAACCATCTATGG + Intronic
951269679 3:20608656-20608678 CCTGTGATGTGAACCATCTATGG - Intergenic
951814746 3:26741656-26741678 CATGGAAAGTAATCCACCAAAGG - Intergenic
951851962 3:27151307-27151329 CCTGTGATGTGAACCATCTATGG - Intronic
953032511 3:39187751-39187773 CCCTGGAGATGATCCACCAACGG - Exonic
953723894 3:45381230-45381252 CCTGTGATGTGAACCATCTATGG + Intergenic
954455965 3:50600033-50600055 CCGGGGGTGTGAAGCACCAAGGG - Intergenic
956595782 3:70965623-70965645 CCTGGGATGTGATAAAGCAGAGG + Intronic
956995625 3:74824184-74824206 CCTGTGATGTGAACCATCTATGG + Intergenic
958262921 3:91403811-91403833 CCTGTGATGTGAACCATCTATGG + Intergenic
958969878 3:100600308-100600330 CCTGTGATGTGAACCATCTATGG + Intergenic
959439500 3:106359106-106359128 CCTCGGCTGTGATTCACCTATGG - Intergenic
959756916 3:109910524-109910546 CCTGTGATGTGAACCATCTATGG + Intergenic
965923187 3:173944527-173944549 CCTAGGATGTTTGCCACCAAGGG + Intronic
972189012 4:36568280-36568302 CCTGTGATGTGAACCATCTATGG + Intergenic
975766784 4:77677008-77677030 CAGGGGAAGTCATCCACCAAGGG - Intergenic
975772098 4:77737203-77737225 GTTGGGATGTGATCCAGAAAGGG - Intronic
976686282 4:87819140-87819162 CCTGTGATGTGAACCATCTATGG + Intergenic
977733276 4:100380290-100380312 CCTGTGATGTGAACCATCTATGG - Intergenic
978726627 4:111977272-111977294 CCTGGGATGTGAACCATCTACGG + Intergenic
979638438 4:122983783-122983805 CCTGTGATGTGAACCATCTATGG - Intronic
980002626 4:127508307-127508329 CCTGGGTTGTCCTCCACCACTGG - Intergenic
982218709 4:153106752-153106774 CCTGTGATGTGAACCATCTATGG + Intergenic
982680083 4:158418724-158418746 CCTGTGATGTGAACCATCTATGG + Intronic
982976895 4:162075162-162075184 CCTAGGATGTGTCCCATCAATGG + Intronic
983449849 4:167895808-167895830 CCTGTGATGTGAACCATCTATGG - Intergenic
984022733 4:174505617-174505639 CCTTGTATTTTATCCACCAACGG - Intronic
989533740 5:42539508-42539530 CCTGTGATGTGAACCATCTATGG + Intronic
989761781 5:45024175-45024197 CCTGGGAGGTGGTGCATCAAAGG - Intergenic
993250274 5:85512942-85512964 CCTGTGATGTGAACCAACTATGG + Intergenic
995674575 5:114648940-114648962 GCTGGGATGTGATCCACCAAGGG + Intergenic
996124083 5:119705776-119705798 CCTGTGATGTGAACCATCTATGG + Intergenic
1001589371 5:172855082-172855104 CCTGGGCTGTGTTCCCCCAACGG + Intronic
1002195944 5:177501365-177501387 CCTGGGATTTGAGCTGCCAAGGG + Intergenic
1002304235 5:178273937-178273959 CCTGGGCTGTGAACCTCCAGGGG + Intronic
1002813913 6:660454-660476 CCTGTGATGTGAACCATCTATGG - Intronic
1003711871 6:8602070-8602092 CCTGTGATGTGAACCATCTATGG - Intergenic
1004828312 6:19448663-19448685 CCTGTGATGTGATCCCTCAAAGG + Intergenic
1005191360 6:23228144-23228166 CCTGTGATGTGAACCATCTATGG + Intergenic
1005760330 6:28961575-28961597 CCTGTGATGTGAACCATCTATGG - Intergenic
1010854111 6:80815491-80815513 CCTGAGTTGTGATTCACCTATGG + Intergenic
1011789665 6:90885126-90885148 ACTGGGATGTGAACCGCCTATGG + Intergenic
1012208304 6:96489087-96489109 CCTGTGATGTGAACCATCTATGG + Intergenic
1012737891 6:102974045-102974067 CCTGTGATGTGAACCATCTATGG - Intergenic
1013852575 6:114534281-114534303 CCTGTGATGTGAACCATCTATGG + Intergenic
1014285026 6:119487380-119487402 CCTGTGATGTGAACCATCTATGG - Intergenic
1015849726 6:137559802-137559824 CCTGTGATGTGAACCATCTATGG + Intergenic
1017383429 6:153856864-153856886 CCTGGCATGGGATCCACTAGGGG - Intergenic
1018009471 6:159656091-159656113 CCTGTGATGTGAACCATCTATGG - Intergenic
1018114887 6:160573762-160573784 CCTGTGATGTGAACCATCTATGG + Intronic
1018377451 6:163226717-163226739 ACTGGGATGTGAGCCACCGATGG - Intronic
1018665698 6:166135451-166135473 CCTGTGATGTGAACCACCTGTGG - Intergenic
1019652090 7:2165467-2165489 TCTGGGATGCGAGCCACCATGGG + Intronic
1019694309 7:2436641-2436663 CCGGGGAGGTGCTCCAGCAAAGG - Intergenic
1020710339 7:11597551-11597573 CCTCTGATGTGATTCACCTATGG - Intronic
1020860846 7:13489885-13489907 CCTGTGATGTGAACCATCTATGG - Intergenic
1024917166 7:54514904-54514926 CCTGTGATGTGAACCATCTATGG + Intergenic
1026098262 7:67364472-67364494 CCTGGCGTGTGATCCACTAGGGG - Intergenic
1026828738 7:73599289-73599311 CATGGAATGGGCTCCACCAAGGG - Intronic
1027350391 7:77306042-77306064 CCTGTGATGTGAACCATCTATGG + Intronic
1027417589 7:77989899-77989921 CCTGTGATGTGAACCATCTATGG + Intergenic
1028182893 7:87747313-87747335 CCTGTGATGTGAGCCATCTATGG + Intronic
1028818351 7:95176156-95176178 CCTGTGATGTGAACCATCTATGG - Intronic
1028993512 7:97075631-97075653 CCTGTGATGTGAACCATCTACGG + Intergenic
1030861484 7:114637048-114637070 GCTGGGATGTGACCGACCACAGG - Intronic
1031879283 7:127177651-127177673 CCTGTGATGTGAACCATCTATGG - Intronic
1033076248 7:138252970-138252992 CCTCCGCTGTGATTCACCAATGG - Intergenic
1033455149 7:141496316-141496338 CCTGGTATGTGATCCATATAAGG + Intergenic
1033961519 7:146919524-146919546 CCTGTGATGTGATCCATCTTCGG + Intronic
1034782870 7:153897391-153897413 CCTTGGATGTGTTCCAGCAGAGG - Intronic
1034930805 7:155161779-155161801 TCTGTGATGTGTTCCACCATTGG - Intergenic
1035516480 8:237950-237972 CTAAGGATGAGATCCACCAATGG - Intronic
1038367143 8:26948084-26948106 CCTGTGATGTGAACCATCTATGG + Intergenic
1040454598 8:47583876-47583898 ACTCGGATGTGATGCTCCAAGGG - Intronic
1041364237 8:57083929-57083951 CCTGTGATGTGAACCGCCTATGG - Intergenic
1041570480 8:59332753-59332775 CTTGTGATGTGAACCACCTATGG + Intergenic
1041877923 8:62712077-62712099 CCTGTGATGTGAACCATCTATGG + Intronic
1043048114 8:75352739-75352761 CCTGTGATGTGAACCATCTATGG - Intergenic
1043071649 8:75643304-75643326 CCTGTGATGTGAACCATCTATGG + Intergenic
1043270762 8:78330067-78330089 CCTGTGATGTGAACCATCTATGG - Intergenic
1045779887 8:105850130-105850152 CCTGTGATGTGAACCATCTATGG - Intergenic
1048970873 8:139644424-139644446 CGTGGGCTGTGATCCATTAATGG - Intronic
1050286576 9:4108901-4108923 CCTGGGGTTTGAGCCACCCAAGG - Intronic
1050502749 9:6315607-6315629 CCTGTGATGTGAACCATCTATGG - Intergenic
1050788384 9:9434098-9434120 TCTGGAATGTGATCAACAAATGG + Intronic
1058774775 9:108272660-108272682 CCTGGGGTCTGATCCTGCAATGG - Intergenic
1059381452 9:113930062-113930084 CCTAGGTTGTGATAAACCAATGG + Intronic
1062077455 9:134598637-134598659 CATGGGCTGTGATCCACCGAGGG - Intergenic
1188309598 X:28600047-28600069 ACTCGGCTGTGAGCCACCAACGG + Intronic
1190897245 X:54633084-54633106 CCTGTGATGTGATCCATCTTCGG + Intergenic
1191779820 X:64853645-64853667 CCTGTGATGTGAACCATCTATGG + Intergenic
1191903510 X:66064035-66064057 CCTGTGATGTGAACCATCTATGG + Intergenic
1192014559 X:67315626-67315648 CCTGTGATGTGAACCATCTATGG + Intergenic
1192981784 X:76351721-76351743 CCTGGGGAGTGCTCCACCAGTGG - Intergenic
1193154654 X:78159213-78159235 CCTGTGATGTGAACCATCTATGG - Intergenic
1193253339 X:79319147-79319169 CCTGTGATGTGAACCATCTATGG + Intergenic
1193420873 X:81280472-81280494 CCTGCGATGTGAACCATCTATGG - Intronic
1193578581 X:83233150-83233172 CCTGTGATGTGAACCATCTATGG - Intergenic
1193865562 X:86726315-86726337 ACTGGGCTGTGCCCCACCAATGG - Intronic
1194701428 X:97119391-97119413 CCTGTGATGTGAACCATCTATGG + Intronic
1195446642 X:104959638-104959660 CATGGGATGTGATCCCCAATTGG - Intronic
1196170955 X:112587912-112587934 CCTGTGATGTGAACCATCTATGG - Intergenic
1196218964 X:113088709-113088731 CCTGTGATGTGAACCATCTATGG - Intergenic
1196737551 X:118992823-118992845 CCTGTGATGTGAGCCATCTATGG - Intronic
1197102535 X:122673311-122673333 CCTGTGATGTGAACCATCTATGG - Intergenic
1197591857 X:128419309-128419331 CCTCTGCTGTGATTCACCAATGG - Intergenic
1197953755 X:131924182-131924204 CCTGTGATGTGAACCATCTATGG - Intergenic