ID: 1085516692

View in Genome Browser
Species Human (GRCh38)
Location 11:77115906-77115928
Sequence CCAAGATGGGAGTGGAGCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 380
Summary {0: 1, 1: 0, 2: 2, 3: 36, 4: 341}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085516683_1085516692 8 Left 1085516683 11:77115875-77115897 CCTCTGTGCTTGGCTTATGGCCC 0: 1
1: 0
2: 7
3: 56
4: 461
Right 1085516692 11:77115906-77115928 CCAAGATGGGAGTGGAGCCCAGG 0: 1
1: 0
2: 2
3: 36
4: 341
1085516680_1085516692 27 Left 1085516680 11:77115856-77115878 CCTGAGCAAATGGGGGACTCCTC 0: 1
1: 0
2: 1
3: 6
4: 86
Right 1085516692 11:77115906-77115928 CCAAGATGGGAGTGGAGCCCAGG 0: 1
1: 0
2: 2
3: 36
4: 341
1085516679_1085516692 28 Left 1085516679 11:77115855-77115877 CCCTGAGCAAATGGGGGACTCCT 0: 1
1: 0
2: 0
3: 4
4: 124
Right 1085516692 11:77115906-77115928 CCAAGATGGGAGTGGAGCCCAGG 0: 1
1: 0
2: 2
3: 36
4: 341

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085516692 Original CRISPR CCAAGATGGGAGTGGAGCCC AGG Intronic
900272134 1:1796394-1796416 CCATGCTGACAGTGGAGCCCAGG - Intronic
900491625 1:2952168-2952190 CCTGGACGGGAGTGGAGCACAGG + Intergenic
901850225 1:12010424-12010446 CCAGGCTAGGAGGGGAGCCCAGG + Intronic
902199903 1:14825651-14825673 CCACGTTGGGATTGGAACCCAGG + Intronic
903229053 1:21910954-21910976 CCAAGCTGGGAGTCAAGCCCAGG + Intronic
903278426 1:22236319-22236341 CCAGGCTGGTACTGGAGCCCAGG - Intergenic
904440320 1:30525657-30525679 CACAGCTGGGACTGGAGCCCAGG + Intergenic
905473825 1:38211992-38212014 CCAAGGTGGGAGTGTGCCCCTGG - Intergenic
905694263 1:39963224-39963246 CCAGGGTGGCAGTGCAGCCCCGG - Intronic
906045812 1:42830307-42830329 CAGAGCTGGGATTGGAGCCCCGG + Intronic
906949999 1:50326809-50326831 CCAGGGTGGCAGTGCAGCCCCGG - Intergenic
907399738 1:54217522-54217544 GCAAGATCGGGCTGGAGCCCAGG - Intronic
907675246 1:56511935-56511957 TCAATATGCAAGTGGAGCCCTGG - Intronic
908679351 1:66642259-66642281 CCAAGATGGGAGTGGACACTGGG - Intronic
909204923 1:72743694-72743716 CCAAGATGGGGCTGGAGGACTGG + Intergenic
909695798 1:78466303-78466325 CCAGGATTGGTGTGGAGCCAAGG - Intronic
910442044 1:87262816-87262838 CAAAGCTGGGAGTGCATCCCAGG - Intergenic
910734546 1:90438238-90438260 CCATGATGAGTGTGGAGCCATGG + Intergenic
912019962 1:105096019-105096041 CCAAGATGGGAGGTGACTCCAGG + Intergenic
913683236 1:121206851-121206873 CCGAGATGGGTGTGGGGCCTAGG + Intronic
914035078 1:143994476-143994498 CCGAGATGGGTGTGGGGCCTAGG + Intergenic
914154375 1:145073495-145073517 CCGAGATGGGTGTGGGGCCTAGG - Intronic
915271857 1:154759197-154759219 CCAAGCTGGCAGTGGAGGGCAGG + Intronic
915932157 1:160067548-160067570 CCAGGATAGCAGTGGGGCCCTGG - Intronic
916102768 1:161406883-161406905 CCAGGGTGGCAGTGCAGCCCTGG - Intergenic
917439393 1:175053702-175053724 TCTAGATGAGATTGGAGCCCAGG + Intergenic
918071625 1:181137488-181137510 CCAAGAGGGGAATGGAACCTGGG - Intergenic
918341300 1:183569980-183570002 CCATGAGGGGAATGCAGCCCAGG - Intronic
918991322 1:191700462-191700484 CCAAGAGGGAAGTTAAGCCCAGG + Intergenic
919476968 1:198041120-198041142 ACAAGAAGGAAGTGGTGCCCAGG + Intergenic
920286936 1:204886756-204886778 CAAAGTTGGAACTGGAGCCCAGG + Intronic
920396352 1:205648812-205648834 CCCAGAGGTGGGTGGAGCCCTGG - Intergenic
920470546 1:206225361-206225383 CCGAGATGGGTGTGGGGCCTAGG + Intronic
920831265 1:209467659-209467681 CTAAGATGGGAGTGGGGTTCAGG + Intergenic
921565404 1:216711304-216711326 CCGAGTTGGCAGTGGAGCCGAGG - Intronic
1063226079 10:4016295-4016317 CCAATATGGGAGTGCTGGCCGGG + Intergenic
1064384359 10:14878025-14878047 ACAACATGGGAGGGGAGCTCGGG + Intergenic
1066448238 10:35503771-35503793 CCAAGTAGACAGTGGAGCCCGGG + Intronic
1066687485 10:37994504-37994526 CACAGATGGGAGTGGGGCCAGGG + Intergenic
1067029973 10:42873345-42873367 CCAAGGTGGTATTGGAGCCAGGG + Intergenic
1067031266 10:42879849-42879871 CCAAGAAGGGAGGGGGGCACAGG + Intergenic
1067568337 10:47353836-47353858 GTAAGAGGGGAGTGGGGCCCAGG - Intronic
1068984816 10:63097799-63097821 CTGAGATGGGACTTGAGCCCAGG - Intergenic
1069690564 10:70348984-70349006 CCAAGATGTGACTGGGGGCCAGG + Intronic
1070559668 10:77556690-77556712 TCAAGATGAGCGTGGATCCCTGG + Intronic
1070568370 10:77620905-77620927 CCAGGATGTGAGTGGCGCCCTGG + Intronic
1070757849 10:79004715-79004737 CAGAGATGGGAATTGAGCCCAGG + Intergenic
1070829076 10:79407752-79407774 CAGAGCTGGGAGTGGAGCGCAGG + Intronic
1070953548 10:80449795-80449817 CCAGGGTGGGAGTGCAGCACTGG + Intergenic
1071074267 10:81732519-81732541 ACAAGCCGGGAGTGGATCCCTGG - Intergenic
1071477125 10:86034640-86034662 CCTAGATGCCAGGGGAGCCCAGG - Intronic
1072305494 10:94102720-94102742 AGGAGATGGGAGTGCAGCCCAGG - Intronic
1073111607 10:101066217-101066239 CCAGGATCCGGGTGGAGCCCTGG - Intronic
1073267082 10:102234286-102234308 CCAGGTTGGGAGTGGAACCGAGG + Intronic
1073295511 10:102436063-102436085 CCAAGATAGGAGCCCAGCCCAGG - Intergenic
1074455968 10:113595309-113595331 CCATGAGGGGAGTGGTCCCCTGG - Intronic
1076725985 10:132413605-132413627 CCAGGACGGGAGTGGACCCAGGG - Intronic
1076785223 10:132746154-132746176 CCAGGTAGAGAGTGGAGCCCAGG + Intronic
1078143882 11:8710173-8710195 CCAAGCTGGGAGTGCAGCAGGGG + Intronic
1078351776 11:10600888-10600910 CCAAGATGGGGCAGGAGCCTAGG + Intronic
1078394807 11:10971731-10971753 GCAAGGTGGGACTGGAACCCAGG - Intergenic
1078471207 11:11588248-11588270 CCAATAGGGGAGTGGAGACATGG - Intronic
1078642483 11:13109347-13109369 CCCAGATCTGAGTGGGGCCCAGG + Intergenic
1078656894 11:13249551-13249573 CAAAGCTGGGATTTGAGCCCAGG + Intergenic
1079027756 11:16962187-16962209 CAAAGATGGGATTGGAATCCAGG - Intronic
1079058686 11:17228947-17228969 CCAGGGTGGCAGTGCAGCCCCGG - Intronic
1079100497 11:17538696-17538718 GCCAGAGGGGAGAGGAGCCCAGG - Intronic
1079224095 11:18589957-18589979 GTAAGATGGGAGTGGAGACAAGG + Intergenic
1079303803 11:19304609-19304631 CCAATATTGGAGTGGGGGCCTGG - Intergenic
1079391269 11:20024022-20024044 CAAAGCTGGGATTGGAACCCAGG + Intronic
1080299192 11:30765440-30765462 CCACTCTGGGAGTGGGGCCCAGG - Intergenic
1081648328 11:44805494-44805516 TCAAGATGAGATTGGGGCCCTGG + Intronic
1083182472 11:60996080-60996102 CCAAGCTGGGAATTGAACCCAGG - Intronic
1083343694 11:61975058-61975080 CCAAGGTGTGAGGGGAACCCTGG - Intergenic
1085245037 11:75094201-75094223 CAGAGATAGGACTGGAGCCCAGG + Intergenic
1085516692 11:77115906-77115928 CCAAGATGGGAGTGGAGCCCAGG + Intronic
1085765385 11:79277484-79277506 CAAAGATGGGATTTGAACCCAGG + Intronic
1089523550 11:119081719-119081741 ATTAGATGAGAGTGGAGCCCTGG - Exonic
1090021117 11:123129810-123129832 CAAAGTTGGGACTGGAACCCAGG + Intronic
1090977536 11:131690146-131690168 CCAAGATGGCAGAGAAGGCCTGG + Intronic
1091901652 12:4148889-4148911 CAGAGAAGGGAGTGGACCCCTGG - Intergenic
1092104199 12:5909565-5909587 CCAAGAAGGGAGCTGAGCACTGG - Intronic
1092284694 12:7121961-7121983 CCAAGATGTGAGTGGAGAAAGGG - Intergenic
1095367986 12:41430952-41430974 GCAAGATGGGAGTGGTGCTACGG + Intronic
1096243556 12:49972306-49972328 CCAAGAAGGGAGGGGAGCGCGGG + Intronic
1101294773 12:103410476-103410498 CCAAGTGGGGAGTGGCTCCCTGG + Intronic
1101343947 12:103867538-103867560 CCAAAATGCCAGTGGAGCCCAGG - Intergenic
1101559938 12:105847244-105847266 TCAGGATGGGAGTGGAACCCTGG + Intergenic
1101708328 12:107241620-107241642 CACAGTTGGGATTGGAGCCCAGG - Intergenic
1101940326 12:109095063-109095085 CTGAGGTGGGAGTGGAGCCTGGG - Intergenic
1102149101 12:110676407-110676429 CCCAGATGCCAGTGGAGGCCAGG - Intronic
1102457460 12:113079484-113079506 CCAAGAGGGGATTCGAACCCAGG - Intronic
1102600798 12:114028816-114028838 CCAAGCTGGGATTTGAACCCAGG + Intergenic
1102986819 12:117285101-117285123 CCAAGCTGGGAGAGGTGTCCTGG - Intronic
1103107961 12:118246761-118246783 CCAGGGTGGCAGTGCAGCCCCGG - Intronic
1103316045 12:120056771-120056793 CCTAGATGGATGTGGAGACCTGG + Intronic
1103931538 12:124453355-124453377 CCTAGATGCGTGTGGAGCCTGGG + Intronic
1104428149 12:128694883-128694905 CAGAGATTGGATTGGAGCCCAGG - Intronic
1104626607 12:130361343-130361365 GCAAGATGGGAGGAGAGCTCTGG + Exonic
1104807532 12:131599058-131599080 CCAGGAGGGGAGTGGAGGGCTGG - Intergenic
1104947870 12:132424923-132424945 CAATGAGGGGAGTGGGGCCCAGG - Intergenic
1104983317 12:132583382-132583404 CCAAGAGGGCGGCGGAGCCCGGG - Exonic
1106025050 13:25948498-25948520 CAGAGCTGGGATTGGAGCCCCGG + Intronic
1106249957 13:27975808-27975830 CCGAGGCGGGAGAGGAGCCCCGG - Intergenic
1111562222 13:89966623-89966645 CCAAGATGGGAAAGGGTCCCTGG + Intergenic
1112326240 13:98444370-98444392 CCAAGAAGGGAGAGGAGCGGTGG + Intronic
1113521595 13:110945949-110945971 CCAAGTTGGGATTGGAACCCAGG + Intergenic
1113709893 13:112456279-112456301 CAGAGATGTGGGTGGAGCCCCGG + Intergenic
1114616259 14:24069921-24069943 CCAAGATGGGTGTTATGCCCAGG + Intergenic
1119403112 14:74377905-74377927 CCAGGGTGGCAGTGCAGCCCTGG + Intergenic
1119908149 14:78324102-78324124 CCGAGCTGGGATTGGAACCCAGG + Intronic
1121653013 14:95573908-95573930 CCCAGATGGCAAAGGAGCCCGGG - Intergenic
1122078985 14:99254004-99254026 CTCAGCAGGGAGTGGAGCCCTGG + Intronic
1122242077 14:100375802-100375824 CCAAGCTGGGATTGAAACCCAGG - Intronic
1122289709 14:100673869-100673891 CCAAGGTTGGGGTGGAGGCCTGG - Intergenic
1122635748 14:103128887-103128909 CCAAGCTGGGCATGGAGCCCTGG + Intronic
1122912165 14:104836176-104836198 CCAGGGTGGCAGTGCAGCCCCGG + Intergenic
1122916863 14:104863543-104863565 CCAAGAAGGTAGAGAAGCCCTGG + Intergenic
1124134239 15:27020057-27020079 TCAAGATGAGAGTGGAGGGCCGG - Intronic
1124822959 15:33066174-33066196 GCAAGATGGCAGTATAGCCCAGG - Intronic
1125553485 15:40565263-40565285 CCAAGCAGGGACTGGAACCCTGG - Intergenic
1128671609 15:69578111-69578133 CCTAGATGGGGGTGGAGGGCTGG + Intergenic
1129185660 15:73904651-73904673 CCAAGATAGATGTGGAGCCAGGG + Intergenic
1130880391 15:88050360-88050382 CCAAGATGGGAATGGTACCTAGG - Intronic
1132024099 15:98390460-98390482 CCAGGATGGGATTTGAACCCAGG - Intergenic
1132120771 15:99173355-99173377 CCAAGATGGGAGGGTAGCCTAGG + Intronic
1132405158 15:101537391-101537413 CCAGCATGAGAGGGGAGCCCGGG - Intergenic
1132837657 16:1962506-1962528 CCAGGGTGGCAGTGCAGCCCCGG + Exonic
1133564337 16:6978923-6978945 CCAAGATGGGTGTGGTCCCCAGG - Intronic
1134093303 16:11402952-11402974 CCAAGATGGAAGGAGAGCACAGG - Intronic
1134098625 16:11436081-11436103 ACAAGATGGGACTGTACCCCTGG - Intronic
1134262046 16:12659066-12659088 GCATCATGGGAGTGCAGCCCAGG - Intergenic
1134629740 16:15748179-15748201 CAAAGAGGGCAGTGGATCCCTGG + Intronic
1136453752 16:30369427-30369449 CCAGGCTGGACGTGGAGCCCAGG + Exonic
1136655675 16:31707807-31707829 CCAAGATGGGAGAGGCAACCAGG - Intergenic
1136683137 16:31979332-31979354 CCAGCAAGGGAGTGGAGGCCTGG - Intergenic
1136783771 16:32922888-32922910 CCAGCAAGGGAGTGGAGGCCTGG - Intergenic
1136886013 16:33930918-33930940 CCAGCAAGGGAGTGGAGGCCTGG + Intergenic
1136910600 16:34141566-34141588 CCACGGTGGGGCTGGAGCCCCGG - Intergenic
1137435081 16:48448268-48448290 CCTAGCAGGCAGTGGAGCCCAGG - Intronic
1137512824 16:49116209-49116231 CAAAGATGGGGGTGGATCCGTGG + Intergenic
1137986593 16:53113933-53113955 CCAAGGTGGGAGGTGAGGCCAGG - Intronic
1138341051 16:56289345-56289367 CTAAGACGGGAGTATAGCCCAGG + Intronic
1138803457 16:60063657-60063679 CCTGGATGGAAGTGGAGTCCTGG - Intergenic
1139939587 16:70595611-70595633 ACAAAATGAGAGAGGAGCCCTGG - Intronic
1140563114 16:76007628-76007650 CCATGATGGGAGTGGAGTTGAGG + Intergenic
1141097353 16:81172312-81172334 CCAAGACAGGAGTGGAGGGCTGG - Intergenic
1141773560 16:86106471-86106493 CAAAGATGGGATTTGAACCCAGG - Intergenic
1142003988 16:87680378-87680400 CCCAGAAGGAAGCGGAGCCCTGG + Intronic
1142224616 16:88871532-88871554 CCAAAATGGGGCTGGGGCCCTGG - Intergenic
1203086428 16_KI270728v1_random:1186890-1186912 CCAGCAAGGGAGTGGAGGCCTGG - Intergenic
1142494125 17:297226-297248 GCCAGATGGGAGAGGTGCCCTGG - Intronic
1142672945 17:1495799-1495821 CCAGGATGGGAGTGAATCCCAGG - Exonic
1142978838 17:3660052-3660074 CCCAGGTGGGGGTGGAGCCCTGG - Intronic
1143423108 17:6811711-6811733 GCACGGTGGGAGTGGAGCCCAGG - Intronic
1143504499 17:7356273-7356295 CCAAGATGGGCGTGAGGACCTGG - Exonic
1144269522 17:13602354-13602376 CCAAGAGGGGAGCAGAGCGCGGG - Intergenic
1144779709 17:17801678-17801700 CCATGCTGGGAGTGGGGCCTGGG - Intronic
1144952530 17:19001938-19001960 TCAAGATGGAAGTGGAGGCTGGG + Intronic
1144956773 17:19022640-19022662 CATAGATAGGAGTGGAGCCCAGG - Intronic
1145022899 17:19446152-19446174 CCAGGGTGGCAGTGCAGCCCCGG + Intergenic
1145242012 17:21245638-21245660 CCAAGATGACGCTGGAGCCCAGG + Intronic
1147120108 17:38330742-38330764 CCAAGATGGGGGTAGAAACCTGG + Exonic
1147144046 17:38475041-38475063 CCAGCAAGGGAGTGGAGGCCTGG - Intronic
1147416017 17:40290463-40290485 CCAAGATGTCAGTGGTGCCAAGG + Intronic
1148747664 17:49927556-49927578 CCTAGATGGGAGAGGATCCCTGG + Intergenic
1148876457 17:50690208-50690230 CCAAGATGGGGGTGGAGAACAGG + Intronic
1149166268 17:53757171-53757193 CCAGGGTGGCAGTGCAGCCCCGG + Intergenic
1149336326 17:55640023-55640045 CCAAGATGTCAGTGGTGCCAAGG + Intergenic
1149682802 17:58517637-58517659 CCAGGTTGGCAGGGGAGCCCAGG + Intronic
1150182596 17:63140603-63140625 CCTAGAAGGGAATGGAGACCAGG + Intronic
1150441774 17:65197140-65197162 CCAAGATGCGAGTGGAACGATGG + Exonic
1151768777 17:76146193-76146215 GTAAACTGGGAGTGGAGCCCAGG - Intronic
1152322779 17:79617479-79617501 CCAAGGAGGGAGTGCAGGCCTGG - Intergenic
1152700528 17:81816318-81816340 CTAAAATGAGAGTGGAGACCAGG + Intergenic
1153821748 18:8838004-8838026 CCAAGGTAGGAGAGGAGCCTGGG - Intergenic
1154024826 18:10697247-10697269 GCCAGCTGGGAGTGGAGCCCTGG - Intronic
1155223190 18:23703960-23703982 CCAAGTTAGGAAGGGAGCCCAGG + Intronic
1156298877 18:35818070-35818092 CCAAGATTGGAGTGGGTGCCAGG + Intergenic
1156362829 18:36399526-36399548 CCAAGATAAGAGTGGAGCTCTGG - Intronic
1156512811 18:37655355-37655377 CCAAGCTGGGAGTCAAGCTCTGG + Intergenic
1160477109 18:79201511-79201533 CTGAGGTGGGAGTTGAGCCCAGG + Intronic
1160770689 19:829383-829405 TCAAGATGGGAAGGGGGCCCTGG + Intronic
1160918347 19:1508206-1508228 GGAAGATGGGGGTGGAGCCTAGG + Intronic
1160924560 19:1537347-1537369 GCCAGCTGGGACTGGAGCCCCGG - Intergenic
1162084609 19:8240958-8240980 CCAAGCTGGGAGTGGGGCCAGGG + Intronic
1162506753 19:11090321-11090343 TCAGGATGGCAGTGGCGCCCTGG - Intronic
1162573354 19:11484997-11485019 CCAAGATCGGATTCCAGCCCGGG + Intronic
1162674063 19:12284981-12285003 CCAGGATGGCAGTGCAGCCCCGG - Intronic
1162799742 19:13103826-13103848 CCAGGAATGGGGTGGAGCCCAGG + Intergenic
1162948757 19:14058422-14058444 CCAAAATGGGGGTGCAGCCATGG + Intronic
1163447264 19:17353977-17353999 TTAAGATGGGAGTCCAGCCCTGG - Intronic
1163634565 19:18432066-18432088 CCCAGGTAAGAGTGGAGCCCTGG + Exonic
1164685061 19:30161138-30161160 CAGAGCTGGGACTGGAGCCCAGG + Intergenic
1165829414 19:38723147-38723169 TTGAGATGGGAATGGAGCCCAGG + Intronic
1166105950 19:40598161-40598183 CCCAGGCGGGAGAGGAGCCCGGG - Intronic
1166225527 19:41392766-41392788 CCAAGCGGGGAGTGGAGACTCGG + Intronic
1166308240 19:41947447-41947469 CCTAGGTGGGACTTGAGCCCGGG + Intergenic
1166518347 19:43463525-43463547 CCAAGATAGAGGTGGAGCCGTGG - Intronic
1167457624 19:49605738-49605760 CCAACCTGGGATTGGAGCCAGGG + Intronic
1167575102 19:50314237-50314259 CCCAGATCGGAGTTGAGCTCAGG - Intronic
1168302492 19:55414101-55414123 CCAAGTTGGGAGAGGTGGCCGGG + Intergenic
1168642005 19:58037058-58037080 CCAAGCTGGGGGTGGAGACCAGG - Intronic
1168682278 19:58324727-58324749 TCAAGATGAGAGTGGAGTCAGGG - Intergenic
925148030 2:1594027-1594049 CAGAGATGGGAGTGGGGCCCAGG - Intergenic
925412203 2:3646262-3646284 CCCTGAAGGGAGTGGAGCCCAGG + Intergenic
925601419 2:5612022-5612044 CCAAGATGGCAGAGGACACCTGG + Intergenic
925903655 2:8526188-8526210 CCAAGCAGGAAGTGGAGCGCAGG - Intergenic
926143097 2:10380296-10380318 CTAAGATGGGGGCTGAGCCCAGG - Intronic
927072853 2:19548334-19548356 CCAAGATGGGAGTAGGCACCTGG - Intergenic
928308039 2:30187368-30187390 CCAGGGTGGCAGTGCAGCCCCGG - Intergenic
929715784 2:44308039-44308061 CTGAGGTGGGAGTTGAGCCCAGG + Intronic
931220663 2:60285644-60285666 CCAAGATGTGGCTGGAGCCCTGG - Intergenic
931960013 2:67471876-67471898 CCACACTGGGAGTGGAGTCCAGG - Intergenic
932315747 2:70780962-70780984 CCATGAAAGGAGTGGAGGCCTGG + Intronic
932522361 2:72427449-72427471 CCGAGATGGGAGTGGGCACCAGG - Intronic
933659602 2:84916461-84916483 CCAGGGTGGCAGTGCAGCCCCGG - Intergenic
934059590 2:88281804-88281826 CCAAGCTGGGATTCGAACCCAGG - Intergenic
934675748 2:96248626-96248648 CCAAGAGGGAAGTGAAGCCATGG + Exonic
937427431 2:121811964-121811986 AGAAGATGGGAGAGGAGCCCTGG - Intergenic
938566563 2:132524029-132524051 AGAAACTGGGAGTGGAGCCCAGG + Intronic
941203240 2:162540885-162540907 CCAAGATGGCAGTTTGGCCCAGG + Intronic
945612043 2:212015522-212015544 CCAGGAGGGGAGTGGAGCTAAGG - Intronic
946099482 2:217307186-217307208 CCAAGAAGTGAGTGAAGCCTGGG - Intronic
946403487 2:219480977-219480999 ACTAGATGGGAGTGGAGCTCAGG + Intronic
948342433 2:237265129-237265151 CCAAGAGGCGAGAGGAGCCCAGG - Intergenic
948749339 2:240121917-240121939 CCAAGATGGACGTGGCGCGCTGG - Intergenic
948825511 2:240571837-240571859 GCAAGCAGGGAGTGGAGGCCAGG - Intronic
948921082 2:241066207-241066229 CCAAGATTGCAGGGGAGGCCCGG + Intronic
1169052930 20:2595780-2595802 CCAGGAGAGGAGTGGAGCACTGG + Intronic
1169464318 20:5823962-5823984 CAAGCATGGGACTGGAGCCCAGG - Intronic
1172941398 20:38656984-38657006 CCAAGGTAGTAGTGGAGCCCAGG + Intergenic
1173768906 20:45640671-45640693 CCAGGGTGGCAGTGCAGCCCCGG + Intergenic
1174124263 20:48291121-48291143 CCAGGATGGGAGTGAATCTCTGG - Intergenic
1174401990 20:50280909-50280931 CAAAGCTGGGATTGGAACCCAGG - Intergenic
1175537390 20:59724280-59724302 CCAAGACCGGAGTGGTCCCCAGG + Intronic
1175598951 20:60257199-60257221 CCGAGCTGGAAATGGAGCCCAGG + Intergenic
1176304671 21:5117135-5117157 CCATGATGGGATCGGAGCCATGG - Exonic
1176973904 21:15296725-15296747 CAAAGATGGGATTTGAACCCAGG + Intergenic
1177173759 21:17682003-17682025 CCACGATGGGAGTGGGGAGCTGG - Intergenic
1177344863 21:19855186-19855208 CAGAGGTGGGAGAGGAGCCCTGG + Intergenic
1178606865 21:34045199-34045221 GTAAAATGGGAGTGGTGCCCAGG - Intergenic
1178907812 21:36650871-36650893 CCATCTTGGGAGTGGAGACCAGG + Intergenic
1179170899 21:38972010-38972032 CCAAGATGGGGATGGAGCGGGGG - Intergenic
1179852383 21:44144895-44144917 CCATGATGGGATCGGAGCCATGG + Exonic
1179879253 21:44286628-44286650 CCAGGATGGCTGTGGAGTCCTGG - Exonic
1179956275 21:44740939-44740961 CCCAGCTGGGAGGGGAGGCCAGG - Intergenic
1180715234 22:17867339-17867361 CCACCAGGGGAGTGGAGCCACGG + Intronic
1180842202 22:18964695-18964717 CCATGGTGGGAGCAGAGCCCGGG - Intergenic
1181669557 22:24419814-24419836 CCCTGAGGGGAGTGGAGCCCTGG - Intronic
1181817364 22:25448510-25448532 CCCAGGTGGGAGTGGGGGCCAGG + Intergenic
1181984855 22:26793106-26793128 CCATGATGGATGTGGGGCCCAGG + Intergenic
1182307595 22:29381452-29381474 CCAAGAAGAGAGTTGAGCACTGG - Intronic
1182329460 22:29540509-29540531 CCAAGCTGGGATTTGAACCCAGG + Intronic
1182749755 22:32632162-32632184 CCAGGCAGGGTGTGGAGCCCTGG + Intronic
1183344741 22:37301023-37301045 CCAGGAGGGGAGTGGGACCCAGG + Intronic
1183416306 22:37684311-37684333 TCTGGGTGGGAGTGGAGCCCTGG + Intronic
1183631848 22:39038065-39038087 CCATGATGGGAGGGGAGGTCAGG + Intergenic
1183636766 22:39068456-39068478 CCATGATGGGAGGGGAGGTCAGG + Intronic
1183637732 22:39074895-39074917 CCATGATGGGAGGGGAGGTCAGG + Intronic
1183757694 22:39785353-39785375 CCAAGATGAGAGAGCAGCCAGGG - Intronic
1184470455 22:44692719-44692741 ACAGGTTGGGAGTGCAGCCCGGG + Intronic
1184518172 22:44975782-44975804 GCGAGTTGGAAGTGGAGCCCTGG - Intronic
1185157790 22:49204769-49204791 CCAGGATGGGAGTGGGTCGCAGG - Intergenic
1185175650 22:49325126-49325148 CGAGGATGGGAGTGGAACACAGG - Intergenic
1185327993 22:50236909-50236931 CCAAGAGGGGTGTGCAGCCATGG - Intronic
950725156 3:14912410-14912432 GCAAGAGGAGAGTGGACCCCAGG + Intronic
952256659 3:31701563-31701585 ACTGGCTGGGAGTGGAGCCCAGG + Intronic
952684384 3:36132047-36132069 CAGAGCTGGGAGAGGAGCCCTGG - Intergenic
952793262 3:37217298-37217320 CCAAGATCGGAGTGGGTGCCAGG - Intergenic
952888623 3:38026869-38026891 CAAAGCTAGGACTGGAGCCCAGG + Intronic
953787280 3:45920687-45920709 TCAGGAGGGGAGTGGGGCCCAGG + Exonic
954634664 3:52065013-52065035 CCAGGAAGGGCCTGGAGCCCAGG + Intergenic
954646066 3:52132298-52132320 ACAAGATGGGAGAGGACCCATGG + Intronic
957014314 3:75044746-75044768 CCACAATGGGAGTGGTACCCTGG + Intergenic
957262823 3:77922629-77922651 CCAAGAGAGGAGGGGAGGCCTGG - Intergenic
961589979 3:127971627-127971649 CCAGGATGGCAGGGGAGCTCAGG + Intronic
962314850 3:134352924-134352946 CCCTGATGGGAATGGAGCCCTGG - Intergenic
964857414 3:161161856-161161878 ACGGGGTGGGAGTGGAGCCCAGG - Intronic
965788714 3:172364474-172364496 CTAAGATGGCAGTGGAGGCAGGG - Intronic
966361670 3:179137047-179137069 CCAGGATTGGTGTGGAGCCAAGG + Intergenic
966549902 3:181193408-181193430 CCAAAACAGGAGTGGAGACCAGG - Intergenic
968811846 4:2803560-2803582 CAAGGCTGGGACTGGAGCCCAGG + Intronic
969243648 4:5918546-5918568 CCCAGAGAGGAGTGGAGCTCAGG + Intronic
969569892 4:8002125-8002147 CCCAGATGGGACTGGAACCGTGG - Intronic
970260313 4:14217550-14217572 CCAAGGTGGGAGGGGGTCCCCGG + Intergenic
970302474 4:14696082-14696104 CAAAGGTGGGATTGGTGCCCAGG + Intergenic
976700708 4:87966338-87966360 CCAAGATTGGAGTGGGTGCCAGG - Intergenic
976799186 4:88969318-88969340 CAAAGATGGGACTGAAGTCCAGG + Intronic
977896188 4:102368189-102368211 CCTAGTTGAGAGTGGAGCCAGGG + Intronic
980495631 4:133585580-133585602 CCAAGATGGCACTGGGGCTCTGG - Intergenic
980595717 4:134952370-134952392 CCAGGGTGGCAGTGCAGCCCCGG + Intergenic
980838474 4:138227629-138227651 TGAAGATGGGTCTGGAGCCCAGG + Intronic
981316909 4:143349457-143349479 CCAGGGTGGCAGTGCAGCCCTGG + Intronic
982864592 4:160493947-160493969 ACAAGTTGGGAGTAGAGCACAGG + Intergenic
983636681 4:169904851-169904873 ACAATATCTGAGTGGAGCCCTGG + Intergenic
985016401 4:185639322-185639344 CCAAGATGGGATTTTACCCCAGG - Intronic
985540611 5:485795-485817 CCAAGGTGGGAGAGGACCCTGGG + Intronic
987070830 5:14335458-14335480 CACAGGTGGGAGGGGAGCCCCGG - Intronic
987967099 5:24891530-24891552 ACAATTTGTGAGTGGAGCCCTGG + Intergenic
991004872 5:61818169-61818191 CCTAGTTGTGAGTAGAGCCCAGG - Intergenic
991413681 5:66369681-66369703 CCAAGCTAGGGGTGCAGCCCAGG + Intergenic
993538533 5:89119032-89119054 GGAAGATGGGAGGGGAGTCCAGG + Intergenic
995251885 5:110002801-110002823 CCAAGTTGGGATTGGAACCTGGG + Intergenic
998133501 5:139662767-139662789 CCAAGCCAGGTGTGGAGCCCAGG - Intronic
998460437 5:142305958-142305980 TCAAGATAGGACTTGAGCCCAGG - Intergenic
999238066 5:150111685-150111707 CAGGGATGGGAGAGGAGCCCAGG - Intronic
999250333 5:150178593-150178615 CAGAGCTGGGACTGGAGCCCAGG + Intronic
1000672195 5:164076895-164076917 CTGAGATGGGAGTGGAGCCCTGG + Intergenic
1001847578 5:174935709-174935731 CCAAAACTGGAGTGGGGCCCAGG - Intergenic
1002196746 5:177505213-177505235 CAAAGCTGGAACTGGAGCCCAGG - Intronic
1002211201 5:177600294-177600316 CCGAGAAGGGAGCGGCGCCCGGG - Intronic
1002286263 5:178164610-178164632 CCGAGGTGGGAGGGGAACCCAGG + Intergenic
1003333620 6:5150394-5150416 CCAAGCTGGGACTTGAACCCAGG - Intronic
1005835274 6:29704089-29704111 CCAGGACGGGAGTGCATCCCAGG - Intergenic
1005929771 6:30475048-30475070 CCTAGATGGGGATGGAGGCCGGG - Intergenic
1006127852 6:31851569-31851591 CCAAGATGGAAGTTAAGCCTTGG + Intergenic
1006398515 6:33802290-33802312 CCAAGCAGGGAGGGGAGGCCGGG + Intronic
1007085417 6:39140997-39141019 CCAGGATGGGGGCGGAGTCCCGG + Intergenic
1007397178 6:41584687-41584709 CCACGCTGAGAGTGGGGCCCTGG + Intronic
1007543655 6:42673480-42673502 CCAAGATGCCAGTGCAGGCCGGG - Intronic
1007669359 6:43539004-43539026 CCAGGGTGGCAGTGCAGCCCTGG + Intronic
1007754180 6:44088140-44088162 ACAAGGTGGGAGTGCTGCCCGGG - Intergenic
1013421457 6:109970795-109970817 CCAAGATCATAGAGGAGCCCAGG + Intergenic
1014971673 6:127824120-127824142 CCTAGATTAGAGTGGAGACCTGG - Intronic
1017916679 6:158836756-158836778 GAAAGATGGGTCTGGAGCCCAGG + Intergenic
1018858886 6:167696371-167696393 GCAAGGTGGGCGTGGAGCCTGGG + Intergenic
1019326329 7:440111-440133 CCAGGAATGGACTGGAGCCCTGG + Intergenic
1022310027 7:29188332-29188354 ACAAGCTAGGAGTGAAGCCCAGG + Intronic
1024006057 7:45225376-45225398 CCAGGAGGGTAGTGGAGGCCTGG + Intergenic
1024618027 7:51132348-51132370 CCAAGCTGGGATCGGAACCCAGG + Intronic
1026772429 7:73211008-73211030 CCACGGTGGGAAGGGAGCCCTGG + Intergenic
1026894067 7:73999995-74000017 CCAAGTGGGGAGTGGAGTCGTGG + Intergenic
1026951739 7:74352008-74352030 CCCAGCTGGGAGTGGGTCCCGGG + Intronic
1027132182 7:75598965-75598987 CCAAAAAGGCTGTGGAGCCCAGG - Intronic
1027302387 7:76853739-76853761 GCAAGGTGTGACTGGAGCCCAGG + Intergenic
1028601572 7:92606359-92606381 TCAAGTTGGGAGTGGTGGCCAGG + Exonic
1029547235 7:101216937-101216959 GCAGGGTGGGAGTGGTGCCCAGG + Intronic
1030741416 7:113114107-113114129 ACCAGGTGGGAGTGGAGTCCAGG - Intergenic
1031696287 7:124859077-124859099 CCAAGATGGAAATGGTGTCCTGG + Exonic
1032433304 7:131880350-131880372 CCAAAGCTGGAGTGGAGCCCAGG - Intergenic
1033917652 7:146347287-146347309 GCAAGAAGGGAGTAGAGCCCAGG + Intronic
1034147263 7:148884229-148884251 CTCAGAAGGCAGTGGAGCCCCGG - Exonic
1035031519 7:155864016-155864038 CCACGATGGAAGGGGAGCACAGG - Intergenic
1035295763 7:157866206-157866228 CCAGGATGGGATTTGAGCCCCGG - Intronic
1038347094 8:26742485-26742507 CAAGGCTGGGAGTGGAGCCAGGG - Intergenic
1040319616 8:46286063-46286085 CCAAGATTGGGGTAGAGCCATGG - Intergenic
1041202779 8:55467066-55467088 CCCAGATGAGATTGCAGCCCTGG - Intronic
1042211873 8:66389395-66389417 CCAACTTGGAAGTGGAGACCAGG - Intergenic
1044602079 8:94015291-94015313 CAGAGCTGGGACTGGAGCCCAGG - Intergenic
1046906906 8:119583190-119583212 CCAAGATGGGAAAAGAACCCAGG + Intronic
1048292508 8:133191518-133191540 CGAAGACGGGTCTGGAGCCCGGG - Intronic
1048514892 8:135097312-135097334 CCATGATGTCAGTGGAGACCAGG + Intergenic
1048538885 8:135324343-135324365 CCAAGAAGATAGTGGAGCCTGGG - Intergenic
1049406259 8:142452979-142453001 CCAAGATGGGGCCGGAGCCGCGG - Intronic
1052363814 9:27589325-27589347 CCAAGATGGGCATGGAGCCAGGG + Intergenic
1054831324 9:69628261-69628283 TCAAGATGAGAATGCAGCCCAGG + Intronic
1057457566 9:95228189-95228211 AAAAGATGGGAGGGGAGCCAGGG + Intronic
1058543288 9:106034534-106034556 CAAAGCTGGGAATGGAGCCCAGG - Intergenic
1060032458 9:120227157-120227179 CCATGATAGGAGAGAAGCCCAGG + Intergenic
1060249841 9:121977251-121977273 CTGAGCTGGGATTGGAGCCCAGG - Intronic
1060680156 9:125555462-125555484 GAAAGATGGTACTGGAGCCCCGG + Intronic
1061177700 9:129007561-129007583 CCAAGCAGGGACTGAAGCCCAGG - Intronic
1061238331 9:129354648-129354670 CCAGGAAGGGAGTTGAGGCCAGG + Intergenic
1061500014 9:130996812-130996834 GGAAGATGGGAGTGGAGTCCAGG - Intergenic
1061957458 9:133971109-133971131 CGATGGTGGGAGTGGAACCCGGG - Intronic
1062524175 9:136971651-136971673 CCAAGAAGGGGGGTGAGCCCTGG - Exonic
1188559913 X:31455918-31455940 CCAATTTGGTAGTAGAGCCCAGG - Intronic
1188600125 X:31953427-31953449 CCAAGCTGGGAGTGGGGACTGGG + Intronic
1189036146 X:37495337-37495359 CCAAGATGGGATTTGAACCCAGG - Intronic
1189429612 X:40935164-40935186 CCAGGGTGGCAGTGCAGCCCCGG + Intergenic
1190328206 X:49219542-49219564 CCAAGGTGGGAGTGGGGGCATGG - Intronic
1192579419 X:72268607-72268629 CCAAGATGGGAGTTGAGGCCAGG - Intronic
1196037053 X:111157153-111157175 CTACTCTGGGAGTGGAGCCCTGG - Intronic
1196434210 X:115660117-115660139 GCAGAAAGGGAGTGGAGCCCAGG + Intergenic
1197370080 X:125614954-125614976 CCATGATGGGGGAGGAGCCAAGG - Intergenic
1198456728 X:136824591-136824613 ACTAGTTGTGAGTGGAGCCCTGG + Intergenic
1201054496 Y:9975366-9975388 CCCAGTTGGGAGTGGGGCCTGGG - Intergenic
1201495102 Y:14584353-14584375 CCAATGCGGGAGTGGAGCCTAGG - Intronic
1201684092 Y:16682089-16682111 CCAACATGGGACTTGAACCCAGG - Intergenic