ID: 1085518115

View in Genome Browser
Species Human (GRCh38)
Location 11:77123007-77123029
Sequence CCCCCCACGGGGAAATGGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 155
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 148}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085518115_1085518124 -7 Left 1085518115 11:77123007-77123029 CCCTCCCATTTCCCCGTGGGGGG 0: 1
1: 0
2: 0
3: 6
4: 148
Right 1085518124 11:77123023-77123045 TGGGGGGCCCACCTGGAAAGTGG 0: 1
1: 0
2: 1
3: 30
4: 208
1085518115_1085518129 20 Left 1085518115 11:77123007-77123029 CCCTCCCATTTCCCCGTGGGGGG 0: 1
1: 0
2: 0
3: 6
4: 148
Right 1085518129 11:77123050-77123072 GAGCCACTGTGTGGTGCGTGTGG 0: 1
1: 0
2: 0
3: 8
4: 171
1085518115_1085518128 11 Left 1085518115 11:77123007-77123029 CCCTCCCATTTCCCCGTGGGGGG 0: 1
1: 0
2: 0
3: 6
4: 148
Right 1085518128 11:77123041-77123063 AGTGGCGTTGAGCCACTGTGTGG 0: 1
1: 0
2: 0
3: 2
4: 63

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085518115 Original CRISPR CCCCCCACGGGGAAATGGGA GGG (reversed) Intronic
900003076 1:25727-25749 CCCCTCACTGGAAAATGGTAAGG + Intergenic
900610128 1:3541188-3541210 CCCCCCACGGGGCAGTGCCATGG - Intronic
902375682 1:16029009-16029031 CCCCCCGCTGGGAAGTGGCAGGG + Intronic
902391977 1:16112270-16112292 AGCCCCAGGGGGAGATGGGAGGG - Intergenic
905145329 1:35883403-35883425 CTCCGCACGGGTATATGGGATGG + Exonic
905343655 1:37296669-37296691 TCCCTCTCGGGGAAACGGGAAGG + Intergenic
912800034 1:112714792-112714814 CCCCCCACTGGAAAATGGGTTGG + Intronic
913123422 1:115763165-115763187 CCCCCCATGGAGACATGGGTTGG - Intronic
913340970 1:117757950-117757972 CCCCCAAAGGAGACATGGGAAGG - Intergenic
914320073 1:146550738-146550760 CCCCCTCGGGGGAAATGGGTTGG + Intergenic
915921323 1:159977910-159977932 CCTGCCATGGGGAAAAGGGAGGG + Intergenic
917514494 1:175696287-175696309 GCCCCCACAGGTAAATGGGCGGG + Intronic
920286784 1:204885373-204885395 CCCCCCACAGGGCAAAGGGGAGG - Intronic
924052848 1:240093878-240093900 CCCCCCACGGTGAAATGACTTGG + Intronic
1063631581 10:7739178-7739200 GCTGCCCCGGGGAAATGGGAGGG + Intronic
1067469858 10:46528366-46528388 CCCCCCACCAGGACATGAGAAGG - Intergenic
1069023747 10:63518819-63518841 CCCTCCAAGGGGAAACTGGAAGG - Intergenic
1071446516 10:85753764-85753786 CCTCCCACGGGGAATAGGAAGGG + Intronic
1072528962 10:96300227-96300249 CCCCCCATGGGGTAAGGGAATGG + Intergenic
1073024707 10:100479371-100479393 CCCACCACGGGGCACTGAGAAGG - Intronic
1074145101 10:110710638-110710660 CCCCCAAAGGGGAAGGGGGAGGG - Intronic
1075584528 10:123647812-123647834 CCACCAACGAGGAAATGTGAAGG + Intergenic
1076407928 10:130225778-130225800 CCACCCACGTGGCATTGGGAAGG - Intergenic
1076456709 10:130604981-130605003 ACCTCCATGGGGAGATGGGAGGG + Intergenic
1077176549 11:1193708-1193730 CCACCCAGGTGGAAATGGGCGGG + Intronic
1080642164 11:34164413-34164435 CATCTCACTGGGAAATGGGACGG + Intronic
1081532163 11:43969582-43969604 CCCACCACAGGGAAAAAGGAAGG - Intergenic
1081600045 11:44486680-44486702 CCCCCCACGGGAAAGGGAGAGGG - Intergenic
1081755384 11:45540700-45540722 TCTCCCACAGGGAAATGGGAAGG - Intergenic
1083617659 11:64034664-64034686 CTCCCCAAGGGGATCTGGGAGGG + Intronic
1084428271 11:69097396-69097418 CCCCTCACCTGGCAATGGGAGGG - Intergenic
1084595047 11:70111905-70111927 CCCCACCCGGGGAACAGGGAAGG - Intronic
1085518115 11:77123007-77123029 CCCCCCACGGGGAAATGGGAGGG - Intronic
1090777127 11:129975544-129975566 CCCACCATGGGGGAGTGGGATGG - Intronic
1096178546 12:49538706-49538728 CCTCCCCCGGCGGAATGGGAGGG - Intergenic
1096803339 12:54126151-54126173 CCCCACATGGCGAAAAGGGAGGG - Intergenic
1102300454 12:111767291-111767313 CAAGTCACGGGGAAATGGGACGG - Intronic
1102467435 12:113138058-113138080 CTCCCCACGGGGAAATACCAAGG + Intergenic
1102887711 12:116534193-116534215 TCCCCCACGGGGACTTGGGAAGG - Intergenic
1103911588 12:124355149-124355171 TCCCCCACTGCGAAATGGAAGGG - Intronic
1104964695 12:132503582-132503604 CCCCACACGGGGCCATGGGTGGG + Intronic
1112550342 13:100414325-100414347 CCTCCCAGAGGGAAATGAGATGG - Intronic
1113487688 13:110666324-110666346 CCCTCCCCAGGGAAATGGTATGG + Intronic
1113951432 13:114073622-114073644 CCACACATGGGAAAATGGGAAGG + Intronic
1121705147 14:95987362-95987384 CCTCCCACTTGGAAAAGGGAAGG - Intergenic
1121847282 14:97183924-97183946 CCCGCCTCTGGGATATGGGATGG - Intergenic
1123462295 15:20484157-20484179 CTACCTACGGGGAAATGGGGAGG + Intergenic
1123655764 15:22516237-22516259 CTACCTACGGGGAAATGGGGAGG - Intergenic
1124272984 15:28300155-28300177 CTACCTACGGGGAAATGGGGAGG + Intronic
1124309674 15:28611414-28611436 CTACCTACGGGGAAATGGGGAGG - Intergenic
1125448721 15:39785468-39785490 CCCCCCCCGAGAAATTGGGAAGG - Intergenic
1126381199 15:48049086-48049108 CTCCCCATGGGGACAGGGGAAGG + Intergenic
1126627289 15:50697131-50697153 TCACCCACGCTGAAATGGGATGG - Intergenic
1127157905 15:56149116-56149138 CCACAGAGGGGGAAATGGGATGG - Intronic
1132844489 16:1993501-1993523 CTACCCACAGGGACATGGGATGG - Exonic
1132906093 16:2283471-2283493 CCCTCCATGGGGAGATGTGAAGG + Intronic
1132988966 16:2783363-2783385 CTCCCCAGGAGGAAAGGGGAGGG + Intergenic
1136552640 16:30989777-30989799 CGACCCACGGGTACATGGGATGG + Exonic
1138536344 16:57662397-57662419 CCCCCCATGGAGAGATGGGGGGG + Intronic
1139113547 16:63921550-63921572 TGCCCCAAGGGGAAATGTGAAGG - Intergenic
1139435655 16:66935175-66935197 CCCCAGATGGAGAAATGGGAAGG - Exonic
1140013452 16:71159339-71159361 CCCCCTCGGGGGAAATGGGTTGG - Intronic
1141567945 16:84915899-84915921 CTCCCCACAGGGAAAGGGCATGG + Intronic
1142150919 16:88512225-88512247 GCCCTCATGGGGAAGTGGGAGGG - Intronic
1146641609 17:34546232-34546254 CCCCCGGCGGGGAAGTGGCATGG - Intergenic
1146831090 17:36070146-36070168 CTCCCCAAGGAGAGATGGGATGG + Intronic
1147913613 17:43873289-43873311 CCCCCTGTGGGGAAATGAGAAGG + Intergenic
1148177960 17:45584439-45584461 CCCCCAGAGGGGAAATGCGAGGG - Intergenic
1148836608 17:50469006-50469028 CCCTCCACGGGGAAGGGGGCGGG + Intronic
1151362682 17:73598101-73598123 CTCCCCCTGGGGAGATGGGATGG - Intronic
1152012070 17:77724852-77724874 GCCCCCACAGGGACAAGGGAGGG - Intergenic
1152064353 17:78102262-78102284 GTCACCACGGGGAAGTGGGAAGG + Intronic
1152242186 17:79166489-79166511 CCACCCACGGGGAGCTGAGATGG + Intronic
1152382329 17:79948550-79948572 CCACCCACGGGGAGATGGAGGGG + Intronic
1157088340 18:44605254-44605276 CGCCCCTCTGGGAAATGGGGTGG - Intergenic
1157221087 18:45828919-45828941 CAGCCCAGGAGGAAATGGGAGGG + Intronic
1160346119 18:78134309-78134331 TCCTTCCCGGGGAAATGGGATGG + Intergenic
1160346217 18:78134764-78134786 TCCATCCCGGGGAAATGGGATGG + Intergenic
1160422509 18:78756736-78756758 CTCGCCAGGGGTAAATGGGAAGG - Intergenic
1160634827 19:67335-67357 CCCCTCACTGGAAAATGGTAAGG + Intergenic
1160974304 19:1785132-1785154 GCCCCCATGGGGAAGTGGGACGG - Intronic
1163757069 19:19112476-19112498 ACCCTCACAGGGAGATGGGAGGG + Exonic
1164540816 19:29120333-29120355 CCCTCCAGGGGGAGTTGGGAAGG - Intergenic
1165435230 19:35791605-35791627 CCCCCCACTGGAAAGTGGGTGGG - Intergenic
1166777782 19:45323148-45323170 CCCCCGCCGGGAACATGGGACGG + Intergenic
1166830753 19:45638447-45638469 CCCCCCAGGAGGAAATAGAAAGG - Intronic
1167808753 19:51809923-51809945 CCCCCTGCTGGGAAATGAGATGG - Intronic
929325672 2:40607974-40607996 CCCCTCATGGGGAACTGGGTAGG - Intronic
932605511 2:73163081-73163103 CGCCCCACGGGGTCAGGGGAAGG + Intergenic
946177689 2:217931443-217931465 ACCACCACGGGGACATGTGAGGG + Intronic
946328397 2:218996654-218996676 CCCTCCCCGTGGAAATGGTATGG + Intergenic
946900548 2:224367880-224367902 CCCCTCACGGGGACATGAAAAGG + Intergenic
1169048725 20:2558832-2558854 TCCCTCACGGGGGAAGGGGAAGG - Intronic
1172639448 20:36432079-36432101 CTCGCCACGGGGAAATTGGAGGG - Exonic
1174486707 20:50865845-50865867 CTGCCCACAGAGAAATGGGAGGG + Intronic
1176294961 21:5066802-5066824 ACCCCCTCTGAGAAATGGGATGG - Intergenic
1179504841 21:41833440-41833462 CCCACCACTGGGAATGGGGAAGG + Intronic
1179505060 21:41834650-41834672 CCCACCACTGGGAATGGGGAAGG + Intronic
1179862088 21:44195325-44195347 ACCCCCTCTGAGAAATGGGATGG + Intergenic
1180985763 22:19903203-19903225 ACCCCCACGGGGACCTGGGCAGG + Intronic
1181478860 22:23185017-23185039 CCCTCAACTTGGAAATGGGACGG - Intronic
950417454 3:12876478-12876500 CGCCCCACGGGGAAGTGGCCCGG - Intergenic
954536095 3:51360558-51360580 CACCCCACGGGGAAATGTTCTGG + Exonic
961828366 3:129610635-129610657 GCTCCCACGGGGAAATGAGACGG - Intergenic
962805996 3:138928325-138928347 CCACCCACTGGGGAAGGGGATGG - Intergenic
965114876 3:164476713-164476735 CTCCCCACGAAGAAGTGGGAAGG - Intergenic
966881829 3:184354926-184354948 GGCCCCACAGGGAACTGGGATGG + Exonic
968593992 4:1473089-1473111 CCTGCCACCTGGAAATGGGATGG + Intergenic
969576692 4:8040206-8040228 CACCCGACGGGGACATGGAACGG + Intronic
970528730 4:16960132-16960154 CCCCTCAAGTGGACATGGGAGGG + Intergenic
972564585 4:40258672-40258694 CCCCCCAGGAAGAAAGGGGAGGG + Intergenic
974581009 4:63801590-63801612 CCCACAAAGGGTAAATGGGAGGG + Intergenic
975737738 4:77398000-77398022 CCCTCCATTGGGAAATGAGATGG - Intronic
984821013 4:183882402-183882424 CGACCCACTGGGAAATGAGAAGG - Intronic
986431304 5:7683655-7683677 CCTCCCAGGGGGGCATGGGAGGG + Intronic
986446827 5:7828929-7828951 CACCCCGTGGGGGAATGGGAGGG - Exonic
986752586 5:10802188-10802210 CCCCCCAGTGAGAGATGGGAGGG - Intergenic
990246396 5:53867486-53867508 CCCTCCACAGGGAATTGGTAAGG + Intergenic
990428518 5:55712165-55712187 CGCCCCTCGGGGAGGTGGGAAGG - Intronic
1001658698 5:173374172-173374194 CTCCCCACCGGGCAGTGGGAAGG + Intergenic
1002838458 6:885364-885386 ACACCCACGAGGAAATGGCAGGG - Intergenic
1016865330 6:148760370-148760392 CTGCCCACAGTGAAATGGGATGG - Intronic
1019350744 7:552830-552852 GCCTCCCCGGGGAAAGGGGAGGG + Intronic
1019350767 7:552898-552920 CCCGACACGGGGAAGTGGGGAGG + Intronic
1021255426 7:18386564-18386586 CCCTCCACTGGTAAGTGGGAAGG - Intronic
1021931534 7:25585832-25585854 ACCCCCATGGGGGAAGGGGAGGG + Intergenic
1024656811 7:51458010-51458032 GCCCCCAGTGGGAGATGGGATGG - Intergenic
1028488274 7:91383768-91383790 CCTCCCACTGGCAACTGGGATGG + Intergenic
1029346336 7:99981239-99981261 CCCCCAAGGGGAAAGTGGGAAGG + Intergenic
1029413752 7:100430562-100430584 CCCCCCAGGAGGAAGTTGGAGGG - Exonic
1029896368 7:103989213-103989235 CCCACCACGGGGAGCTGGAAGGG - Exonic
1031972580 7:128075092-128075114 TTCCCCACGGGGCAATGTGAAGG - Intronic
1034297355 7:149986142-149986164 CCCACCAAGAGGAAATGGGTCGG - Intergenic
1034808669 7:154110712-154110734 CCCACCAAGAGGAAATGGGTCGG + Intronic
1035029956 7:155850296-155850318 CTCCCCATGGGGGAATGGGGTGG + Intergenic
1038278256 8:26139782-26139804 CTCCCCATGGGGAAGAGGGAGGG - Intergenic
1038814432 8:30886663-30886685 CACCCCAGTGGGAAACGGGAGGG + Intronic
1040041540 8:42920518-42920540 CCAGCCACGGGGGATTGGGAAGG + Intronic
1045234850 8:100342616-100342638 CCCCCCACTGGTAAATTTGACGG - Intronic
1049353375 8:142175968-142175990 CTCCCCACAGGGAGATGGGTAGG - Intergenic
1049685814 8:143938927-143938949 CTTCCCCCGAGGAAATGGGAGGG + Intronic
1049885880 9:25840-25862 CCCCTCACTGGAAAATGGTAAGG + Intergenic
1053114241 9:35488176-35488198 CCCTCCACCGGAAAACGGGAAGG - Intergenic
1053319068 9:37079553-37079575 CCCGCCACGTGGCACTGGGAAGG + Intergenic
1055863963 9:80789836-80789858 CCCCTCACAGGAAAATGTGAAGG - Intergenic
1057890558 9:98866940-98866962 CACCCCACCCGCAAATGGGAGGG - Intergenic
1058935079 9:109762845-109762867 CCACCCCCTGGGGAATGGGAAGG - Intronic
1060823362 9:126673805-126673827 ATCCCCACGGGGAGATTGGATGG + Intronic
1061628848 9:131858901-131858923 GCCCACTCGGGGAAGTGGGAGGG - Intergenic
1187694535 X:21905405-21905427 CCCCAGACTGGGAAGTGGGAAGG + Intergenic
1189491696 X:41475280-41475302 CCCCGCCAGGAGAAATGGGACGG - Exonic
1189645832 X:43130458-43130480 CCCCCCATGGGGAAGTAGGTAGG - Intergenic
1190258503 X:48783073-48783095 CCCTCCACGGGGATGGGGGAGGG + Intergenic
1197760030 X:130021414-130021436 CCCATCGCGGGGAAATGGGTCGG - Intronic
1197800587 X:130343671-130343693 CCCCAGACTGGGCAATGGGAGGG + Intronic