ID: 1085520117

View in Genome Browser
Species Human (GRCh38)
Location 11:77132816-77132838
Sequence ATGATGAAACAGGCTCAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 860
Summary {0: 1, 1: 2, 2: 23, 3: 151, 4: 683}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085520114_1085520117 13 Left 1085520114 11:77132780-77132802 CCAGGTGGATAGAGGTTTTTAAT 0: 1
1: 0
2: 0
3: 15
4: 143
Right 1085520117 11:77132816-77132838 ATGATGAAACAGGCTCAGGAAGG 0: 1
1: 2
2: 23
3: 151
4: 683
1085520111_1085520117 21 Left 1085520111 11:77132772-77132794 CCACCGCACCAGGTGGATAGAGG 0: 1
1: 0
2: 1
3: 8
4: 97
Right 1085520117 11:77132816-77132838 ATGATGAAACAGGCTCAGGAAGG 0: 1
1: 2
2: 23
3: 151
4: 683
1085520113_1085520117 18 Left 1085520113 11:77132775-77132797 CCGCACCAGGTGGATAGAGGTTT 0: 1
1: 0
2: 0
3: 10
4: 101
Right 1085520117 11:77132816-77132838 ATGATGAAACAGGCTCAGGAAGG 0: 1
1: 2
2: 23
3: 151
4: 683

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085520117 Original CRISPR ATGATGAAACAGGCTCAGGA AGG Intronic
901669793 1:10849564-10849586 GTGAGGAAACAGGCTCAGAGAGG - Intergenic
901873475 1:12152400-12152422 AGGTTGCAACAGCCTCAGGACGG + Intergenic
902405179 1:16178918-16178940 TTGAAGAAACAGGCTCAGGGAGG - Intergenic
903221755 1:21873261-21873283 ATGAAGAAACAGGCTCGGACAGG + Intronic
903469204 1:23573758-23573780 ATGAGGAAACAGGCTCAGAGAGG + Intergenic
903610728 1:24610082-24610104 ATCAGGAAACAGGTTCAGCAAGG + Intergenic
903838566 1:26221968-26221990 AAGATCAAACAGGCTTAGAAAGG - Intergenic
903891905 1:26575339-26575361 ATGGGGAAACAGGCTCAAGTTGG + Intergenic
903992547 1:27283792-27283814 ATGAGCAAACAGGCTCAGACAGG - Intronic
904473590 1:30750748-30750770 ATGAGGAAACAGGCTCAGGAGGG - Intronic
904535519 1:31196939-31196961 ACCAAGAAACAGGCACAGGAAGG - Intronic
904597001 1:31653141-31653163 ATGAGGACACAGGCTCAGAGAGG + Intronic
904846349 1:33420919-33420941 ATGAAGAAACAGGCTCAAAGAGG - Intronic
904940091 1:34159623-34159645 ATGAAGAAACAGGTTCAGAGAGG - Intronic
905003322 1:34690623-34690645 ATGACGAAACAGGCACAGAGTGG - Intergenic
905291177 1:36922731-36922753 ATGAGGAAACAGGTTCCGGGAGG + Intronic
905295536 1:36952055-36952077 ATGCAGAAACAGGGTCAGCAAGG + Intronic
905476873 1:38235200-38235222 ATGAGGAAACAGGCTCAGAGAGG + Intergenic
905652927 1:39668521-39668543 ATGGGGAAACAGGCCCAGAAAGG + Intronic
905833900 1:41099742-41099764 ATAAGGAAACGGGCTCAGAAAGG - Intronic
905884709 1:41485370-41485392 ACAAGGAAACAGGCCCAGGAAGG - Intergenic
906188364 1:43879238-43879260 ATGCTGTAACAGGGTGAGGAAGG + Intronic
906282465 1:44563674-44563696 ATGGTGAAACAGGTTCAGAGAGG - Intronic
906293466 1:44634860-44634882 ATGATGGAACAGGTTCGGGTGGG + Intronic
906383171 1:45345676-45345698 ATGAAGAAACAGACTCAGAGAGG + Intronic
906488657 1:46250518-46250540 ATGAGAAAACAGTCTCAGAAGGG + Intronic
906647211 1:47483786-47483808 ATGACCAAGCAGGCTGAGGATGG + Intergenic
906674216 1:47681517-47681539 ATGAGGAAACTGGCTCAGAAAGG - Intergenic
906689639 1:47784130-47784152 ATGAGGAAACAGGCTCAGTGAGG + Intronic
906808830 1:48805789-48805811 ATGAGGAAACAGGCTGAGAGAGG - Intronic
907053758 1:51346204-51346226 TTGATGAAACAGGTTCAGAGGGG + Intergenic
907076998 1:51587998-51588020 ATGAGGAAACAGGTTCAGAGAGG - Intronic
907747369 1:57226711-57226733 GTGAGGAAACAGGCTGAGAAAGG + Intronic
907782201 1:57577560-57577582 ATAAAGAAACAGGCTCAGAGAGG + Intronic
907932723 1:59015528-59015550 CTCTTGAAACAGGCTCAGTAAGG - Intergenic
908028725 1:59977315-59977337 ATGAGGAAATAGGCACAGCATGG + Intergenic
908797987 1:67850566-67850588 ATGAAGAAAGAGGCTCAGAGAGG - Intergenic
908916250 1:69129854-69129876 ATAACGAAACAGGGTAAGGAGGG + Intergenic
909504542 1:76373286-76373308 ATGAGAAAACAGGCCCAGCAAGG - Intronic
909513452 1:76481015-76481037 ATGATGATGCAAGGTCAGGAGGG - Intronic
909661016 1:78082150-78082172 ATGTGGAAACAGGCTCAGGAAGG + Intronic
909986509 1:82167261-82167283 ATGAAAAAAAAGGCTCAGGCAGG - Intergenic
910473035 1:87575962-87575984 ATGAGGAAATAGGCTTAGAATGG + Intergenic
911052693 1:93684595-93684617 GGGAGGAAACAGACTCAGGAAGG + Intronic
911582020 1:99644931-99644953 ATGAGGGAACAGGCTCAGAGAGG - Intergenic
911712840 1:101095380-101095402 ATGTTGAGACAGGCATAGGATGG + Intergenic
911946697 1:104118835-104118857 ATGTTAAAACAGGCTCATTAGGG + Intergenic
912107927 1:106304067-106304089 ATGAAAAAGCAGGTTCAGGAAGG - Intergenic
912310664 1:108617796-108617818 ATGAAGAAACGGCCTCAGAAAGG + Intronic
912587730 1:110782016-110782038 ATGAGGAAACAGGCTCAGAGAGG + Intergenic
913047588 1:115087702-115087724 ATGAGGAAACAGGCTCAAATTGG - Intronic
913445131 1:118943059-118943081 ATGAAGAAATTGGCTCAGAAAGG - Intronic
913454856 1:119020371-119020393 AAGTTGAAAAGGGCTCAGGAAGG + Intergenic
913539462 1:119804975-119804997 GTGAGGAAACAGGCTCAGGATGG + Intronic
914229495 1:145752473-145752495 ATTATTATTCAGGCTCAGGAAGG - Intronic
914447147 1:147759727-147759749 ATGAAGAAACAGACTCAGTGAGG - Intronic
914965016 1:152248630-152248652 ATGAGGAAACAGACTCAGAAAGG - Intergenic
914973441 1:152333211-152333233 ATGAGGAAACAGACCCAGAAAGG - Intergenic
915065799 1:153222949-153222971 ATGCTGAAACAGGCCTAGGCTGG - Intergenic
915676777 1:157539240-157539262 ATGATGAAACTGGTACAGGATGG + Exonic
916211877 1:162366369-162366391 ATGAGGTAACAGACTCAGGGAGG + Intronic
916880032 1:169011819-169011841 ATGAGGAAGCAGGCTTAGGGAGG - Intergenic
917025261 1:170634945-170634967 ATGATGATACAGGGCAAGGAAGG + Intergenic
917347206 1:174040562-174040584 ATGAGGAAACAGGCACAGAAGGG + Intergenic
917824365 1:178801441-178801463 ATGATGAAACAGGATCAAATGGG - Intronic
917965281 1:180174867-180174889 ATGAAGAAACAGGCTCGGCCAGG + Intronic
918001085 1:180496912-180496934 ATGAAGAGAGAAGCTCAGGAGGG + Intronic
918148736 1:181780498-181780520 AAGATGACCTAGGCTCAGGAAGG + Intronic
918345179 1:183601565-183601587 ATGGTGAATCAGGCTGAGCACGG + Intergenic
918346571 1:183612633-183612655 ACGAAGAAACAGGCTCAGAAAGG + Intergenic
919357641 1:196545444-196545466 TTGAGGAAACAGGATCAGGCTGG + Intronic
919516853 1:198535757-198535779 CTGAGGAAACAGGCACAGCAAGG + Intronic
919561876 1:199131332-199131354 ATGAAGAAACATGCTCAGTGAGG + Intergenic
919743868 1:200996524-200996546 ATGATGAAACAGGCTCAGAGAGG - Intronic
919765171 1:201122516-201122538 AAGAGGAAACAGGCTCAGAGAGG + Intronic
919766344 1:201129779-201129801 ATGAGGAAACCGGCTCAAAAGGG + Intergenic
920124840 1:203685737-203685759 AAGAAGAAACAGACTCAGGGAGG - Intronic
920176804 1:204107209-204107231 ATGAGGAGACAGGCTAAGGGAGG + Intronic
920679349 1:208060594-208060616 ATCATGGAAAAGGCCCAGGAAGG + Intronic
920697374 1:208191627-208191649 ATGAAGAAACAGGCACAGAGAGG + Intronic
920729394 1:208468634-208468656 ATGAGGAAACAGATTCAGAATGG + Intergenic
921103525 1:211952455-211952477 ATAAGGAAACAGGCACAGAAAGG + Intronic
921395899 1:214669274-214669296 ATGATTTAGCAGTCTCAGGATGG + Intergenic
922057758 1:222057652-222057674 ATGAGGAAACAGGCTCAGAGAGG + Intergenic
922122723 1:222688872-222688894 ATTATAAAACAGCCTCAGGCAGG + Intronic
922321015 1:224486929-224486951 CTGACTAAACAGGCTCCGGATGG + Intronic
922495181 1:226051581-226051603 ATGAGGAAATAGGCTAAGGAAGG - Intergenic
922532585 1:226355800-226355822 ATGTGGAAACAGGCTCAGAGAGG - Intergenic
923610506 1:235488391-235488413 ATGATGAAATAGGCTGGGTATGG + Intronic
924105801 1:240647949-240647971 AAAATGAAAAAGGCTCTGGATGG + Intergenic
924545969 1:245028177-245028199 AAGATAAAAGAGGCTCAGCATGG - Intronic
924934756 1:248758505-248758527 ATAAGGAAACAGGCCCAGGGAGG + Intergenic
1063653403 10:7962987-7963009 ATTAGGAAACAGGCTCAGAGAGG + Intronic
1063676670 10:8146455-8146477 GTGAGATAACAGGCTCAGGATGG - Intergenic
1064041089 10:11964869-11964891 ATAATGAGACAGCCTGAGGATGG + Intronic
1064110665 10:12535908-12535930 ATGAGGACACAGGCTCAGAGGGG + Intronic
1064681307 10:17813101-17813123 ATGAAGCACCAGGCTCAGGGAGG + Intronic
1064893354 10:20205806-20205828 ATGAGGAAACAGGCTTAGAAAGG + Intronic
1065155267 10:22863001-22863023 ATGAGGAAACAGGGTCAGAGGGG + Intergenic
1066009529 10:31181582-31181604 TTGCTGGAACAGGCTCTGGACGG - Intergenic
1066428556 10:35331490-35331512 ATGATGAAACAGGGACAGCCAGG - Intronic
1067294167 10:44965226-44965248 CTGGTGAAACAGGCTATGGAAGG + Intronic
1067523690 10:47026232-47026254 AAGATGAAACAGGCTCGAGGAGG - Intergenic
1069507981 10:69018799-69018821 AGGCTGGAACAAGCTCAGGAAGG + Intergenic
1070371236 10:75784239-75784261 GTGAGGAAACAAGCTCAGGGAGG - Intronic
1070791592 10:79192730-79192752 ATGAGGATGCAGGCTCAGGAAGG + Intronic
1070931843 10:80266342-80266364 AGGAGGAAACAGGCTCTGGCAGG - Intergenic
1071052229 10:81464903-81464925 ATGGTAAAACAGCCTCAGGCAGG - Intergenic
1071701119 10:87937654-87937676 ATGATCAAACAGGCACAGGAAGG + Intronic
1071873073 10:89816172-89816194 GTGAGGACACAGCCTCAGGAAGG + Intergenic
1072798879 10:98377964-98377986 ATGAAGAAAGAGGGTAAGGAAGG - Intergenic
1073082300 10:100867929-100867951 ATGAGGAAACGGGCTCAGTGAGG + Intergenic
1073255827 10:102150566-102150588 ATGATGATACTGGTCCAGGAAGG + Intergenic
1074238218 10:111607796-111607818 ATCATGAAACATGCTCAGAGAGG - Intergenic
1074438623 10:113455622-113455644 ATGGGGAAACAGACTCAGGATGG - Intergenic
1074525250 10:114257496-114257518 ATGAGGGAACAGGCTCAGAGAGG + Intronic
1074540150 10:114358428-114358450 ATGAAGAAACAGACTCAGGGAGG + Intronic
1074936677 10:118188674-118188696 ATGAGGAAAGATGATCAGGAGGG + Intergenic
1075686301 10:124367463-124367485 ATCAGGAAACAGGCTCAGAGAGG + Intergenic
1075733248 10:124648690-124648712 ATGAGCAAACAGGCTCAGAAAGG + Intronic
1076113509 10:127879518-127879540 ATGAGGAATGAGGCTCAGAAAGG - Intronic
1076468011 10:130698340-130698362 AGGATGAAAGAGGCACAGAAAGG + Intergenic
1077146887 11:1050450-1050472 ATGAGGAAACAGGCACAGAGAGG + Intergenic
1077281087 11:1746577-1746599 ATGATGAGTCAGGAGCAGGAGGG + Intronic
1077506370 11:2931635-2931657 AAGAGGAAACTGGTTCAGGATGG + Intergenic
1078267496 11:9766017-9766039 ATGAGGAAATAGGCTCAGACAGG + Intergenic
1078713132 11:13814262-13814284 ATGAAGAAAGAGGCCCACGAAGG - Intergenic
1078746211 11:14117872-14117894 ATAAGGAAACAGGCTCAGGGAGG - Intronic
1079075573 11:17383583-17383605 ATGAGGACACAGGGTCAGAAAGG - Intergenic
1079138889 11:17794448-17794470 ATGAAGAACCAGGCTCAGAGAGG + Intronic
1079247849 11:18766232-18766254 ATCATTAAACAGGCTCAGAGAGG + Intronic
1079401999 11:20113179-20113201 ATGAGGAAATAGGCCCAGGGAGG - Intronic
1079504248 11:21135566-21135588 ATAAGGAAACAGGCTCAGATGGG - Intronic
1079504415 11:21137385-21137407 AGGATCATACAGGCTCAGGAGGG + Intronic
1080582788 11:33657485-33657507 ATGAGGAAACAGGCTTGGAAAGG + Intronic
1080691296 11:34560757-34560779 ATGAGGAAACAGACTCAGGCAGG + Intergenic
1080704607 11:34678502-34678524 TAGATAAAACAGGCTCAGAAGGG - Intergenic
1081678048 11:44982442-44982464 AGGAAGAAAAAGGCTCTGGACGG - Intergenic
1081988068 11:47321578-47321600 ATTATGAAAGAAGCTCAGGGGGG + Intronic
1082015709 11:47485074-47485096 ATGAGGAAACAGGCACAGAATGG - Intronic
1082288505 11:50342432-50342454 ATGATGAAGCAAGCTCAGAGAGG + Intergenic
1082740065 11:56901008-56901030 ATGAAGAAACAGACTCACAAAGG + Intergenic
1082806496 11:57454984-57455006 ATGGAGAAACAGGCTCAGAGAGG - Intergenic
1082997358 11:59264572-59264594 ATGAAGAAACAGGCTCAGGTGGG - Intergenic
1083315550 11:61812915-61812937 ATGAGATAACAGGCTCAGGGAGG - Intronic
1083658184 11:64240309-64240331 TTGAGGAAATAGGCTCAGAAAGG + Intergenic
1083935801 11:65869527-65869549 AAGAAGAAACAGGCTCAGAGAGG + Intronic
1084041234 11:66543828-66543850 ATGAAGCAGCAGGCACAGGAAGG + Exonic
1084079962 11:66815901-66815923 ATAGAGAAACAGGTTCAGGAGGG + Intronic
1084112389 11:67022698-67022720 ATGAAGAAACAGGCTCAGAGAGG - Intronic
1084344758 11:68539278-68539300 ATGAGGAAACAGACCCAAGAAGG - Intronic
1084775597 11:71372616-71372638 AAGAAGAAACAGGCCCTGGAGGG + Intergenic
1084949477 11:72656826-72656848 ATGGGGAAACAGGCCCAGGGTGG - Intronic
1085056001 11:73404306-73404328 ATGAGGAAACAGGTTATGGAAGG - Intronic
1085114120 11:73915110-73915132 ATGAGGAAGCAGGCTCAGAGAGG - Intronic
1085520117 11:77132816-77132838 ATGATGAAACAGGCTCAGGAAGG + Intronic
1085811388 11:79685303-79685325 GTGAGGAAACAGGCTGAAGAAGG + Intergenic
1085896821 11:80649422-80649444 GTGATGAGAGAGGCTCAGAAAGG + Intergenic
1085962269 11:81476078-81476100 ATGATGGAAGAGGATCAGGGAGG - Intergenic
1086633361 11:89051342-89051364 ATGATGATACAAGCTGAAGATGG + Intronic
1087152807 11:94873590-94873612 ATGAGGAAATGGGCTCAGAAAGG + Exonic
1087292747 11:96338374-96338396 ATGAAGAAACTGGCTGAGTAAGG + Intronic
1087614675 11:100474294-100474316 ATGACGAAGCATGCACAGGAAGG + Intergenic
1087727939 11:101743718-101743740 ATGTTTAAGCTGGCTCAGGATGG - Intronic
1087854595 11:103076585-103076607 ATGAGGAAACAGGCTGAAAACGG - Intronic
1088392162 11:109326492-109326514 ATGAAGAAACAGTCCCAGAAAGG - Intergenic
1088971828 11:114780672-114780694 ATGCTGTAAGAGGCTCAGGAAGG + Intergenic
1089399322 11:118155353-118155375 ATGAAGAAAGAGGCTCAGAGAGG + Intergenic
1089710217 11:120309231-120309253 ATGACAAGACAGGCTCAGAAAGG + Intronic
1089816988 11:121184621-121184643 CAGATGAAACAGGCTCAGAGAGG + Intronic
1089854743 11:121533301-121533323 ATGAGAAAACAGGCTCAGCAAGG + Intronic
1090041227 11:123293791-123293813 ACTATGAAACAGCCTCAGGCAGG - Intergenic
1090358661 11:126157856-126157878 ATGATGGATCAGGTCCAGGAAGG - Intergenic
1090775374 11:129960057-129960079 ATGATTAAAAAGTCTCAGTATGG - Intronic
1090803616 11:130189414-130189436 GTCAGAAAACAGGCTCAGGAAGG + Intronic
1091538316 12:1434811-1434833 ATGACGAAAGAGGCTCAGCATGG - Intronic
1091854424 12:3727939-3727961 ATGAGGAAACAGGCCCAAGAGGG + Intronic
1091998652 12:5015651-5015673 ATGAGAAAACAGGCACAGAAAGG - Intergenic
1092145554 12:6212252-6212274 ATGAAGAAACAGGCTCCGAGAGG - Intronic
1092248141 12:6874942-6874964 AGGAAGAAACAGGCACAGGGAGG - Intronic
1093068407 12:14683321-14683343 ATGCTGAAACAGGTTAAAGAGGG - Intronic
1093121816 12:15279782-15279804 CTGATGCATCAGGCCCAGGAAGG + Intronic
1093483635 12:19629778-19629800 ATGAAGAAACAATCTCAGGGAGG + Intronic
1094461426 12:30700582-30700604 ATGAGGAAACAGGCACAGAGAGG - Intergenic
1094482513 12:30896097-30896119 ATGATGAAACAGGGGAAGTATGG + Intergenic
1094697691 12:32837351-32837373 ATGAGGAAACAGCCTCAGAGAGG - Intronic
1095223985 12:39656591-39656613 ATTGTAAAACAGGCTCAGGCAGG + Intronic
1095399651 12:41799925-41799947 ATGTTGACAGTGGCTCAGGATGG + Intergenic
1095704995 12:45227477-45227499 CTGAAGAAACAGGCTCAGAGAGG - Intronic
1095792870 12:46186211-46186233 CTGATGAAATACGCACAGGAGGG - Intronic
1095817273 12:46438305-46438327 ATGAGGAAACTGGCTCAGAGAGG + Intergenic
1096102756 12:48979433-48979455 ATGATAGCTCAGGCTCAGGAAGG - Intronic
1096194198 12:49638770-49638792 ATGAGGAAACAGGGTCAGAAAGG - Exonic
1096410839 12:51376180-51376202 AAGAGGAAACAGGTTCAGGGAGG + Intronic
1096828409 12:54296550-54296572 ATGAAGATACAGGGGCAGGAGGG - Intronic
1097238215 12:57554258-57554280 ATGACGAAACAGGCTCAAAGAGG - Intronic
1097880409 12:64681403-64681425 ATGAGGGAACAGGCTCAGAAAGG + Intronic
1099300812 12:80892321-80892343 TTGATGAGACTGGCTCAGGAAGG + Intronic
1099821675 12:87719329-87719351 ATGAAGAAACAGACTCAGAAAGG - Intergenic
1100150959 12:91737057-91737079 ATGAGGAAACAGGTTTAGGGAGG - Intergenic
1100467486 12:94859712-94859734 AGGAAGAAAGAGGGTCAGGAAGG - Intergenic
1100826398 12:98478759-98478781 ATGATGAAACAGGCTTACGAAGG + Intergenic
1101109080 12:101468191-101468213 ATGAAGAAACAGGCTCAGGGAGG - Intergenic
1101241114 12:102841100-102841122 ATGAGGAAACAGGCTTGGGAAGG + Intronic
1101314729 12:103618702-103618724 ATGAGGAAACAGGCACAGAGTGG - Intronic
1101721160 12:107351902-107351924 ATGATGAGTCAGGCTGAGGTAGG + Intronic
1101777487 12:107807504-107807526 ATGAGAAAACAGTCTCAGGGGGG + Intergenic
1101823235 12:108200308-108200330 ATGAAGAAACAGGCTCAGAGAGG + Intronic
1101846668 12:108368358-108368380 ATGGAGAAACAGGCCCAGAAGGG + Intergenic
1102195717 12:111023877-111023899 CTGAAGAAACAGGTTCAGGCAGG + Intergenic
1102210579 12:111123894-111123916 ATAAGGAAACAGGCTCAGAGGGG + Intronic
1102570555 12:113824736-113824758 TTGAAGAAACAGGCTCAGAGAGG - Intronic
1102602241 12:114040152-114040174 ATCAGGAAAAGGGCTCAGGAAGG + Intergenic
1102754590 12:115327089-115327111 CTGATGCAGCAGGTTCAGGATGG + Intergenic
1102956243 12:117060938-117060960 ACGAGAAAACAGACTCAGGAAGG - Intronic
1103181408 12:118915117-118915139 AAGAAGAAACAGGCTCTGAAAGG + Intergenic
1103201000 12:119087896-119087918 ATGAGAAAACAGGCTCAGAGAGG - Intronic
1103538382 12:121649347-121649369 AGGAGGAAACAGGTTCAGGGAGG - Intergenic
1103719974 12:122968308-122968330 ATGAGAAAACAGGCTCAGATAGG - Intronic
1103922209 12:124404925-124404947 AGGAGGAAACAGGCTCAGAGAGG + Intronic
1104360919 12:128132482-128132504 ATGGGGAAACAGGCTCAGAGAGG + Intergenic
1105311944 13:19219927-19219949 ATGAAGAAACGTGCTCAGAAAGG - Intergenic
1106193472 13:27474139-27474161 ATGAAGAAACAGGCCCAGACAGG + Intergenic
1106202905 13:27557284-27557306 ATGATGAAACAAACTTAGGGAGG + Intronic
1106301246 13:28468156-28468178 ATGAGGAAACTGGTTCAGAAAGG - Intronic
1106373044 13:29155544-29155566 ATGAAGAGGCAGGCTCAGGATGG + Intronic
1106619357 13:31358565-31358587 ATGCTAGAAAAGGCTCAGGAGGG + Intergenic
1106999782 13:35529156-35529178 ATGAGGACACAGGCTCAGACAGG + Intronic
1107174600 13:37385708-37385730 TCCATGAAACAGCCTCAGGAAGG - Intergenic
1107410374 13:40152546-40152568 GAGATGAAACTGGCTCAAGATGG - Intergenic
1108000784 13:45904105-45904127 ATGAGGAAACAGGCTTAGAGAGG - Intergenic
1108486200 13:50928738-50928760 ATGTGGAAACAGCCACAGGAAGG + Intronic
1108739191 13:53317663-53317685 ATGAGGAAAAAGGCTCAGAGAGG + Intergenic
1109313642 13:60724472-60724494 TGGAAGAAACAGCCTCAGGAGGG + Intergenic
1109885270 13:68533627-68533649 ACTATGAAACAGCCTCAGGGAGG - Intergenic
1110711656 13:78657088-78657110 ATAAGGAAACAGGCTCAAAAAGG - Intronic
1112461594 13:99607633-99607655 ATGAAAAAACAGGGTCAGAAAGG + Intronic
1112826362 13:103397155-103397177 ATGGTGAAACAGGCACAGAATGG + Intergenic
1113252067 13:108464460-108464482 ATGAGGTAACAGTCTCAGAAAGG + Intergenic
1113363351 13:109652311-109652333 GTGATGAAACAGACTGAGAAGGG - Intergenic
1115631173 14:35247044-35247066 ATGATGAAACAGGCTCAGAGAGG + Intronic
1115976751 14:39005269-39005291 TTCTAGAAACAGGCTCAGGAGGG - Intergenic
1117019094 14:51550822-51550844 ATGAGGAAACAGGCTCAGAGAGG - Intronic
1117642320 14:57813063-57813085 ATGAGGAAACAGGCACAGAGAGG + Intronic
1118671405 14:68132009-68132031 AGGAAGAATCAGGCTCAGAAAGG + Intronic
1119473602 14:74914069-74914091 ATGGAGAAACAGGCTCAGGAGGG - Intronic
1119613807 14:76085132-76085154 ATGAGGAAACAGACTCAGAGAGG + Intergenic
1119726605 14:76925212-76925234 ATGAAGACACAGCCTCAGAAAGG - Intergenic
1120674391 14:87404057-87404079 ATAACGAAATAGGCTCAGAAAGG + Intergenic
1121181727 14:91934280-91934302 ATGAGAAAACAGGCTCAGTGAGG - Intronic
1121419457 14:93802509-93802531 ATGAGGAAACAGGCCAAGGGAGG + Intergenic
1121495480 14:94389047-94389069 ATGAGGAAACAGGCTCAGAGCGG + Intronic
1122045205 14:99018009-99018031 ATGAGGAAACAGGCTCAGCAAGG - Intergenic
1122666006 14:103330148-103330170 GTGAGGAAAGAGACTCAGGAAGG - Intergenic
1122759370 14:104010530-104010552 ATTATAAAACAGTCTCAGGCAGG - Intronic
1123101857 14:105808868-105808890 AGGAAGAAAAAGGCTAAGGAAGG - Intergenic
1123986915 15:25654292-25654314 ATGATACACCAGGGTCAGGATGG + Intergenic
1124403400 15:29371181-29371203 GGGATGAAGCAGGCTCAAGAGGG - Intronic
1124625867 15:31307199-31307221 ATGGGGAAACAGGCTCAGAGAGG + Intergenic
1125588840 15:40842262-40842284 ATGAGCAAACAGGCTCAGACAGG - Intergenic
1126407619 15:48337433-48337455 ATGAGGAAACAGGCTCAGAAAGG - Intronic
1126499714 15:49332029-49332051 ATGAGGAAACAGGCTGAGATAGG + Intronic
1126644868 15:50865437-50865459 ATGAAGAAACAGCCTCATAAAGG + Intergenic
1126953498 15:53909429-53909451 ATGAGGAGACAGGCTCAAGAAGG + Intergenic
1127764149 15:62168300-62168322 ATGCAGAAACAGGCTCACAAAGG + Intergenic
1128142474 15:65311936-65311958 ATGATGAAATAGGCTCTGAGTGG - Intergenic
1128252489 15:66172802-66172824 ATGAGGAAACAGGCTCAGACAGG + Intronic
1128323932 15:66711400-66711422 CTGAGGAAACAGGCTCAGAGAGG + Intronic
1128451707 15:67809699-67809721 ATGAGGAAACAGACTCAGACAGG - Intergenic
1128576879 15:68782360-68782382 ATGAAGAAATAGGCTCAGAAAGG + Intronic
1128937476 15:71759380-71759402 ATGAGGAAACAGGCTCAGAGAGG - Intronic
1128979833 15:72178175-72178197 AGGGTGAAGAAGGCTCAGGAGGG - Intronic
1129660428 15:77550063-77550085 ATGAGAAAACAGGCTCAGAGAGG + Intergenic
1129687324 15:77694337-77694359 ATGAGGAAACAGGCCCAGAGAGG + Intronic
1129713380 15:77832944-77832966 ATGAGGAAACAGGCTCAGAGAGG + Intergenic
1129852061 15:78798996-78799018 ATGAGGAAACAGGCTCAGAGGGG - Intronic
1130250942 15:82300091-82300113 ATGAGGAAACAGGCTCAGAGGGG + Intergenic
1130287503 15:82568181-82568203 ATGAGGAAATAGGCTCATGGAGG - Intronic
1130551894 15:84894796-84894818 ATGAGGAAACAGGCTCAGTGAGG + Intronic
1130649817 15:85756156-85756178 CTGAGGAAACATGCTCAGCATGG - Intergenic
1130660027 15:85824059-85824081 ATGAAGAAACAGGCTGATGGAGG + Intergenic
1131179979 15:90233172-90233194 ACAATGAAACAGGTTCAGAAAGG - Intronic
1131864010 15:96687533-96687555 ATGAGGAAACAGGCTCAGGGAGG + Intergenic
1132019889 15:98351745-98351767 AGGTTGAAACTGGCTCAGGTTGG - Intergenic
1132153339 15:99477609-99477631 TTGAAGAAACAGGCTCAGGGAGG + Intergenic
1132259357 15:100408615-100408637 ATGATGAATCAAGCTCAGAAGGG + Intronic
1133468185 16:6048188-6048210 TTGTTGAAGCTGGCTCAGGAAGG + Intronic
1134572425 16:15302668-15302690 GTGAAGAAACAGGCTCAGAGAGG - Intergenic
1134729957 16:16453373-16453395 GTGAAGAAACAGGCTCAGAGAGG + Intergenic
1134771491 16:16813115-16813137 GTGATCTAACAGGCTCAGGGAGG + Intergenic
1134779559 16:16883483-16883505 AAGAGGAAACAAGCTCAGAAAGG + Intergenic
1134937476 16:18258527-18258549 GTGAAGAAACAGGCTCAGAGAGG - Intergenic
1135042996 16:19132295-19132317 AAGATGAAGCAGGCTCAGAGAGG + Intronic
1135074763 16:19383639-19383661 ATGAGAAAACAGGCTCAGAAAGG - Intergenic
1135191825 16:20360666-20360688 AAAATGGAACAGGGTCAGGATGG + Intronic
1135510063 16:23074939-23074961 ATGCTGGAACAGACTCAGGATGG + Intronic
1135880882 16:26255084-26255106 GTGATGAAATAGCATCAGGAAGG + Intergenic
1136063452 16:27742614-27742636 AGGAGGAAACAGGCTCAGCAGGG - Intronic
1136071277 16:27788841-27788863 ATGAGGAAACAGGCACAGAAAGG + Exonic
1136172182 16:28495994-28496016 AGGCTGAAACAGCCTCAGGCGGG + Exonic
1136176005 16:28517231-28517253 AAGATGAAACAGGCCCAGAGAGG + Intergenic
1136369360 16:29826268-29826290 ATGAGGAAACAGGCACAGGGTGG + Intronic
1136392953 16:29976923-29976945 ATAAAGAAACAGGCTCAGCAAGG - Intronic
1136546163 16:30956202-30956224 ATAAGGAAACAGGCCCAAGAAGG + Intronic
1136686319 16:31996777-31996799 AGGAGGAAACAGGCTCAGAGAGG + Intergenic
1136713510 16:32259033-32259055 ATGAAAAAACAGTTTCAGGAAGG - Intergenic
1136754401 16:32670398-32670420 ATGAAAAAACAGTTTCAGGAAGG + Intergenic
1136786932 16:32940306-32940328 AGGAGGAAACAGGCTCAGAGAGG + Intergenic
1136813712 16:33199967-33199989 ATGAAAAAACAGTTTCAGGAAGG - Intronic
1136820188 16:33310047-33310069 ATGAAAAAACAGTTTCAGGAAGG - Intergenic
1136826751 16:33366586-33366608 ATGAAAAAACAGTTTCAGGAAGG - Intergenic
1136831817 16:33465357-33465379 ATGAAAAAACAGTTTCAGGAAGG - Intergenic
1136882841 16:33913483-33913505 AGGAGGAAACAGGCTCAGAGAGG - Intergenic
1137010436 16:35315447-35315469 GTGAGGAAACAGTCTCAGGGAGG + Intergenic
1137024048 16:35455773-35455795 ATGAGGAAACAGTCTCAGGGAGG + Intergenic
1137491708 16:48938488-48938510 ATGAGGAAACAGGTTCAGAGAGG + Intergenic
1137821922 16:51454223-51454245 ATGATGATACAGCCTCATGGGGG + Intergenic
1137823252 16:51465459-51465481 ATGACCAAAGAGGCCCAGGATGG - Intergenic
1137950460 16:52778854-52778876 ATGACAAAACAGACTCAGAAAGG - Intergenic
1138230714 16:55333864-55333886 ATGAGGAAATAGGCTCAGAGAGG + Intergenic
1138291967 16:55855585-55855607 GTTATGACACAGGCTCAGGGTGG + Intronic
1138454131 16:57111668-57111690 ATGAGGAGACAGGTTCAGAAAGG - Intronic
1138488403 16:57361483-57361505 ATGGAGAAACAGGCTTAGCAAGG + Intronic
1138498161 16:57421316-57421338 ATGGAGAAATAGGCTCAGGCAGG - Intergenic
1138589032 16:57989632-57989654 ATGATGAAATGGACTCAGGAAGG + Intergenic
1139278569 16:65750267-65750289 ATGAGGAAACAGGCCCAGCAAGG + Intergenic
1139387278 16:66580748-66580770 ATGAGGAAACAGGCTGGGAATGG - Intronic
1139551888 16:67678084-67678106 CTGTTCACACAGGCTCAGGAGGG + Intronic
1140525747 16:75621454-75621476 ATGAGGAAACAGACCCAGCAAGG - Intronic
1141760171 16:86023031-86023053 ATGAGGAAACAGGCTCAGATAGG + Intergenic
1141768625 16:86075039-86075061 ATGGAGAAACAGGCCCAGGGTGG - Intergenic
1141990526 16:87606597-87606619 ATGAAGAAACAAGCTCAGAGAGG - Intronic
1202992288 16_KI270728v1_random:22941-22963 ATGAAAAAACAGTTTCAGGAAGG - Intergenic
1203056548 16_KI270728v1_random:930729-930751 ATGAAAAAACAGTTTCAGGAAGG + Intergenic
1203089168 16_KI270728v1_random:1201976-1201998 AGGAGGAAACAGGCTCAGAGAGG + Intergenic
1142653379 17:1372496-1372518 ATGATGAAGCTGAGTCAGGAAGG - Intronic
1142858618 17:2747976-2747998 ATGAGGAGACAGGCTTAGAAAGG + Intergenic
1143061923 17:4209090-4209112 ATGATGAAACAACCTAAGAAAGG + Intronic
1143392379 17:6567314-6567336 ATAAGGAAACAGGCTTAGAAAGG + Intergenic
1143554800 17:7653345-7653367 AGGAGGAAACAGGGTCAGCAGGG - Intronic
1143618892 17:8069881-8069903 ATGAGGAAACAGGCACAGAGAGG - Intergenic
1144755783 17:17679999-17680021 ATGAGGAAACAGGCGCAGAGTGG - Intergenic
1144822078 17:18082292-18082314 ATGTAGAAACAGGCTCAGAGAGG + Intergenic
1144966324 17:19078936-19078958 TTGAGGAAACAGACTCAGGGAGG + Intergenic
1144981594 17:19173121-19173143 TTGAGGAAACAGACTCAGGGAGG - Intergenic
1144986630 17:19205118-19205140 TTGAGGAAACAGACTCAGGGAGG + Intergenic
1145008029 17:19348521-19348543 ATGATGAAACAGGGGCAGAGAGG - Intronic
1145067846 17:19774411-19774433 AGGATGAAACAGGTTCAGAGAGG - Exonic
1145225640 17:21125939-21125961 ATGAATAAACTGGCTCTGGAAGG + Intronic
1145416044 17:22714927-22714949 GTGAGGAAACAGGCTGTGGATGG - Intergenic
1145993858 17:29094639-29094661 ATGCTGGAACAGGTACAGGAGGG - Exonic
1146287168 17:31581796-31581818 ATGAGGCAACAGGCTCAGCAGGG - Intergenic
1146448643 17:32953939-32953961 AGGAGGAAACAGGCCTAGGAAGG + Intergenic
1146459853 17:33037443-33037465 ATGATGAACCAGCCACAGCAGGG - Intronic
1146556212 17:33826562-33826584 ATGAGGAAACAGGCCCAGAGAGG + Intronic
1146937414 17:36820903-36820925 ATGAAGAAACTGGTGCAGGAGGG - Intergenic
1147147278 17:38492445-38492467 AGGAGGAAACAGGCTCAGAGAGG + Intronic
1147406339 17:40215082-40215104 ATGAAGAAACAGACACAGCAAGG - Intergenic
1147744943 17:42689213-42689235 AAGGTGATACATGCTCAGGATGG + Intronic
1147976746 17:44252371-44252393 ATGAGGAAACAGGCTCAGAGAGG + Intronic
1148355267 17:46971659-46971681 ATGAAGAAACAGGCCTTGGAAGG + Intronic
1149122781 17:53190169-53190191 GTCATAAAACAGTCTCAGGAAGG + Intergenic
1149344767 17:55723600-55723622 ATGAGGAAACAGGCTCAGAGAGG + Intronic
1150004598 17:61462231-61462253 ATCATGAAACAGGCTCTGAAAGG - Intronic
1150132517 17:62677024-62677046 ATGATGAAGCAGGCTCGGTGAGG + Intronic
1150655962 17:67039843-67039865 AGCAAGAAACAGGCTCAGAAAGG + Intergenic
1151040880 17:70859889-70859911 ATGAAGAAACAGTCTCAAGCAGG - Intergenic
1151135375 17:71941575-71941597 ATGCTGAACCAGCCTCAAGATGG - Intergenic
1151395968 17:73823282-73823304 GTGAGAAAACAGGCTCAGAAAGG + Intergenic
1151567105 17:74904835-74904857 ATGATTAAACAGACTCAGAGAGG + Intergenic
1151811635 17:76446625-76446647 GTCATGAGACAGGTTCAGGAAGG - Intronic
1151916456 17:77121713-77121735 ATGAGGAAACGGGCTCAGAATGG + Intronic
1152036213 17:77874712-77874734 AAGAGGAAACAGGCTCAGGATGG - Intergenic
1152057556 17:78042387-78042409 ATGAAGAAACAGGCTCAGAGAGG - Intronic
1152158035 17:78647747-78647769 ATGGTGAAGGAGGCTCCGGAGGG + Intergenic
1152218381 17:79047580-79047602 ATGGCAAAACAGGCTCAGCAGGG + Exonic
1153187493 18:2501419-2501441 ATGAAGAAACAGATTCAGGTAGG - Intergenic
1153247711 18:3089737-3089759 ATGAAGAAATAGGCTTAGGAAGG + Intronic
1153273273 18:3344047-3344069 ATGAAGAAACAGATTCAAGAAGG - Intergenic
1153532437 18:6061638-6061660 AAAATGAAACAAACTCAGGATGG - Intronic
1153764680 18:8364291-8364313 ATGAGAAAACAGGCTCGGGGTGG + Intronic
1153923174 18:9809144-9809166 AGGTAAAAACAGGCTCAGGATGG - Intronic
1154052539 18:10974691-10974713 ATGAAGAAACGGGCTCTAGAGGG - Intronic
1154285722 18:13054605-13054627 ATGAAGAAACAGGTTGAGGGAGG - Intronic
1154982689 18:21516695-21516717 ATGAAGAAACATGTTCAGGTTGG + Exonic
1155639649 18:27998377-27998399 ATGAGGAAATGGGCTTAGGAAGG + Intronic
1156310445 18:35917593-35917615 AAGATGAGACAGGCTCAGAGAGG - Intergenic
1157097739 18:44701525-44701547 AGGATGAACTAGGCTCAGGGCGG + Exonic
1157611295 18:48957747-48957769 AGGATGACACAGGCACAGGAAGG + Intergenic
1157655262 18:49380746-49380768 ATGAAGAGACAGGCTCAGAAAGG + Intronic
1157790298 18:50525182-50525204 GTGAGGAAAGAGGCTCAGGGTGG + Intergenic
1160578912 18:79872741-79872763 GTGAGGAAACAGGCTCAGAATGG - Intronic
1161603433 19:5200161-5200183 ATTATGATACAGGCACACGATGG - Intronic
1162001074 19:7745421-7745443 ATGAGGAAACTTGCTCAGGCAGG + Intronic
1162464839 19:10833406-10833428 AAGAGGAAACAGGCTCAGATAGG - Intronic
1162531590 19:11239352-11239374 ATGGAGAAACAGGCTCAGCATGG + Intronic
1163181907 19:15609954-15609976 AGGTTGAAACCTGCTCAGGAAGG + Intergenic
1163288795 19:16365214-16365236 ATTAAGAAACAGGCTGAGGGGGG - Intronic
1164145331 19:22509435-22509457 ATGAGGACACAGACTCAGAAAGG + Intronic
1165060351 19:33202100-33202122 GTGAGGAAACAGGCTCAGAGAGG - Intronic
1165412992 19:35673704-35673726 ATGAGTAAACAGGCCCAGAAAGG + Intronic
1165861787 19:38912811-38912833 GTGAGAAAACAGGCCCAGGAAGG - Intergenic
1166351738 19:42202050-42202072 ATGGGGAAACAGGCTCAGAGAGG - Intronic
1166443069 19:42833167-42833189 ATGAGGAAAGAGGCTGAGGGAGG + Intronic
1166468899 19:43060384-43060406 ATGAGGAAAGAGGCTGAGGGAGG + Intronic
1167247296 19:48381330-48381352 ATGAGGAAACAGGTTCAGAGGGG - Intergenic
1167308685 19:48723608-48723630 ATGAGGAAACAGAATCAGGTAGG - Intronic
1167614201 19:50522949-50522971 ATGATGAATTAGGCCCAGGGAGG + Intronic
1168132474 19:54330347-54330369 AAGTTGCAACAGGCTCAGGGGGG + Intergenic
1168233359 19:55047030-55047052 ATGAAGAAACAGGCTCAGAGGGG + Intronic
1168292643 19:55364053-55364075 ATGGAGAAACAGGTTCAGTAAGG - Intergenic
1168538668 19:57192308-57192330 ATGTTTAAGGAGGCTCAGGAGGG + Intronic
1168724164 19:58571539-58571561 ATGAGGAAACAGGCAAAGAAAGG + Intronic
925810381 2:7694362-7694384 ATGAGAAAACAGGCCCAGGAAGG + Intergenic
926088505 2:10035159-10035181 ATGAGAAAACAGGCTCAGAGAGG + Intergenic
926110662 2:10181224-10181246 ATGAGGAAACAGGCTTAGAGTGG + Intronic
926210727 2:10867703-10867725 AAGAGGAAACAGGCTCAGAGAGG - Intergenic
926390609 2:12387521-12387543 ATGATAAAACAGCCTCAGGCAGG - Intergenic
926986265 2:18627624-18627646 ATGAGGAAGCAGGCTCAAAAGGG - Intergenic
927415792 2:22879185-22879207 ATGAGATAACAGGCCCAGGAAGG - Intergenic
928098059 2:28417576-28417598 AGAAGGAAACAGGATCAGGAGGG - Intergenic
928211208 2:29325170-29325192 AAGATGAAAGACCCTCAGGAAGG + Intronic
928564036 2:32524478-32524500 ATGAAGAAACAGCCTTAGAAAGG - Intronic
928853088 2:35772300-35772322 ATAATAAAACAGGATCAAGAGGG + Intergenic
929033203 2:37667902-37667924 ATGAGAACACAGGCTCAGAAAGG - Intronic
929045982 2:37790744-37790766 ATCATGAAACAACGTCAGGACGG + Intergenic
929870166 2:45752549-45752571 ATGAGGAAACAGGCTCAGAGAGG - Intronic
929922590 2:46183009-46183031 ATGAGGAAACTGGCTCAGAGAGG - Intronic
930675001 2:54191068-54191090 ATGATGACTCAGGCTGAGGAGGG - Intronic
930755826 2:54970996-54971018 AAGGGGAAAAAGGCTCAGGAAGG + Exonic
931173227 2:59827110-59827132 ATGAGGAAACAGGTTCAGAAAGG + Intergenic
931193317 2:60026488-60026510 ATTTTGAAACAGTCTCAGGCAGG - Intergenic
931601345 2:64006467-64006489 ATTAGGAAACAGACTTAGGAAGG - Intronic
932443416 2:71754034-71754056 ATGGTGAAACAGCCTCAAGCAGG + Intergenic
932596590 2:73097335-73097357 ATGATGAAAGAGGGTGAGGGGGG - Intronic
932823830 2:74922790-74922812 ATGAGGAAACAGGCTCAAAAAGG + Intergenic
933169040 2:79105160-79105182 GTGATGGGACAGGCACAGGATGG + Intergenic
933588975 2:84210668-84210690 ATGAAGAAACAGGCACAGAGAGG - Intergenic
935803450 2:106723260-106723282 AGGAAGAGAGAGGCTCAGGAAGG + Intergenic
936792483 2:116165694-116165716 ATGATGAGACTAGCACAGGAAGG - Intergenic
936920505 2:117684056-117684078 ATAAAGGAACAGGATCAGGATGG - Intergenic
937447800 2:121973403-121973425 ATGATAAAATATGCACAGGAAGG + Intergenic
937962118 2:127468097-127468119 TTGAAGAAGCAGGCTCAGAAAGG - Intronic
938120894 2:128632368-128632390 CTGATAGAACAGGCTCAAGAAGG - Intergenic
938758405 2:134401397-134401419 ATGATGTAGCAGACTCAGGAAGG - Intronic
939712155 2:145535840-145535862 AGCAAGAAACAGGCTCTGGAGGG - Intergenic
941023161 2:160431531-160431553 ATTATGAAACAGACTTTGGAAGG - Intronic
941284293 2:163589991-163590013 ATGAGGAAACAAGCGCAGAAAGG + Intergenic
941297097 2:163752854-163752876 ATGATGAAACAAGTTCAGAGAGG - Intergenic
941530845 2:166668889-166668911 ATGAGGAAACAGGTTCAGAAAGG + Intergenic
941547849 2:166876326-166876348 GTAATAAAACAGACTCAGGAAGG + Intergenic
941848837 2:170158931-170158953 ATGAGAAAACTGGCTTAGGAAGG - Intergenic
942931834 2:181502959-181502981 AAGTTGAAGCAGGCTAAGGAGGG + Intronic
944669706 2:201984737-201984759 ATTAGGAAACAGGCCCAGCAAGG + Intergenic
944837553 2:203594970-203594992 AACATTAAACAGGTTCAGGAAGG + Intergenic
945464473 2:210151645-210151667 AAGAAGAAACAGACTCAGCATGG - Intronic
946389435 2:219406583-219406605 GTGAGGAAACAGGCTCAGAGAGG + Intergenic
947277806 2:228413815-228413837 ATGAGAACACAGGCTCAGGGTGG - Intergenic
947464379 2:230327902-230327924 AAGAAGAAAAAGGCCCAGGATGG + Intronic
947835739 2:233173971-233173993 AGGCTGAAACAGGCTCAGGATGG + Intronic
1168811403 20:706874-706896 ATGAGGAAACAGGCCCAGAGAGG - Intergenic
1168862206 20:1053687-1053709 AGGAGGAAACAGGCTGAGGAGGG - Intergenic
1168960937 20:1869210-1869232 ATAAGGAAACAGGCTCAGAGAGG - Intergenic
1169165601 20:3420939-3420961 ATAAGGAAACAGCCTCAGAAAGG + Intergenic
1170341932 20:15338668-15338690 ATGAAGAAACAGGCCTAGGGGGG + Intronic
1170381804 20:15769022-15769044 ATTGTAAAACAGCCTCAGGAAGG - Intronic
1170543261 20:17410196-17410218 ATAAGGAAACAGGCTCAGAAGGG + Intronic
1170771529 20:19337009-19337031 ATGAAGAAACAGACTCAGAGAGG - Intronic
1171040631 20:21759186-21759208 AGAAGGAAACAGGCTCAGCATGG - Intergenic
1171519354 20:25764318-25764340 GTGAGGAAACAGGCTGCGGATGG - Intronic
1171557569 20:26092173-26092195 GTGAGGAAACAGGCTGCGGATGG + Intergenic
1171992966 20:31710585-31710607 TTGATGATACAGGCTGAGGGTGG + Intronic
1172024062 20:31935983-31936005 ATGAGGAAACAGGCTCAGAGAGG - Intronic
1172063772 20:32205645-32205667 ATGAGGAAACAGGCTAATAATGG - Intronic
1172273824 20:33669204-33669226 ATGAGGAAACAGGCCCAGAGAGG + Intronic
1172610701 20:36249725-36249747 ATGAGGAAGCAGGCTCAGGAAGG + Intronic
1172848945 20:37946885-37946907 TTGAGGAAACAGGCTCAGAGAGG + Intergenic
1173190467 20:40871894-40871916 ATGATGTGACAGGCACAGGGTGG - Intergenic
1173542387 20:43863860-43863882 ATGAGGAAACAAGCTCAGAAAGG - Intergenic
1173613861 20:44390215-44390237 ATGGAGAAACACGCTCAGAAAGG + Intronic
1173671186 20:44800006-44800028 ATGAGGAAACAGGCTCAGGGAGG + Intronic
1173846449 20:46191631-46191653 ATGAGGAAACGGGCTCAGAGGGG + Intronic
1173868087 20:46325529-46325551 ATGAAGAAACATGCTCAGAGAGG - Intergenic
1173916995 20:46715044-46715066 AGGAAGCAACAGGATCAGGATGG - Intronic
1173934779 20:46851840-46851862 ATGAGAAAACAGGCTCAGAGAGG + Intergenic
1173943281 20:46930375-46930397 ATGAGGAAACAGGCTCAGAAAGG + Intronic
1174053454 20:47783040-47783062 ATGAGGAAACAGGCACAGAGAGG - Intronic
1174057614 20:47809549-47809571 CTGGGGAAACAGGCTCAGGGAGG + Intergenic
1174298469 20:49565734-49565756 AGGAGGAAACAGGCTCAGAAAGG - Intronic
1174307280 20:49622649-49622671 ATGAGGAAACATGCTCAGCAAGG - Intergenic
1174406091 20:50304374-50304396 CAGATGAAACAGGCTCAGGGAGG - Intergenic
1174459968 20:50675618-50675640 TTGAGGAAACAGGTTCAGGCAGG + Intronic
1174466371 20:50720742-50720764 ATGAAGAAACTGAGTCAGGAAGG + Intergenic
1174519768 20:51120445-51120467 ATGAGGAAACAGGCACAGAGTGG + Intergenic
1174690874 20:52503355-52503377 ATGATGAAACAGACACAGAGAGG + Intergenic
1175477162 20:59284964-59284986 ATGAGGACACTGGCTCAGAAGGG - Intergenic
1175838853 20:62014204-62014226 ATGAGGGGACAGGCACAGGAAGG + Intronic
1175911688 20:62408112-62408134 AGGATGAAACTGGCTCAGTGAGG + Intergenic
1175915773 20:62425057-62425079 GTGAGGAAACAGGCTCAGAGAGG - Intronic
1176653496 21:9570599-9570621 GTGAGGAAACAGGCTGCGGATGG - Intergenic
1178964124 21:37099355-37099377 ATGATGAAACAGGTATAGGGAGG + Intronic
1179252202 21:39680630-39680652 ACGATAAAACAGCCTCAGGCAGG + Intergenic
1179361631 21:40714584-40714606 ATGGTGAGACAGGAACAGGATGG - Intronic
1180000833 21:44994833-44994855 CTGATGAAACAGGCTCTGTTGGG - Intergenic
1180635560 22:17260501-17260523 ATGAGAAGACAGGCTCAGGGAGG - Intergenic
1180761028 22:18207641-18207663 ACTATGAAACAGCTTCAGGAAGG + Intergenic
1180774639 22:18416978-18417000 ACTATGAAACAGCTTCAGGAAGG - Intergenic
1181145690 22:20844820-20844842 ATGATGAAACAGACACAGAGAGG + Intronic
1181560351 22:23696420-23696442 AAGAGGAAACAGTCTCAGGGAGG + Intronic
1181783701 22:25210469-25210491 ATGAAGAAACAGGCTCAGGGAGG + Intergenic
1181937282 22:26447997-26448019 ATGAGGAAACAGGCTCAGAGCGG + Intronic
1182078496 22:27511733-27511755 ATGGAGAAACAGGTTCAGGGAGG - Intergenic
1182111857 22:27729396-27729418 ATGGGGAAACAGACTCAGAAAGG - Intergenic
1182438145 22:30344499-30344521 AAGCAGAAACAGGCTCAGAAAGG - Intronic
1182448264 22:30402491-30402513 ATGAGAAAACAGGCTCAGAGAGG + Intronic
1182553062 22:31111929-31111951 GTTAGGAAACAGGCTCAGAAAGG + Intronic
1182554271 22:31120520-31120542 ATGCTGAAACAGGCTGAGGGTGG - Intergenic
1183313480 22:37124386-37124408 ATTAGGAAACAGGCCCAGGGAGG - Intergenic
1183321628 22:37168521-37168543 ATGCAGAAACAGGCTCAGAGAGG - Intronic
1183370567 22:37429406-37429428 AGGAGGAAACAGGCTCAGAGAGG - Intergenic
1183650200 22:39149257-39149279 GTGAGGAAACAGGCTCAGAGAGG - Intronic
1184064602 22:42110518-42110540 TTGAAGAAACAGAGTCAGGAAGG - Intergenic
1184088390 22:42279693-42279715 ATGAGCAAACAGGCTCAGGGAGG + Intronic
1184350889 22:43943494-43943516 GTGATGAAACAGGCAGAGCACGG - Intronic
1184410612 22:44323982-44324004 ATGAGGAAACAGGCTCAGAGAGG + Intergenic
1184444117 22:44537259-44537281 ATGAGGAAACAGGCTCAGAGGGG + Intergenic
1184473489 22:44708654-44708676 ATGAGCAAACAGGCTCGGAATGG + Intronic
1184517546 22:44971929-44971951 ATAAGAAAACAGGCTCAGGGAGG + Intronic
949535595 3:4993770-4993792 ATAAGGAAACAGATTCAGGAAGG - Intergenic
949984122 3:9525853-9525875 GTTATGAAACAGGCACAGAAAGG + Intronic
950185650 3:10943829-10943851 ATGAGGAAACAGGCTCAGAGAGG + Intergenic
950353100 3:12376481-12376503 TTGATGAAACAGGCTTATGGAGG - Intronic
950458591 3:13107481-13107503 ATGGAGAAACAGGCTCAGAGCGG + Intergenic
950665042 3:14490214-14490236 ATGAGGAAACAGGCACAGAGAGG - Exonic
951051159 3:18095710-18095732 ATGAAGAAACAGGCACAGAAAGG - Intronic
951417309 3:22440531-22440553 ATGATGAAACTGGATCATAAAGG - Intergenic
951845961 3:27084840-27084862 ATGAGAAAACAGGCTCAGAGAGG - Intergenic
952140494 3:30473567-30473589 ATGAGGAAACAGGCTAAGGGAGG - Intergenic
952245454 3:31585330-31585352 TTGATGGAACAGGCACAGGGTGG - Intronic
952515728 3:34103361-34103383 ATGAGGAAACAGCCTCAGAAAGG - Intergenic
952521619 3:34164920-34164942 ATGAGAAAACAGGCTCAGAGAGG + Intergenic
953598765 3:44343206-44343228 ATGAGGAAACAGACTCCAGAAGG + Intronic
953658416 3:44872222-44872244 ATGATGAAAGAAGCTCAGAGAGG + Intronic
953706125 3:45231875-45231897 ATGAGAAAACAGGTGCAGGAAGG + Intergenic
953772746 3:45791524-45791546 ACAATGCAACAGGCACAGGAGGG + Intronic
953817467 3:46171190-46171212 ATGATGAAAAACTCTCAGCAAGG - Intronic
953961948 3:47273312-47273334 ATGAGGAAACAGGCTCAGTGTGG + Intronic
954792351 3:53142776-53142798 ATGGGGAAACAGGCTCTGCAGGG - Intergenic
955008477 3:54991765-54991787 ATGAAGAAACAGGCTCAGAGAGG - Intronic
955209250 3:56925661-56925683 ATGAGGAAAGAGGCTCAGAAGGG + Intronic
955393512 3:58537861-58537883 GTAAGGAAACAGGCTCAGGGAGG + Intergenic
955614022 3:60786508-60786530 ATGAAGTAACAGACTCAGGTAGG - Intronic
955747730 3:62156679-62156701 ATGATGAAACAAGATTGGGAAGG + Intronic
956302239 3:67784831-67784853 ATGAGGAAACAGGCTTAGAAAGG + Intergenic
956400824 3:68877970-68877992 ATGATAAAACAGGTTCAGAGAGG + Intronic
956442630 3:69295164-69295186 GTGATGAAACAGGCCCAAGAGGG + Intronic
956647436 3:71470230-71470252 ATGAAGAAACAGGCTCAGGAAGG - Intronic
956743786 3:72295469-72295491 GTGAGGAAACAGGCTCAGAGAGG - Intergenic
956909317 3:73800964-73800986 ATGATGAAGCAAGCTCAGAGAGG - Intergenic
957042613 3:75348000-75348022 ATTATGGAACAGGCTTTGGAGGG - Intergenic
957052925 3:75424008-75424030 ATAATAAAAGAGGCTGAGGAAGG - Intergenic
957866490 3:86031086-86031108 ATGAATAAACAGACTTAGGAAGG + Intronic
958880831 3:99667052-99667074 ATGAAGAAACAGATTCAGGAAGG + Intronic
958936896 3:100264737-100264759 ATTCTTAAAAAGGCTCAGGATGG + Intronic
959137993 3:102449127-102449149 ATAATGAAATATGCTCAGGCTGG - Intronic
959510191 3:107202110-107202132 ATGATGAAACAGGAGCAGGGAGG + Intergenic
959751002 3:109834962-109834984 ATGAAGAAACAGGCTTAGAGAGG + Intergenic
960515758 3:118600662-118600684 CTGAGGAAACATGCTCAGAAAGG + Intergenic
960701288 3:120441854-120441876 ATGGGGAAACAGGCTCAGAGAGG + Intronic
961115698 3:124327923-124327945 AAGAGGAAACAAGCTCAGAATGG - Intronic
961141960 3:124563303-124563325 AAGATGAAACTGACTCAGGAAGG - Intronic
961457131 3:127029803-127029825 ATGGGGAAACAGGCTCGGGCGGG + Intronic
961517928 3:127450040-127450062 ATAATGAAACAGGCTCATAGAGG - Intergenic
961590009 3:127971777-127971799 ATGATGAAAATGGCTCAGATGGG - Intronic
961595519 3:128013026-128013048 GTGATAAAACAGCCTCAGGCAGG + Intergenic
961827020 3:129604443-129604465 ATGAAGAAACAGGCACAGAGAGG - Intronic
961884048 3:130084092-130084114 ATGGTGACTGAGGCTCAGGAGGG + Intronic
961983873 3:131111648-131111670 ATGAGGAAACAGGTTCAGAGAGG - Intronic
962479203 3:135783956-135783978 ATGAGGAAACAGGCACAGGGAGG - Intergenic
962932875 3:140053755-140053777 ATAATGAAACAGGCTTATGAAGG - Intronic
962970490 3:140396579-140396601 ATGAGGAAACAGGCACAGAGAGG + Intronic
963918206 3:150880153-150880175 GTGAGGAAACAGGCTCAGAGAGG + Intronic
964478913 3:157122744-157122766 ATGAGAAAACAGGCTCAGAAGGG + Intergenic
964623713 3:158739314-158739336 CTCAGGAAAGAGGCTCAGGATGG + Intronic
964837341 3:160954111-160954133 ATGAAGAAACAGACTCAGAGAGG - Intronic
965648091 3:170905800-170905822 ATGAGAAAACAGGCTCAGAAAGG + Intronic
965983547 3:174723213-174723235 ATTAGGAAATAGGCTCAGAAAGG - Intronic
966138667 3:176730174-176730196 ATGAGGAAATAGGTTCAGGAAGG + Intergenic
966158715 3:176945936-176945958 AAGATGAAACAGAATGAGGAAGG + Intergenic
966586265 3:181629025-181629047 ATGAAGAAACAGGCTCAGAGAGG - Intergenic
966945989 3:184777424-184777446 ATGAGGAAACAGGCCCAGGGAGG + Intergenic
966952525 3:184835237-184835259 ATGAGAAGATAGGCTCAGGAAGG + Intronic
967080564 3:186045789-186045811 ATAACGAAAAAAGCTCAGGAAGG - Intergenic
967980773 3:195063896-195063918 ATGAAGAAACAGGCCCAGAGAGG + Intergenic
968235525 3:197028522-197028544 AAGATGAAGCAGGCTCAGAGAGG - Intronic
968818789 4:2835079-2835101 TTAATGAAACAGACTCAGGGAGG + Exonic
969029654 4:4201616-4201638 ATGATGAAACAGGTTCAAAGTGG + Intronic
969377107 4:6770131-6770153 ATGAGGTAACAGGCTCAGAGGGG + Intergenic
969438241 4:7200740-7200762 ATGAGGAAAAAGGCTCAGAGAGG - Intronic
969820728 4:9718199-9718221 GTGGTGAATGAGGCTCAGGAGGG - Intergenic
969906800 4:10404732-10404754 ATGAGGAAACAGGCACAGAGAGG + Intergenic
969966699 4:11003864-11003886 ATGGAGAAACAGGCTCAGGGAGG + Intergenic
970074097 4:12197598-12197620 ATGAGGAAGGAGGCACAGGAAGG + Intergenic
970138730 4:12956447-12956469 ATGAAGAAACAGGCTCAGCAAGG - Intergenic
971742944 4:30543168-30543190 ATAATGAAACAGGCATAGCAGGG + Intergenic
971761883 4:30776607-30776629 CTGAAGAAACGGTCTCAGGAAGG - Intronic
972594162 4:40515699-40515721 ATGAGGAGACGGGCTCAGGGAGG - Intronic
973646188 4:52953475-52953497 ATAAAGAAACAAGCTCAGGGAGG + Intronic
973876299 4:55223093-55223115 ATGAGGAAACAGGTTCAGAGAGG - Intergenic
974328720 4:60448797-60448819 ATGATTAAACAAGCTTAGTATGG + Intergenic
975547623 4:75575837-75575859 ATAATAAAACAGGTTAAGGAGGG + Intergenic
975691815 4:76972910-76972932 ATGAGAAAACAGGCTCAGAAAGG + Intronic
975950414 4:79763511-79763533 ATGATGAGAGAGGCATAGGATGG + Intergenic
976324721 4:83758292-83758314 CTGATGGGTCAGGCTCAGGAGGG + Intergenic
977191996 4:94012540-94012562 ATGAGGACACAGGCTCAGCATGG + Intergenic
978323209 4:107521269-107521291 ATAAGGAAACAGTCTCAGGGAGG - Intergenic
978545269 4:109865184-109865206 ATGAGAAAACAGGCTCAGCAAGG + Intronic
979292411 4:118992290-118992312 CTGCTGAAACAGTCTGAGGAAGG + Intronic
979720946 4:123899842-123899864 ATGATGTGACAGGCTGAGCAGGG - Intergenic
980956077 4:139430566-139430588 CTGTTCACACAGGCTCAGGAGGG + Intergenic
981688905 4:147484318-147484340 ATGAAGCAATAGACTCAGGAGGG - Intronic
981940868 4:150280388-150280410 ATTCTAAAACAGCCTCAGGAAGG + Intronic
982364551 4:154560938-154560960 ATGGTGAAACAGGTTCAGAGAGG - Intergenic
983637856 4:169916510-169916532 ATGAAGAAAAAGGCTTATGAAGG - Intergenic
984103548 4:175516267-175516289 TTGAAGAAACAGGCTTAGGTTGG - Intergenic
984891973 4:184502335-184502357 ATGAGGAAATAGGCTCAGAGTGG - Intergenic
984914594 4:184710692-184710714 TTGAGGAAACAGCCTCTGGAAGG - Intronic
986409743 5:7465308-7465330 ATGAGAAAAAAGACTCAGGAGGG - Intronic
986681829 5:10240541-10240563 ATGAGAAAACAGGCTCAGCAAGG - Intronic
987172023 5:15269125-15269147 ATGAAGAAACAGGCTAAGCAGGG + Intergenic
988797748 5:34667531-34667553 ATAATAAAAAAGGCTCAGGCAGG - Intronic
990697678 5:58439150-58439172 ATGATGAAACAGGCTTTGCTTGG + Intergenic
990922747 5:60985774-60985796 ATCATGAGATCGGCTCAGGAAGG + Intronic
991640406 5:68746113-68746135 ATGATGAATTAGGCTCAGGTTGG - Intergenic
992381856 5:76245322-76245344 ATGGAGAAACAGGCTGTGGAAGG + Intronic
992510241 5:77425633-77425655 ATGAAGAAATAGGCTCAGCAAGG - Intronic
992947758 5:81826100-81826122 ATGAGGACACAGGCTCAGGAGGG + Intergenic
993189349 5:84661525-84661547 ATGTAGAAACAGGCTCAGAAAGG + Intergenic
995133559 5:108656850-108656872 ATGATGAAGAAGACTCAGCAGGG + Intergenic
995798463 5:115965048-115965070 ATGAGGAAACAGACTCAGAGAGG - Intronic
996249878 5:121316683-121316705 ATGATCAACCAAGCTGAGGATGG - Intergenic
996685175 5:126271989-126272011 ATGCTGAAACAGGCACAGCCTGG - Intergenic
997098701 5:130943603-130943625 ATGATCAACTAGGCTAAGGAGGG - Intergenic
997639636 5:135440207-135440229 ATGAGGAAACAGGATCAGAGAGG - Intergenic
997716006 5:136043613-136043635 ATGATGAAATTGGCTGAGGATGG + Intronic
997732199 5:136190004-136190026 ATGAGGAAATAGGCTCAGATAGG + Intergenic
997767870 5:136523430-136523452 ATGATGAAACTTCCTCAGTACGG + Intergenic
998182617 5:139956027-139956049 ATGCTGAGACAGGCAGAGGAAGG + Intronic
998229929 5:140354589-140354611 ATGAGGAAACAGGCTCAGAGAGG - Intergenic
998296251 5:140971871-140971893 ATGAGGAAATAAGCTCAGGGAGG + Intronic
998492802 5:142561690-142561712 CTCATGAAACAGGCTCATTACGG - Intergenic
998892963 5:146766640-146766662 ATGAGAAAACAGGCTCAGAGAGG + Intronic
998930361 5:147174562-147174584 AAGAAGAAACAGGCTTAGAAAGG + Intergenic
999139963 5:149353900-149353922 ATAAAGAAACAGGCTCAGAAGGG - Exonic
999407412 5:151319042-151319064 CTGAGGAAACAAGCTGAGGAAGG - Intronic
999665024 5:153904039-153904061 ATGGGGAAACAGGCTCAGAGAGG + Intergenic
999730445 5:154473345-154473367 ATGGAGAAACAGACTCAGGGAGG - Intergenic
999754090 5:154651780-154651802 ATGAGGAAACAGGCTCTGTCCGG - Intergenic
999805480 5:155077225-155077247 ATGAGAAAACAGGCTCAGGGAGG + Intergenic
1000017929 5:157294755-157294777 ATGGTAAAACAGCCTCAGCAGGG - Intronic
1000040528 5:157481499-157481521 ATGAGGAAACAGACTCAAGAGGG + Intronic
1000146053 5:158454458-158454480 ATGATGAAAATTGCTCAGGCAGG + Intergenic
1000380199 5:160622213-160622235 ATGAGGAAACAGACCCAGGGAGG + Intronic
1000383350 5:160648712-160648734 ATGTGGAAACAGGCTCAGAGAGG + Intronic
1001279420 5:170375867-170375889 ACGAGGAAACAGGCACAGAAAGG + Exonic
1001399872 5:171440099-171440121 AAGAGGAAACAGGATCAGAAAGG - Intronic
1001414729 5:171537147-171537169 ATGATGAAACAGGCTCCAAGGGG - Intergenic
1001553855 5:172623069-172623091 ATTAAGAAACAGGCTCAGAGAGG - Intergenic
1002101741 5:176861321-176861343 GTGAGGAAACAGGTTCAGGATGG + Intronic
1002570666 5:180137730-180137752 AAGAGGGCACAGGCTCAGGAGGG + Intronic
1003263489 6:4546472-4546494 CTGAGCAAGCAGGCTCAGGATGG - Intergenic
1003538384 6:6996344-6996366 GTGATGGAACAGGCTCAGAGAGG - Intergenic
1003959930 6:11199372-11199394 ATGAGAAAACAGGCTTAGAATGG - Intronic
1004444124 6:15682165-15682187 TTGAAGAAACAGGCTCAGAATGG - Intergenic
1006099578 6:31678087-31678109 ATGAGGAAACAGGTGCAGAAAGG - Intronic
1006428651 6:33981942-33981964 ATAAAGAAACAGGCTCAGAGAGG - Intergenic
1006520772 6:34569878-34569900 ATGAGGAAACAGGCCCAGAGAGG + Intergenic
1006811632 6:36824028-36824050 ATGAGGAAACAGGCTCAGAGAGG - Intronic
1007110780 6:39312533-39312555 GTGAAGAAACAGGCTCAGAGAGG - Intronic
1007428679 6:41763778-41763800 ATGAGGAAACAGGTTCAGAGAGG + Intergenic
1007431298 6:41779035-41779057 AGGAAGAAGCAGGCTCAGGGAGG + Intronic
1007703193 6:43776148-43776170 ATGCTGAAACAGGCTGAAAAAGG - Intronic
1007744745 6:44036648-44036670 ATGAAGAAACAGACTCTAGATGG + Intergenic
1008725201 6:54409069-54409091 ATGAAGAAACAGGCTCAACATGG + Intergenic
1008900627 6:56611264-56611286 ATAAGGAAACAGGCTCAGAGAGG - Intronic
1010388340 6:75308397-75308419 ATGAGGAAACAGGCTCAGATGGG + Exonic
1012347342 6:98207151-98207173 ATGAGAAAACAGGTTCAGAATGG + Intergenic
1012840636 6:104324994-104325016 ATGTAGAAACAGCCTCTGGATGG - Intergenic
1013609399 6:111779939-111779961 AAGAAGAAACAGGCTCAGAGAGG + Intronic
1013759840 6:113505023-113505045 ACTATGAAACAGCCTCAGGCAGG - Intergenic
1014610720 6:123541469-123541491 AAAATGAAAAAGGCTGAGGAGGG - Intronic
1015073199 6:129122825-129122847 ATGAGGAAACAGGCTCAGAGAGG - Intronic
1015774375 6:136798780-136798802 ATGAAGAAACAGGTCCAGAAAGG - Intergenic
1016422133 6:143896562-143896584 ATAAGGAAACAGGTTCAGCAAGG - Intronic
1017136227 6:151150005-151150027 ATGATAAAACAGATTCAGAAAGG + Intergenic
1017993529 6:159510588-159510610 GTGAGGAAATGGGCTCAGGAAGG - Intergenic
1018340524 6:162846641-162846663 ATGATAAAACAGCCACTGGAGGG - Intronic
1019509159 7:1408645-1408667 ATGAGGAAACAGGCTCAGAGAGG - Intergenic
1019668791 7:2267094-2267116 ATGGAGAAACAGGCTCAGGGAGG - Intronic
1021514639 7:21470866-21470888 ATGGTGAAACAGACTGAGGATGG - Intronic
1021601372 7:22367302-22367324 ATAAAGAAACAGGCTCAGAGAGG - Intergenic
1021800443 7:24300186-24300208 ATGAGGAAACAGGCTCAGAGAGG + Intergenic
1022525791 7:31036347-31036369 ATGAAGAAACAGGCTCAGAAAGG + Intergenic
1023132623 7:37017987-37018009 ATGAGGAAACAGGTTCAGGGGGG - Intronic
1023186096 7:37534695-37534717 ATGAGGAAACAGGCTCAGAGAGG + Intergenic
1023573281 7:41595120-41595142 TTGAGGAATAAGGCTCAGGAAGG + Intergenic
1024058715 7:45682688-45682710 CAGATGGGACAGGCTCAGGAGGG + Intronic
1024376956 7:48651223-48651245 ATGATGGAACAGACGCTGGAGGG - Intergenic
1024855571 7:53774565-53774587 AAGATGAACCAGGCTGTGGAGGG + Intergenic
1025279835 7:57619258-57619280 GTGAGGAAACAGGCTGCGGATGG - Intergenic
1025304897 7:57846243-57846265 GTGAGGAAACAGGCTGCGGATGG + Intergenic
1026836933 7:73645852-73645874 ATGAGGAAACAGGCTCAGAGAGG - Intergenic
1026990526 7:74582617-74582639 ATGTGGAAACAGGCTCAGAGAGG + Intronic
1027657098 7:80944197-80944219 ATAATGAGACAGGCAGAGGAAGG - Intergenic
1028385512 7:90248850-90248872 ATGAGGAAACAGACACAGAAAGG - Intronic
1028912076 7:96219526-96219548 ATGAGGAAACAGGCCCAGAGGGG - Intronic
1029115003 7:98232223-98232245 ATGGGGAGACAGGCTCGGGAGGG + Intronic
1029260355 7:99298109-99298131 ATGAGGAAACATGTTCAGCAAGG - Intergenic
1029371402 7:100153344-100153366 ATTACGGCACAGGCTCAGGAAGG - Intronic
1030078896 7:105760359-105760381 ATGAGGAAACAGGCTCTGAGAGG + Intronic
1030296532 7:107934467-107934489 AGGAAGAAACAGGCTCAGTTAGG + Intronic
1031910961 7:127516264-127516286 ATGAAGAAACAGCCTGAGGAAGG - Intergenic
1032001934 7:128271322-128271344 CTGAGGAAACAGGCCCAGAATGG - Intergenic
1032215787 7:129956049-129956071 ATGATAGAACAGGTTAAGGAAGG + Intergenic
1032324664 7:130916015-130916037 ATGATGAAACTGGCTTAGCGAGG - Intergenic
1033179742 7:139164320-139164342 ATGAGGAAACAGGCTCAGAAAGG + Intronic
1033242655 7:139693167-139693189 ATGAGGAAACAAGCTCAAGGAGG - Intronic
1034788864 7:153949885-153949907 AGGCTGAAACAGGGTCTGGAGGG + Intronic
1035050762 7:155997967-155997989 AAGAGGAACCAGGCTCAGGGAGG - Intergenic
1035242112 7:157538842-157538864 AGGATTAAACAGTCTCAGTAAGG - Intergenic
1036652090 8:10651092-10651114 ATCAGGAAGCAGGCTCAGAAGGG + Intronic
1036770197 8:11573410-11573432 GTGAGGAAACAGGCTTAGGGAGG - Intergenic
1036773606 8:11595006-11595028 ATGATGCCACAGGGTGAGGATGG - Intergenic
1037122524 8:15306053-15306075 TGGAAGGAACAGGCTCAGGAGGG - Intergenic
1037918228 8:22785680-22785702 ATGAGGACTCAGGCTCAGGGAGG - Intronic
1037979319 8:23239642-23239664 CTCATGACACAGACTCAGGAAGG - Intergenic
1038290415 8:26244273-26244295 GTGAGGAAACAGACTCAGAAAGG - Intergenic
1038564788 8:28610677-28610699 ATGAAGAAATGGGCTCAGGTTGG + Intronic
1039635430 8:39159560-39159582 AGGAAGAAAGAGGCTGAGGAAGG - Intronic
1039915598 8:41858234-41858256 AAGATAAAACAGGCTTAGGCAGG + Intronic
1040466566 8:47701000-47701022 CTGCTGGAAAAGGCTCAGGAGGG - Intronic
1040594359 8:48823095-48823117 ATGCTGAACCAGGGTCAGGCAGG + Intergenic
1040759514 8:50821962-50821984 GTGATTAAACAGCCTCAGGCAGG - Intergenic
1041053661 8:53961010-53961032 ATGAGGAAGCAGGCCCAGAAAGG - Intergenic
1041746892 8:61217104-61217126 ATCATGAAAAAGTCTCAGAAAGG - Intronic
1043442641 8:80289833-80289855 ATGAGAAAACAGGCTCAGAGAGG + Intergenic
1043980498 8:86633075-86633097 ATGATGAAACAAGCCCAAGGAGG + Intronic
1044481206 8:92691052-92691074 ATTATGAAACAGGCTAAGCAAGG - Intergenic
1044584577 8:93857582-93857604 ATGAGGAAACAGCTTCAAGAAGG - Intergenic
1044803160 8:95977724-95977746 AGGAAGAAACAGGCTCAGAGAGG - Intergenic
1044911917 8:97068786-97068808 ATGAAGAAACAGACTCATAAGGG + Intronic
1044938821 8:97319592-97319614 ATGAAGAAACAGGCCCAGTGAGG - Intergenic
1045051460 8:98330904-98330926 ATGAGGAAACTGGCTCAGAGAGG + Intergenic
1046031525 8:108787962-108787984 ATGTGGAAACAGGCTCAGAGAGG + Intergenic
1046280133 8:112017577-112017599 ATGATCAAACACTCTCAGTAGGG - Intergenic
1047119311 8:121882814-121882836 ATGATTAGAGAGGCTCAGAAAGG + Intergenic
1047154486 8:122301653-122301675 ATGAGAAAAAAGGCTCAGAAAGG + Intergenic
1047713839 8:127577381-127577403 ATGAGAAAACAGGCTCAGACAGG - Intergenic
1047816652 8:128471757-128471779 ATGATGAATCAGACTCATCATGG + Intergenic
1048018478 8:130518356-130518378 ATGAGGAAACTGGCTCAGAGAGG - Intergenic
1048140794 8:131792226-131792248 TTGAGGAAACAGGCTCAGAGAGG + Intergenic
1048470383 8:134699452-134699474 ATTAGGAAACGGGCTCAGCAGGG - Intronic
1048511973 8:135071290-135071312 ATGAAGAAATAGGATCAGAAAGG - Intergenic
1048675833 8:136778799-136778821 GTGAGGAAACAGGATCTGGATGG + Intergenic
1048971443 8:139647168-139647190 AGGGTGGAACAGGCCCAGGATGG + Intronic
1049223770 8:141440065-141440087 ATGAGGAAACAGGCCCAGAGAGG + Intergenic
1050068838 9:1789327-1789349 ATGAGGACACAGGACCAGGAAGG - Intergenic
1050163404 9:2740749-2740771 ATTATAAAACTGGCTCAGTAAGG - Intronic
1051189878 9:14500160-14500182 ATGAGGAAACAGGCACAGAGAGG + Intergenic
1051901301 9:22044702-22044724 ATGGGGATACAGGCACAGGAAGG - Intergenic
1052233885 9:26187985-26188007 AAGATGAAGCAGGTTCAAGAAGG + Intergenic
1052236499 9:26217459-26217481 ATGCAGAAGCAGGCACAGGAAGG + Intergenic
1052820062 9:33131276-33131298 GTGAGGAAACAGGCTCAGAGAGG - Intronic
1053153087 9:35755175-35755197 ATGAGGAAACAGGCTCAGAGAGG - Exonic
1053471994 9:38353192-38353214 ATGTGGAAACAGGCTCAGAGGGG - Intergenic
1054853986 9:69878440-69878462 ATGCTGAAACAGAATCAGGCAGG - Intronic
1055081036 9:72267733-72267755 ATCAGGAAACAGGTTCAGAAAGG + Intergenic
1055670311 9:78598352-78598374 ATTATGAAACATGCTCCGAAAGG + Intergenic
1055947973 9:81708963-81708985 ATGTTGAAACAGGCCCGGTATGG + Intergenic
1056606832 9:88092927-88092949 AGGAGGAAGCTGGCTCAGGAAGG + Intergenic
1056657853 9:88523782-88523804 ATGATAAAAATGGCCCAGGAAGG + Intergenic
1056693254 9:88825750-88825772 ACGGTGAAACAGGCATAGGACGG - Intergenic
1057337092 9:94164813-94164835 ATGATGAAGTAGGCTGAGGTGGG - Intergenic
1057479366 9:95432504-95432526 ATGGGGAAACAAGCTCAGGGGGG - Intergenic
1057529544 9:95831909-95831931 CTGAGAAAACAGCCTCAGGAAGG - Intergenic
1057928068 9:99170573-99170595 ATGGGGAAACAGGCTGAGAAAGG + Intergenic
1058479786 9:105380154-105380176 ATGGAAAAACAGGCTCAGAATGG + Intronic
1058581129 9:106458883-106458905 GTGAGGAAACAGGCTCAGAGAGG - Intergenic
1058635444 9:107033867-107033889 ATGAAGAAACAGACTAAGGAAGG - Intergenic
1058665492 9:107310822-107310844 ATGAAGAAACAGGCTTAGAAAGG + Intronic
1059206331 9:112469782-112469804 ATGAGGAAACAGACTCAAAAAGG - Intronic
1059431908 9:114255431-114255453 ATGGGGAGACAGGCCCAGGACGG - Intronic
1059439599 9:114299570-114299592 ATGAGGAAACAGGCTCAGAGAGG - Intronic
1059647427 9:116281343-116281365 ATGCTGGTATAGGCTCAGGAGGG - Intronic
1059672790 9:116507347-116507369 ATGGAGAAACAGGCACAGAAGGG + Intronic
1059757785 9:117309999-117310021 ATGAAGAAACAGGCTCAGAAAGG - Intronic
1059825240 9:118020799-118020821 ATGAGGAAACAGGTTCAAAATGG - Intergenic
1059939006 9:119339695-119339717 ATGAGGAAACAAGCTCAGAGAGG + Intronic
1060066045 9:120501971-120501993 ATGAGGAAACAGGCTGAGACAGG + Intronic
1060069968 9:120537663-120537685 ATGATGAAACAGGCACAGTGTGG - Intronic
1060128862 9:121075674-121075696 ATGAGGAAACATGATCAGGAAGG - Intronic
1060276128 9:122184159-122184181 ATGAGGAAACAGGCTCAGTGGGG + Intronic
1060279260 9:122204951-122204973 ATGAGGAAACAGGCTCAGAGAGG - Intronic
1060451365 9:123743832-123743854 TTAAGGAAACAGGCTCAGAAAGG + Intronic
1060872700 9:127055599-127055621 ATGAGGAAACAGACACAGAAAGG + Intronic
1060900977 9:127258012-127258034 ATGAGGAAACAGGCTCAGAGAGG + Intronic
1060916532 9:127395166-127395188 ATAAGGAAATAGGCTTAGGAAGG + Intergenic
1061047900 9:128177211-128177233 AAGAGGAAACAGGCACAGGGTGG + Intronic
1061048043 9:128177992-128178014 ATGGGGAAACAGACTCAGGAGGG + Intronic
1061106282 9:128533131-128533153 ATGATGAAACAGGCTGGGCATGG + Intronic
1061147536 9:128808676-128808698 ATGAGGAGACTGGCTCAGCAAGG + Exonic
1061510434 9:131057656-131057678 AAGAGGAAGCAGGCTCAGGGAGG - Intronic
1061684759 9:132266227-132266249 ATGAGGAAACAGGCTCAGAGAGG - Intronic
1061823168 9:133239771-133239793 ATGATGAAAGGGGCTCGGGGCGG - Intergenic
1061937620 9:133866992-133867014 TTGAGGAAACAGGCTCAGGGAGG - Intronic
1061945124 9:133904481-133904503 ATGAGTGAGCAGGCTCAGGACGG + Intronic
1062056560 9:134472106-134472128 AGGAGGACCCAGGCTCAGGAAGG - Intergenic
1062271508 9:135711972-135711994 ATGAGCATACAGGCTCAGGGAGG + Intronic
1203631216 Un_KI270750v1:74046-74068 GTGAGGAAACAGGCTGCGGATGG - Intergenic
1185819100 X:3184614-3184636 ATGAGGACACAGGCTCAGTTGGG + Intergenic
1186343899 X:8671065-8671087 ATGATGAAGAAGGCTGAGAATGG - Intronic
1186467510 X:9795445-9795467 ATCATGAAACAAGATCAGTATGG - Intronic
1186780023 X:12903175-12903197 AGGAGGAAACAGGCTCATAAAGG - Intergenic
1186890313 X:13953429-13953451 ATGAGGAAACAGGCTCAAAGGGG - Intergenic
1186923519 X:14307334-14307356 ATAATGAAATAGGCTGAGAAAGG - Intergenic
1187441332 X:19323318-19323340 ATGAAGAAACAGGCACATGGGGG - Intergenic
1187656400 X:21479858-21479880 ATGCTGAGATAGCCTCAGGATGG + Intronic
1187862601 X:23696583-23696605 ATGAGGAAACAGGCTTAGAGAGG - Intergenic
1187898291 X:24003211-24003233 ATAAGGAAACAGGCACAGAAAGG - Intronic
1188618188 X:32185347-32185369 GTGAAGAAACAGATTCAGGAAGG - Intronic
1189085353 X:38017535-38017557 ATGATGAAAGAGACTGAAGAGGG - Intronic
1189268515 X:39734383-39734405 ATGATAAAACAGGTTCAGAGAGG - Intergenic
1190421670 X:50290876-50290898 ATGATGGAACTGTCTCTGGAAGG - Intronic
1190756996 X:53409795-53409817 ATGAGGAAACAGGTACAGAAAGG - Intronic
1191617757 X:63188151-63188173 ACCATGACACAGCCTCAGGATGG + Intergenic
1191765051 X:64689204-64689226 ATAAAGAATCAGGCTCAGGAGGG + Intergenic
1191780407 X:64858145-64858167 ACCATGAAAGAGGCTGAGGATGG - Intergenic
1191951062 X:66593759-66593781 ATGATGATAAAGGCATAGGAAGG - Intergenic
1192139396 X:68634666-68634688 AAGATGAAACAGATTCATGAAGG + Intergenic
1192862841 X:75096607-75096629 AATGTGAAACAAGCTCAGGAAGG - Intronic
1193864558 X:86715175-86715197 TTGAGGAAACATGTTCAGGAGGG - Intronic
1194751479 X:97689561-97689583 AGGATGAACCAGACTCAGAATGG + Intergenic
1195679548 X:107534073-107534095 ATGATGAAACAGGTCCAGAATGG - Intronic
1195781016 X:108464183-108464205 ATGAAGAAAGGGGATCAGGAAGG - Intronic
1196002537 X:110802204-110802226 ATAAGGAAACAAGCTCAGAAAGG - Intergenic
1196410686 X:115414962-115414984 ATGATGAAACAGAATTGGGAAGG - Intergenic
1196906304 X:120439858-120439880 AAGTGGAAACAGGATCAGGAAGG + Intronic
1197528766 X:127596178-127596200 ATGATGAAACAGTATCGGGTAGG - Intergenic
1197735437 X:129847380-129847402 ATGAAGAAATAGTCTCAGAAAGG - Intergenic
1197883944 X:131198431-131198453 ATTTTGAAACAAGCTGAGGAAGG - Intergenic
1198056302 X:132998915-132998937 GTGAAGAAACAGGCCCAGAAAGG + Intergenic
1198377066 X:136050725-136050747 AGGAAGAGACAGGCTCAGGCAGG - Intergenic
1198399687 X:136256819-136256841 ATGAGGAAGCAGGCCCAGGGAGG + Intergenic
1198506914 X:137310078-137310100 CAGGTGAAACAGGCTCAGGGAGG - Intergenic
1198641878 X:138765112-138765134 ATGAAGAAAGAGGCTCAGTGAGG - Intronic
1198669496 X:139064029-139064051 TAGATGAACCAGGTTCAGGATGG + Intronic
1198684278 X:139211256-139211278 ATGAGGAAACAAGCTCAGAGAGG + Intronic
1198783803 X:140265746-140265768 ATGAGAAAACAGGCTCAGTGAGG - Intergenic
1199828426 X:151523933-151523955 ATGATAAATCAGGCTAAGAAAGG + Intergenic
1200343944 X:155429363-155429385 ATGAGGAAACAGAATCAGGTGGG - Intergenic