ID: 1085520766

View in Genome Browser
Species Human (GRCh38)
Location 11:77137825-77137847
Sequence TCCTTCTGGGGTAAGTTTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 219
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 203}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085520766_1085520777 14 Left 1085520766 11:77137825-77137847 CCCCCAAACTTACCCCAGAAGGA 0: 1
1: 0
2: 1
3: 14
4: 203
Right 1085520777 11:77137862-77137884 TCACTCCCCAGAGGCAGCCAGGG 0: 1
1: 2
2: 4
3: 45
4: 364
1085520766_1085520776 13 Left 1085520766 11:77137825-77137847 CCCCCAAACTTACCCCAGAAGGA 0: 1
1: 0
2: 1
3: 14
4: 203
Right 1085520776 11:77137861-77137883 CTCACTCCCCAGAGGCAGCCAGG 0: 1
1: 0
2: 7
3: 49
4: 398
1085520766_1085520773 5 Left 1085520766 11:77137825-77137847 CCCCCAAACTTACCCCAGAAGGA 0: 1
1: 0
2: 1
3: 14
4: 203
Right 1085520773 11:77137853-77137875 TATCTGCCCTCACTCCCCAGAGG 0: 1
1: 0
2: 2
3: 17
4: 232

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085520766 Original CRISPR TCCTTCTGGGGTAAGTTTGG GGG (reversed) Intronic
901473025 1:9470783-9470805 TCCGCCTGGCGTCAGTTTGGAGG - Intergenic
902220438 1:14961117-14961139 TCCTTCTGGGGTGTGAATGGTGG + Intronic
903395910 1:23001780-23001802 TACTTGTGGGTTAAGTTGGGGGG + Intergenic
905079083 1:35301257-35301279 TCCTTCTGGGCTGAGTGTGGTGG + Intronic
905398597 1:37685076-37685098 TCGTTCTAGGGTAAGATTTGGGG - Intronic
907248995 1:53125564-53125586 TCCTACTGGGTTCATTTTGGAGG - Intronic
909035576 1:70591174-70591196 TACTTGTGGGTTAAGGTTGGGGG - Intergenic
913483340 1:119310787-119310809 TCCTGCTGGGTTAACTTTTGAGG - Intergenic
913992441 1:143627208-143627230 TCCTTCTGGGGAAGGCCTGGAGG + Intergenic
920367242 1:205454689-205454711 CCCTTTAGGGGTAATTTTGGTGG - Intronic
920726127 1:208436761-208436783 GCCTTCTGGGGCATGGTTGGAGG + Intergenic
921453419 1:215337644-215337666 ACCTTCTGGTTTCAGTTTGGTGG + Intergenic
1064772165 10:18734692-18734714 TCTTTCTGGGGTGGGGTTGGTGG + Intergenic
1069342151 10:67423642-67423664 TCTTTTTGTGGTATGTTTGGTGG - Intronic
1069458542 10:68573108-68573130 TCCTTGAGAGGTAACTTTGGGGG - Exonic
1071981773 10:91010536-91010558 TCTTTCTGGGGTGGGGTTGGGGG + Intergenic
1074879534 10:117644547-117644569 TTCTTCTGGTGTAGGTTTGCTGG + Intergenic
1076544672 10:131237209-131237231 ACCTTCTGGGCAAAGCTTGGAGG - Intronic
1076606837 10:131694852-131694874 TCCTTCTGGGGAAGGATTAGGGG - Intergenic
1077858637 11:6155591-6155613 TTCAACTGGGGTAAGTTTTGGGG - Intergenic
1081590180 11:44417251-44417273 TCCTTCTTGAGAAGGTTTGGGGG - Intergenic
1081836858 11:46162854-46162876 TGGTTCTGGGGTTTGTTTGGGGG + Intergenic
1082918410 11:58464828-58464850 TCCTTATGGGGTGAGGTTGGAGG + Intergenic
1084245501 11:67854290-67854312 TACTTCTGGGTTAAGGTGGGTGG + Intergenic
1084787148 11:71448926-71448948 TCCATCTCGGGTCACTTTGGCGG - Intronic
1084827184 11:71740288-71740310 TACTTGTGGGTTAAGTTGGGTGG - Intergenic
1084940359 11:72609364-72609386 TCCTTCTGGGGAAAGTGAGCGGG - Intronic
1085520766 11:77137825-77137847 TCCTTCTGGGGTAAGTTTGGGGG - Intronic
1085528742 11:77179340-77179362 TCCTTCTGGAGTGTTTTTGGGGG + Intronic
1086060097 11:82691609-82691631 TCCTTCTGAGTTTAGTTAGGGGG - Intergenic
1088555064 11:111053062-111053084 TACTTGTGGGTTAAGGTTGGGGG - Intergenic
1089708058 11:120295030-120295052 CCCTTTGGGTGTAAGTTTGGGGG - Intronic
1091229301 11:133977434-133977456 TGCTCCTGGGGTAAGCTTCGGGG - Intergenic
1091963126 12:4716105-4716127 TCCTTTTGAGGTAAGTCTGCTGG + Intronic
1092140880 12:6182634-6182656 TCCTTATAGGGGAGGTTTGGAGG - Intergenic
1093947633 12:25128576-25128598 TTCTGTTTGGGTAAGTTTGGGGG - Intronic
1094825853 12:34268508-34268530 TACTTGTGGGTTAAGGTTGGGGG - Intergenic
1095522820 12:43087145-43087167 TCCTTCTGGTGACTGTTTGGTGG - Intergenic
1100377935 12:94034631-94034653 TCCTCCTGGAGCAAGTTTAGAGG + Intergenic
1102581247 12:113889449-113889471 TCAATCTGGGGAAATTTTGGGGG + Intronic
1103982839 12:124747753-124747775 TACTTCTGGGGAGAGTCTGGGGG - Intergenic
1105777880 13:23679980-23680002 TCCTTCTGGGGACAGTGAGGAGG + Intergenic
1108952835 13:56115251-56115273 TACTTGTGGGTTAAGGTTGGGGG + Intergenic
1111631587 13:90851424-90851446 TACTTGCGGGTTAAGTTTGGGGG + Intergenic
1113313438 13:109154667-109154689 GCCTTCTGGGGAAAGTGAGGAGG + Intronic
1114625034 14:24123375-24123397 CCCTTGTGGGGAATGTTTGGAGG + Exonic
1115952768 14:38739882-38739904 TCCTTCAGGTCTCAGTTTGGAGG - Intergenic
1116934669 14:50726808-50726830 TCCTTATGGGGACATTTTGGTGG - Intronic
1120710115 14:87784792-87784814 TCCTTCTTGGGTGTGTTTTGTGG - Intergenic
1120906785 14:89627727-89627749 TCCTTCTGGGCTGGGTGTGGTGG - Intergenic
1121193178 14:92047546-92047568 TACTTGTGGGTTAAGGTTGGGGG + Exonic
1129300769 15:74624228-74624250 GCCTCCTGGGGTGAGGTTGGGGG + Intronic
1130410876 15:83647930-83647952 TCCTTCTGGTGTAATTTGTGAGG - Intergenic
1132987173 16:2773492-2773514 TCCTTGAGTGGTAAGCTTGGGGG + Intronic
1133765619 16:8835857-8835879 TACTTGTGGGTTAAGGTTGGGGG + Intronic
1135042860 16:19131225-19131247 TTCATCTGGGTTAAGATTGGAGG - Intronic
1136371780 16:29841242-29841264 TCCTTCATGGGGCAGTTTGGAGG - Intronic
1141352662 16:83312563-83312585 CCCTTCTTGGGCAGGTTTGGAGG + Intronic
1142292368 16:89199010-89199032 TCTTTTGGGGGTAAGTGTGGTGG - Exonic
1143756257 17:9069916-9069938 TCCTCCTGGGAAGAGTTTGGTGG + Intronic
1144766888 17:17737971-17737993 TCCTTCTGGGGCCAGGGTGGGGG - Intronic
1146464528 17:33075659-33075681 GCCTTCTGGGGGAAACTTGGGGG + Intronic
1146506644 17:33411497-33411519 TCCTGCTGGGCTGATTTTGGAGG + Intronic
1146734812 17:35229534-35229556 GCCTTCTGGTGTATGTGTGGGGG + Intergenic
1147417411 17:40303129-40303151 GCCTTCTGGGTTTGGTTTGGTGG + Exonic
1148584820 17:48769922-48769944 TTCTTCTGGGTTAAGTGTGGAGG + Exonic
1149492151 17:57092746-57092768 CCCCTCTGGAGAAAGTTTGGTGG + Intronic
1150289454 17:63973081-63973103 CACTTCTGGGGAAAGTGTGGTGG - Intergenic
1153370371 18:4308626-4308648 TCTTTGTCAGGTAAGTTTGGGGG - Intronic
1158336488 18:56418470-56418492 TACTTGTGGGTTAAGGTTGGGGG - Intergenic
1161310950 19:3593552-3593574 TCATTTTGGGGGAAGTTTGGGGG + Intergenic
1162132671 19:8536698-8536720 TCATGCTGAGGGAAGTTTGGGGG + Intronic
1162316619 19:9942880-9942902 TCCTGCTTGGGTGAGTTGGGAGG + Intergenic
1165285497 19:34838583-34838605 TCTTTCTGAGGCAAGTATGGAGG + Intergenic
1165417323 19:35702757-35702779 TCCCTCTGCGGTATGGTTGGAGG + Intergenic
1166916915 19:46201718-46201740 TACTTGTGGGTTAAGGTTGGGGG + Intergenic
925161211 2:1685574-1685596 TCCTTCTGGGCTTTGCTTGGGGG - Intronic
926463979 2:13166827-13166849 TACTTGTGGGTTAAGTTGGGGGG + Intergenic
928569323 2:32587448-32587470 TGCTTTTGGGCTAAGTGTGGCGG + Intronic
928779601 2:34803799-34803821 TACTTGTGGGTTAAGTTGGGGGG + Intergenic
929668888 2:43853868-43853890 TCCTCCTGGGGGAAGGATGGTGG - Intronic
930063259 2:47308543-47308565 TCCTTGTGGGGTCACTTTGAGGG - Intergenic
932034647 2:68230684-68230706 TCTTTCTAGGGTAAGTCTGCTGG + Intronic
932101932 2:68908956-68908978 GCCTTCTGGGAATAGTTTGGTGG - Intergenic
934523568 2:95034746-95034768 TCCATCTGTGGTCAGGTTGGGGG + Intronic
935238114 2:101154787-101154809 TGCATCAGGGGCAAGTTTGGAGG - Intronic
935697736 2:105784704-105784726 TCCTCCAGGGGCAAGTTTGATGG - Intronic
935813576 2:106825086-106825108 TCATTATGGAGTCAGTTTGGAGG - Intronic
937447297 2:121969705-121969727 TTCTTCTGGGGTTATTTTTGTGG + Intergenic
937677491 2:124607946-124607968 TCCTGCTGCGGAAAGTTTGCTGG + Intronic
938033948 2:128020068-128020090 CCTTTGTGGGGTAAGTTTGGGGG - Intronic
939353020 2:141065710-141065732 TCCTTTTTGTGTAATTTTGGGGG - Intronic
939574504 2:143879950-143879972 TCCTGCACGGGGAAGTTTGGAGG + Intergenic
940288552 2:152055985-152056007 TCCTTCTGGCTTCAGTGTGGTGG - Intronic
940328623 2:152451864-152451886 CCTGTGTGGGGTAAGTTTGGAGG + Intronic
940508676 2:154586068-154586090 TACTTGTGGGTTAAGGTTGGGGG + Intergenic
940916698 2:159264531-159264553 CCCTTCTGGGGTAAGATTCTTGG + Intronic
941253746 2:163201100-163201122 TTCTTATGGAGTAAGCTTGGGGG - Intergenic
943538505 2:189182518-189182540 TCCTCCTGGGGACAGTGTGGTGG - Intergenic
944026394 2:195174250-195174272 TATTTCTGTGGAAAGTTTGGGGG - Intergenic
944251140 2:197580989-197581011 TACTTGTGGGTTAAGTTGGGGGG - Intronic
945394408 2:209302095-209302117 TACTTGTGGGTTAAGGTTGGGGG - Intergenic
1169001653 20:2172290-2172312 TCCTTCTGGTCTCAGTATGGAGG + Intronic
1170680326 20:18520431-18520453 TACTTGTGGGTTAAGGTTGGGGG + Intronic
1176023828 20:62975924-62975946 GCCTGCTGGGGGAAGGTTGGGGG - Intergenic
1182547886 22:31086064-31086086 GCCTTCTGTGGTACATTTGGAGG - Intronic
1183739317 22:39661344-39661366 TCCTGCTGGGGTGTGTGTGGAGG + Intronic
1184454369 22:44600839-44600861 CCCTTCTGGGCTAAGTCTGGGGG - Intergenic
1184538222 22:45101932-45101954 TCCTTCTAGGGTGAGGTGGGGGG + Intergenic
950667282 3:14505286-14505308 GCCATCTGGGGTAAGTCAGGTGG + Intronic
952165946 3:30748944-30748966 TCCCTCTGTGGGAAGTTTAGAGG - Intronic
953910951 3:46892806-46892828 GCCTTCTGGGGTAGGGATGGAGG + Intronic
954345805 3:49997927-49997949 TGATTTTGTGGTAAGTTTGGAGG + Intronic
956164564 3:66386665-66386687 TCCTTTTGGAGTAAGGTTTGTGG - Intronic
958182994 3:90083940-90083962 TACTTCTGGGTTAAGGTAGGGGG - Intergenic
958814387 3:98900828-98900850 TCCTTCTGGGGAAAATTTTGGGG - Intronic
960244362 3:115383102-115383124 CTCTGCTGGGGTAAGTCTGGTGG - Intergenic
961559295 3:127717696-127717718 TCCCTCTGGGCTAAGCTTGAGGG - Intronic
962126676 3:132626911-132626933 TCCTTCTGGGGGATGTTTTTTGG - Intronic
962159425 3:132983298-132983320 TCCTTCTGTGGTAACCTTAGAGG - Intergenic
962658031 3:137569259-137569281 CCCTTAGGGGCTAAGTTTGGTGG - Intergenic
963456556 3:145554018-145554040 TACTTGTGGGTTAAGTTGGGGGG + Intergenic
963520549 3:146356428-146356450 TCCTTGTGGGTTAAGGTGGGGGG - Intergenic
964983726 3:162715270-162715292 TACTTGTGGGTTAAGGTTGGGGG - Intergenic
965624780 3:170675357-170675379 TACTTGTGGGTTAAGTTGGGGGG + Intronic
966085534 3:176064215-176064237 TACTTGTGGGTTAAGGTTGGGGG - Intergenic
968863324 4:3190388-3190410 TCCTCCTGTGTTAAATTTGGAGG + Intronic
973549347 4:52016654-52016676 TACTTCTGCTGTAAGTTTGGAGG + Intronic
974428292 4:61767134-61767156 TACTTGTGGGTTAAGGTTGGGGG + Intronic
975226704 4:71880946-71880968 TCCTTGTGGGGAAAATATGGGGG + Intergenic
975707306 4:77123835-77123857 TCCTTCTGGGGAAATTGTGAGGG - Intergenic
976208947 4:82648192-82648214 TCCCTCTGGGAGATGTTTGGGGG + Intronic
977494254 4:97755089-97755111 TCCTTTTGTGGTAAGTTTGGAGG + Intronic
980091976 4:128452673-128452695 TCTGTGTGGGGTAAGTTAGGAGG - Intergenic
981026568 4:140082704-140082726 GCCTTCTGGGGAAAGCCTGGTGG - Intronic
982497002 4:156106315-156106337 TACTTGTGGGTTAAGGTTGGGGG + Intergenic
983448157 4:167879128-167879150 TACTTGTGGGTTAAGGTTGGGGG - Intergenic
986854987 5:11858000-11858022 TCCTTATGGCATATGTTTGGAGG + Intronic
988032726 5:25784740-25784762 TGCTTATGGAGCAAGTTTGGAGG + Intergenic
990241908 5:53824454-53824476 TCCTTCTGGGGCAAGTGGGTAGG - Intergenic
994388359 5:99159706-99159728 TCCTTCTGGGTTTTGTTTGCAGG + Intergenic
995125056 5:108571305-108571327 TACTTGTGGGTTAAGGTTGGGGG + Intergenic
995866946 5:116701552-116701574 TCCTTCTTGGGTCAGTTGGAGGG + Intergenic
996510002 5:124306664-124306686 TACTTGTGGGTTAAGTTGGGGGG - Intergenic
997607424 5:135185175-135185197 TCCTTTTGGGGGCAGTTTGGAGG + Intronic
997772538 5:136568185-136568207 TACTTGTGGGTTAAGGTTGGGGG + Intergenic
999758298 5:154681628-154681650 TCCTTGGGGGGTATGTGTGGGGG - Intergenic
999882310 5:155879469-155879491 TCTTTGAGGGGTAAATTTGGAGG - Intronic
1000277258 5:159748873-159748895 TCCTTGTAGGGTAACTTTGGTGG - Intergenic
1001781313 5:174371388-174371410 GAGGTCTGGGGTAAGTTTGGAGG - Intergenic
1002610845 5:180417561-180417583 TACTTGTGGGTTAAGGTTGGGGG + Intergenic
1003230546 6:4248740-4248762 TGATTCTGGGGTACGTTTGTTGG + Intergenic
1003364155 6:5456852-5456874 TCCTTCTGTGGACGGTTTGGGGG - Intronic
1003576314 6:7299185-7299207 TTCTTCTGGGGTAGGGGTGGTGG + Intronic
1004343885 6:14830780-14830802 TCCTTTGGGGGTAGATTTGGGGG + Intergenic
1008656137 6:53616124-53616146 TTTTGCTGGTGTAAGTTTGGAGG + Intronic
1011613568 6:89177551-89177573 TGCTGTTTGGGTAAGTTTGGTGG + Exonic
1012607800 6:101179778-101179800 TTCTTCTGGGGAAAGTTGGGTGG - Intergenic
1013348554 6:109285833-109285855 TCTTTCTGGGTTAAGCTTGTTGG - Intergenic
1014555959 6:122842701-122842723 TACTTGTGGGTTAAGGTTGGGGG - Intergenic
1014793879 6:125704699-125704721 TACTTGTGGGTTAAGGTTGGGGG + Intergenic
1015271480 6:131341743-131341765 CACTTGTGGGTTAAGTTTGGGGG - Intergenic
1016518209 6:144920793-144920815 AGCTTCTGGGGTAAGCTTGTGGG + Intergenic
1017922715 6:158885866-158885888 TACTTGTGGGTTAAGGTTGGGGG + Intronic
1019216563 6:170447619-170447641 TCCTTGTGGAGTCAGTGTGGAGG - Intergenic
1019735483 7:2648045-2648067 TCCTGGTGGGGTGAGTCTGGGGG + Exonic
1020852615 7:13376544-13376566 TCCTTCTGAGGGAAATTTGAAGG + Intergenic
1021637424 7:22706115-22706137 TACTTGTGGGTTAAGGTTGGGGG - Intergenic
1022837972 7:34135045-34135067 ACCTCCTGGGGAAAGTTAGGAGG + Intronic
1023698778 7:42873450-42873472 TACTTGTGGGTTAAGGTTGGGGG + Intergenic
1023778084 7:43629322-43629344 TTCTTCTGGGAGTAGTTTGGTGG - Intronic
1026319709 7:69258108-69258130 TTCTTCTTGGGTAAGTTGAGGGG - Intergenic
1029426200 7:100495486-100495508 TCCTTTTAGGGTAACTTTGCAGG - Intergenic
1030920593 7:115380772-115380794 TCCTGTTGGAGTAACTTTGGTGG - Intergenic
1032017448 7:128389057-128389079 TCCTGCTGAGGAGAGTTTGGAGG - Intergenic
1032191014 7:129765941-129765963 TCAGTCTGGGCTCAGTTTGGAGG - Intergenic
1032622873 7:133555623-133555645 TCATTCTGGGGTAATTCTGAGGG + Intronic
1034391181 7:150788784-150788806 TGCTTCTGGGGTAGGGTGGGAGG - Intergenic
1038317198 8:26496605-26496627 ACCTTCTTGAGTAAGTTTGGGGG - Intronic
1039498897 8:38001515-38001537 TACTTGTGGGTTAAGTTGGGGGG + Intergenic
1039511068 8:38092310-38092332 TACTTCTGGGCCAAGTTTGAGGG + Intergenic
1040768917 8:50949933-50949955 ACCCTCTGGGGAAAGATTGGGGG - Intergenic
1040825744 8:51619053-51619075 TGCTTCTGAGGCTAGTTTGGAGG - Intronic
1041410380 8:57547120-57547142 TACTTTTGGGGAAAGTTTAGGGG + Intergenic
1042697382 8:71570396-71570418 TTCTAGTGGGGTAAGATTGGAGG + Intronic
1043837833 8:85065844-85065866 TACTTGTGGGTTAAGGTTGGGGG - Intergenic
1046573701 8:115998733-115998755 TTCCTCTGTGGTAACTTTGGAGG - Intergenic
1046574225 8:116005785-116005807 TCCTTCTTGAGTGATTTTGGTGG - Intergenic
1047668603 8:127120042-127120064 TCCTTCTGGGCTAAGGTGGGAGG - Intergenic
1048257797 8:132918317-132918339 TCCTTCAGCGGTGAATTTGGAGG + Intronic
1049819852 8:144626939-144626961 TCCTGCTGGGATAAGGTTCGTGG + Intergenic
1051052740 9:12951219-12951241 TACTTGTGGGTTAAGGTTGGGGG - Intergenic
1051899967 9:22026676-22026698 ACCTCCTGGGGTATGTTTGGGGG + Intronic
1052449922 9:28615757-28615779 TCATTCTTGGGACAGTTTGGGGG + Intronic
1052916417 9:33927050-33927072 ACCCCCTGAGGTAAGTTTGGGGG + Exonic
1053803210 9:41777104-41777126 TCCTTCTGGGCAAATTTTGAGGG + Intergenic
1054191502 9:61988414-61988436 TCCTTCTGGGCAAATTTTGAGGG + Intergenic
1054646867 9:67599298-67599320 TCCTTCTGGGCAAATTTTGAGGG - Intergenic
1054807380 9:69407585-69407607 TACTTGTGGGTTAAGGTTGGGGG + Intergenic
1056103460 9:83323075-83323097 TACTTCTGGTGGAAATTTGGTGG + Intronic
1057911506 9:99023489-99023511 TCCCTCTGGGGTTATTTTGAAGG - Intronic
1059785731 9:117581615-117581637 TCCTTTTTGGGTAGGTTTGTTGG + Intergenic
1061263167 9:129491070-129491092 TCCTGCTGGGCTGAGTTTGTGGG + Intergenic
1062692055 9:137846992-137847014 TACTTGTGGGTTAAGTTGGGGGG - Intronic
1188900042 X:35721237-35721259 TCCTTGTGTGCTATGTTTGGGGG - Intergenic
1188952496 X:36393299-36393321 ACCTACTCAGGTAAGTTTGGGGG + Intergenic
1191761390 X:64651786-64651808 TACTTGTGGGTTAAGGTTGGGGG - Intergenic
1192766842 X:74148445-74148467 TTCTTGTAAGGTAAGTTTGGTGG - Intergenic
1193886033 X:86984673-86984695 TACTTGTGGGTTAAGGTTGGGGG - Intergenic
1193941606 X:87684767-87684789 TACTTGTGGGTTAAGGTTGGGGG - Intergenic
1195228265 X:102820103-102820125 TTTTTCTGGTGTAAGTGTGGTGG + Intergenic
1195427889 X:104755740-104755762 TCCTACTGGGGCAGTTTTGGGGG - Intronic
1196533440 X:116815321-116815343 TACTTGTGGGTTAAGGTTGGGGG + Intergenic
1202119638 Y:21509688-21509710 TGTTTCTGGGGTAAGCTTGCTGG + Intergenic
1202122091 Y:21533229-21533251 TGTTTCTGGGGTAAGCTTGCTGG + Intronic
1202156916 Y:21896154-21896176 TGTTTCTGGGGTAAGCTTGCTGG - Intronic
1202159362 Y:21919695-21919717 TGTTTCTGGGGTAAGCTTGCTGG - Intergenic
1202185810 Y:22184610-22184632 TGTTTCTGGGGTAAGCTTGCTGG - Intergenic
1202205550 Y:22401786-22401808 TGTTTCTGGGGTAAGCTTGCTGG + Intronic