ID: 1085521375

View in Genome Browser
Species Human (GRCh38)
Location 11:77140724-77140746
Sequence GATTATATGGGGCAGTTTAC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 75
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 67}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085521364_1085521375 25 Left 1085521364 11:77140676-77140698 CCCAGGGTCAGGGAGTGCAGCTG 0: 1
1: 0
2: 4
3: 26
4: 323
Right 1085521375 11:77140724-77140746 GATTATATGGGGCAGTTTACGGG 0: 1
1: 0
2: 0
3: 7
4: 67
1085521365_1085521375 24 Left 1085521365 11:77140677-77140699 CCAGGGTCAGGGAGTGCAGCTGG 0: 1
1: 0
2: 5
3: 44
4: 349
Right 1085521375 11:77140724-77140746 GATTATATGGGGCAGTTTACGGG 0: 1
1: 0
2: 0
3: 7
4: 67

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085521375 Original CRISPR GATTATATGGGGCAGTTTAC GGG Intronic
903351025 1:22716646-22716668 GATTCTATGGGCCAGTTTGCTGG + Intronic
909084859 1:71158332-71158354 GTTTATATGGGGCAGGATAGGGG + Intergenic
910051911 1:82984898-82984920 GACTATATGGTGCAGCTGACTGG - Intergenic
912696564 1:111846631-111846653 GATTATACGGGACAGTCTACAGG + Intronic
919416020 1:197310789-197310811 AATTACATAGGGCAGTTTAGGGG + Intronic
919602970 1:199645805-199645827 GGTTATATGGTATAGTTTACGGG + Intergenic
921493760 1:215811467-215811489 GATCAGATGAGCCAGTTTACTGG - Intronic
1066240770 10:33532748-33532770 TATTCAATGGGGCAGTTCACAGG + Intergenic
1069437290 10:68396475-68396497 TATTATATACGGCAGTTTCCAGG + Intronic
1074060134 10:109957812-109957834 GTTTATAAGGGGCACTGTACAGG - Intergenic
1078502904 11:11900554-11900576 GTTTATATAGTGCAGTGTACAGG + Intronic
1080372498 11:31667690-31667712 GATTATATTATGCAGTTCACCGG - Intronic
1085521375 11:77140724-77140746 GATTATATGGGGCAGTTTACGGG + Intronic
1088411998 11:109544478-109544500 GATCAGATGAGCCAGTTTACTGG - Intergenic
1090818728 11:130321263-130321285 GATGCTATGGGGCAGTTTCTAGG + Intergenic
1094038343 12:26094999-26095021 AATTTTATGTGCCAGTTTACTGG - Intergenic
1097524402 12:60712103-60712125 GATTTTATGGTGCAGTTCATAGG + Intergenic
1099089129 12:78282540-78282562 GATGATGTTGGCCAGTTTACTGG - Intergenic
1102226406 12:111231496-111231518 GATTGTCTGTGGTAGTTTACTGG - Intronic
1116414212 14:44661178-44661200 TATTATGTGGGAAAGTTTACCGG + Intergenic
1118406246 14:65426524-65426546 GATTATATGGGGAGGCTTAAAGG + Intronic
1118487594 14:66228504-66228526 GATCAGATGAGCCAGTTTACTGG + Intergenic
1121118077 14:91357670-91357692 GTTTATTTGGGGCTGGTTACGGG - Intronic
1121878106 14:97473431-97473453 GAGTTAAAGGGGCAGTTTACAGG - Intergenic
1132250991 15:100335257-100335279 GATTAAATGGGGCAGGTCTCTGG - Intronic
1135511319 16:23086487-23086509 AATTCTATGGGGCAGGTTGCTGG + Intronic
1143455205 17:7063050-7063072 GATGATGTGGGGCAGGTTGCAGG - Intergenic
1147653813 17:42077311-42077333 TATTATATGGGGTACTTTGCAGG - Intergenic
1147923715 17:43934001-43934023 GAGTTTAAGGGGCAGTTGACAGG + Intergenic
1148341260 17:46874911-46874933 GAATTTAAGGGGCAGTTGACAGG + Intronic
1155301745 18:24435721-24435743 TATTATGTGGGGCAGTTAATCGG + Intronic
1159834341 18:73319281-73319303 GATCAAAAGAGGCAGTTTACGGG - Intergenic
927201909 2:20583288-20583310 AAGGATATGGGGCAGCTTACTGG + Intronic
928185105 2:29102965-29102987 GAATATATGGGGGAGTTTTAGGG - Intronic
929420265 2:41783250-41783272 AGTTATATGGGGAAGTTTAATGG - Intergenic
930414850 2:51078357-51078379 GACCATATAGGGCAGTTTTCTGG - Intergenic
932720775 2:74137836-74137858 GATTATATGAGGCTTTTTCCAGG - Intronic
935704926 2:105848176-105848198 GATTAAATGAGCCAGTCTACAGG - Intronic
939134347 2:138275624-138275646 GATTATATGGGGCAATATATAGG - Intergenic
941103038 2:161319247-161319269 CATTCTATGGGTCAGTTTTCTGG - Intronic
944211808 2:197213698-197213720 GATTGTATGAGCCAGTCTACAGG - Intronic
945307564 2:208273138-208273160 GATTTTTTGGGTCTGTTTACTGG - Intronic
945560752 2:211337073-211337095 GATTTTATCGGGCAGATTTCAGG + Intergenic
1169735391 20:8832349-8832371 TATTATAATGGGCAGTTTTCAGG - Intronic
1172414052 20:34749916-34749938 GGAAATATGGTGCAGTTTACGGG - Exonic
1182121411 22:27789597-27789619 GTTTATATGGGGATGTTTATTGG + Intronic
953395210 3:42563715-42563737 GAATACATGGGGCTGTTTCCTGG - Intronic
955869711 3:63424719-63424741 GATAATATGGGGCACTTTGGAGG + Intronic
958779788 3:98526516-98526538 TACTATATGTGGCACTTTACAGG - Intronic
959931697 3:111991506-111991528 AATCTTATGGGGCAGTTCACAGG - Exonic
963462855 3:145639250-145639272 GAAAATATGGGGCATTTTAGTGG + Intergenic
964578635 3:158204874-158204896 CATTATATGGGGAATTTTAAAGG + Intronic
967458896 3:189722417-189722439 GATTCTATCGTGCATTTTACAGG - Intronic
971420609 4:26470791-26470813 GGTTTTATGGGGAAGTTAACAGG + Intergenic
977682766 4:99813830-99813852 GATTATCTGGGACTGTTGACTGG + Intergenic
983721694 4:170861322-170861344 GAATTTATGGTGCAGTTTACTGG - Intergenic
987720249 5:21624123-21624145 GATTATAAGGGCCAGTTTTGAGG + Intergenic
991156282 5:63440426-63440448 GATTATATAAGGCAGATAACTGG - Intergenic
995865685 5:116688124-116688146 GGTTATATGGGGCTATTTACGGG + Intergenic
1000993118 5:167931434-167931456 TATTATATGGCCCAATTTACAGG - Intronic
1004507440 6:16258476-16258498 GTTGCTATGGGGGAGTTTACTGG + Intronic
1011586386 6:88930792-88930814 GAGAAGATGGGGCAGATTACAGG + Intronic
1021622528 7:22562812-22562834 CATTATTTGGGGGAGTTCACAGG - Intronic
1022332441 7:29392700-29392722 CATGATATGGGGCAGTTTCCTGG - Intronic
1036152445 8:6311093-6311115 GATAAAATTGGACAGTTTACAGG - Intergenic
1037041245 8:14237606-14237628 AATCACATGGGGCAGTTAACCGG - Exonic
1043254852 8:78122108-78122130 AATTATATGGGATAGTCTACTGG + Intergenic
1045326869 8:101123600-101123622 GTTTATATGGGACAGTTCAGAGG - Intergenic
1047160416 8:122371573-122371595 GAGAATATGGGGCAGTGTTCAGG + Intergenic
1188204063 X:27330531-27330553 GAATATATGGAGCAGTTTTCAGG + Intergenic
1189695193 X:43655605-43655627 GACTCTACGGGGGAGTTTACGGG - Intronic
1192367866 X:70489796-70489818 GATTAGAGGGCGGAGTTTACTGG - Intronic
1193383962 X:80848892-80848914 GATTATAAGGGCCAGTTTTGAGG - Intergenic
1194872320 X:99147219-99147241 GACTATATGGGCCAGTCTCCAGG - Intergenic
1197871273 X:131064929-131064951 GATTATATGGGGAATTGTAAAGG - Intronic