ID: 1085521802

View in Genome Browser
Species Human (GRCh38)
Location 11:77143532-77143554
Sequence CCTGCCCCGGAGAAGGTGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 429
Summary {0: 1, 1: 0, 2: 5, 3: 21, 4: 402}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085521794_1085521802 12 Left 1085521794 11:77143497-77143519 CCTTGGGGAGGGAAGGAGAGGTC 0: 1
1: 0
2: 5
3: 44
4: 412
Right 1085521802 11:77143532-77143554 CCTGCCCCGGAGAAGGTGGCTGG 0: 1
1: 0
2: 5
3: 21
4: 402

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085521802 Original CRISPR CCTGCCCCGGAGAAGGTGGC TGG Intronic
900427560 1:2587445-2587467 CCCGCCCCGCAGCTGGTGGCTGG + Intronic
900946157 1:5832425-5832447 CCTTCCCTGGAGAAGGGGGTTGG - Intergenic
901373051 1:8817204-8817226 CCAGCTCCGGGGAAAGTGGCGGG + Exonic
902578028 1:17390654-17390676 CCTGCCCTGGAAAAGCTGTCTGG - Intronic
902667313 1:17948657-17948679 CATGCTCGGGAGAGGGTGGCGGG - Intergenic
904484543 1:30816179-30816201 CCTGCCCCTGCCAAGGTGGAGGG + Intergenic
904542066 1:31239811-31239833 CCTGCCCCGGGGCGGCTGGCGGG + Intergenic
904572452 1:31477186-31477208 CCTGCTCCAGTGGAGGTGGCAGG + Intergenic
906383029 1:45344877-45344899 CCTGAGGTGGAGAAGGTGGCTGG + Exonic
906578824 1:46917543-46917565 CCTGCTCCAGTGGAGGTGGCAGG + Intergenic
906669432 1:47643843-47643865 GCTTCCCAGGAGGAGGTGGCCGG + Intergenic
907040754 1:51257138-51257160 CCTGTCCCAGATAAGGTGGGTGG - Intronic
907713300 1:56904393-56904415 CCTGCCCTTGAGAAGTTAGCAGG - Intronic
908981793 1:69967560-69967582 CCTGCTCCGGTGGAGGTGGCAGG - Intronic
909673636 1:78214815-78214837 CCTGTTCCAGTGAAGGTGGCAGG - Intergenic
911360696 1:96873018-96873040 CCTACCCTGATGAAGGTGGCAGG + Intergenic
915132878 1:153708122-153708144 TCTGCCCCAGATAAGGAGGCAGG - Intergenic
915346610 1:155200746-155200768 CGTGCCCAGGACAAGGAGGCTGG - Intronic
915821635 1:159030670-159030692 CCTGCTCCTGTGGAGGTGGCAGG + Intronic
916213500 1:162376825-162376847 CCTGCTCTGGAGAGGCTGGCTGG + Exonic
917691538 1:177474966-177474988 CCTCCCCTGGAGCAAGTGGCTGG + Intergenic
919281552 1:195495936-195495958 CCTGCTCTGGTGGAGGTGGCAGG + Intergenic
920181036 1:204131809-204131831 CCTGGCCTGGGGAAGGAGGCGGG - Exonic
920966450 1:210705222-210705244 CCTCCTCTGGAGAAGCTGGCAGG - Intronic
922422838 1:225471167-225471189 AGTGCCCCGGAGTAGCTGGCAGG - Intergenic
922549145 1:226481401-226481423 CTTGCCCTGGGGAAGGTTGCAGG + Intergenic
922725083 1:227918877-227918899 CCTGGTGCAGAGAAGGTGGCTGG + Exonic
922927322 1:229360819-229360841 CCTGTTCCGGTGGAGGTGGCGGG + Intergenic
923034124 1:230272289-230272311 CCTTCCCCAGAGAAGGTGGCCGG + Intronic
923174102 1:231446449-231446471 CCTGCTCCAGTGGAGGTGGCAGG - Intergenic
923691866 1:236202132-236202154 CCTGCTCCTGTGGAGGTGGCAGG + Intronic
1063504158 10:6580603-6580625 CCTGACTCTGAGAATGTGGCCGG - Intergenic
1065384966 10:25125434-25125456 CCTGCCCTGGTGAAGGAGGTGGG + Intergenic
1065631938 10:27689609-27689631 CTTGCCCGTGGGAAGGTGGCTGG + Intronic
1068834967 10:61543305-61543327 CCTGCCTCGGAGCAGGTGAGAGG + Intergenic
1071015817 10:80996509-80996531 CCTGCTCTGGAGAAAGTAGCAGG + Intergenic
1072408939 10:95183399-95183421 CCTGCCCAGGAGCAGCTGCCAGG - Intergenic
1073051655 10:100671120-100671142 CCGGCCCCGGCGGAGGCGGCGGG - Intergenic
1075071026 10:119319975-119319997 CCTGCTCCCGGGAAGGAGGCGGG - Intronic
1075946852 10:126440645-126440667 CCTGCTTCAGTGAAGGTGGCAGG - Intronic
1076180661 10:128404937-128404959 CCTGCTCTGGAGAAGTTGACGGG + Intergenic
1076375925 10:129984638-129984660 CCTGCTCCAGTGGAGGTGGCAGG - Intergenic
1076666252 10:132094632-132094654 CCTGTTCCGGTGGAGGTGGCAGG + Intergenic
1076677253 10:132153528-132153550 CCTCTCCTGGAGAAGGTGTCAGG + Intronic
1077834221 11:5910291-5910313 CCTGCTCCGGTGGAGGTAGCAGG + Intronic
1078545700 11:12245631-12245653 GCTGACCTGGAGCAGGTGGCTGG - Intronic
1078588044 11:12610957-12610979 CCTGCTCTGGTGGAGGTGGCAGG - Intergenic
1079415820 11:20235561-20235583 CCTGCTCCCGTGCAGGTGGCAGG - Intergenic
1079464117 11:20712862-20712884 CCTGCTCTGGTGGAGGTGGCAGG + Intronic
1079952115 11:26818902-26818924 CCTGCTCTGGTGGAGGTGGCAGG + Intergenic
1080203294 11:29699260-29699282 CCTGCTCCAGTGGAGGTGGCAGG + Intergenic
1080567652 11:33526428-33526450 CCTGCTCTGGTAAAGGTGGCAGG - Intergenic
1080672492 11:34394461-34394483 CCTGTTCCGGTGGAGGTGGCGGG + Intergenic
1081646066 11:44791547-44791569 AGTGCCCAGGAGAAGGAGGCGGG - Intronic
1083541147 11:63512212-63512234 ACTGCCCCAGAGAAGAGGGCTGG + Intronic
1083926832 11:65812411-65812433 CCTGCCCTGGGGATGGTGCCTGG - Intergenic
1084414245 11:69021832-69021854 CCTGCCACGCACGAGGTGGCTGG + Intergenic
1084666380 11:70578589-70578611 CGTGTCCCCGAGAAGGTGGGGGG + Intronic
1085043460 11:73340308-73340330 CCTGCCCCCAAGAAGGGGGCGGG - Intronic
1085521802 11:77143532-77143554 CCTGCCCCGGAGAAGGTGGCTGG + Intronic
1086315633 11:85589055-85589077 CCTGCCCTGTTGGAGGTGGCAGG + Intronic
1086869306 11:92017829-92017851 CCTGCTCTGGTGAAGGTGGCAGG + Intergenic
1087217089 11:95505950-95505972 TCTTCCCCGGAGAAGGAAGCAGG + Intergenic
1089956281 11:122574367-122574389 CCTGCCCCAGAGCAGGAGGATGG - Intergenic
1089972340 11:122704251-122704273 TCTTCCTCTGAGAAGGTGGCTGG + Intronic
1090668446 11:128930475-128930497 ACTGCCACTGAGAAGGAGGCCGG + Intergenic
1091444741 12:537857-537879 CCTGCCCCAGAGCAAGTGGGTGG - Intronic
1093104935 12:15075000-15075022 CCTGCTCTGGTGGAGGTGGCAGG - Intergenic
1095115338 12:38345167-38345189 CCTGTTCCGGTGGAGGTGGCAGG - Intergenic
1095976417 12:47943400-47943422 CCTGCCCTGAGGAAGGAGGCGGG + Intergenic
1096182860 12:49560091-49560113 CCAACCCCAGAGAAGGAGGCTGG - Intronic
1096613314 12:52817185-52817207 CCTGCCCCAGAGGACATGGCAGG + Intergenic
1096867895 12:54576092-54576114 CCAGCCCAGGTGAGGGTGGCTGG + Exonic
1101888112 12:108686986-108687008 TCTGCCACGGTGAAGGTTGCTGG - Intronic
1104015622 12:124959931-124959953 CCTGCCCTGGAGCAGGGGGAGGG + Intronic
1104891777 12:132143750-132143772 CCGGCCCTGGAGGAGGCGGCCGG - Exonic
1104980588 12:132571615-132571637 CCAGCCCAGGAGGAGGTGGGGGG + Intronic
1105378479 13:19864669-19864691 CCGGACCAGGAGACGGTGGCAGG - Intergenic
1106978090 13:35246670-35246692 CCTGCTCCAATGAAGGTGGCAGG + Intronic
1108171622 13:47747958-47747980 CCTGACAAGGAGAAGCTGGCAGG - Intergenic
1109508362 13:63336649-63336671 CCTGTTCTGGTGAAGGTGGCAGG + Intergenic
1111951459 13:94712178-94712200 CCCGCCCCGGAGGAGGGGGCTGG + Exonic
1113240304 13:108329228-108329250 CCTGCTCTGGTGGAGGTGGCAGG - Intergenic
1113831369 13:113297869-113297891 GCTGCGCCGCCGAAGGTGGCAGG + Intronic
1113910305 13:113838473-113838495 CCAGCCCCGGAGCAGGAGGAGGG + Intronic
1113910337 13:113838554-113838576 CCAGCCCCGGAGCAGGAGGAAGG + Intronic
1114485068 14:23057371-23057393 CCTGCCCCGGAGCAGGGGTCGGG - Intronic
1117318742 14:54600221-54600243 CATGCTCAGGAGAAGGTGCCTGG - Intronic
1117682843 14:58223246-58223268 GCTGCTCCGGAGGAGGAGGCAGG - Intronic
1117768528 14:59108101-59108123 CCTGCTCCGGTGGAGATGGCAGG - Intergenic
1119037284 14:71241196-71241218 CCTGACCCTGAGGAGGTGGTTGG - Intergenic
1119728605 14:76937270-76937292 CCGGCCCTGGGAAAGGTGGCAGG - Intergenic
1120489652 14:85161263-85161285 CCTGTTCCGGTGGAGGTGGCAGG - Intergenic
1121347897 14:93149665-93149687 CCTGCCGGGGTGAGGGTGGCGGG - Intergenic
1121691012 14:95877026-95877048 GCTGCCCGGGAGAATGAGGCAGG + Intergenic
1121744693 14:96278949-96278971 CCTGCCCTGGTGAATGAGGCAGG + Intergenic
1122053425 14:99075613-99075635 CCTTCCCCAGGGAAGGTGCCTGG + Intergenic
1122373366 14:101241940-101241962 GCAGCCTCCGAGAAGGTGGCAGG - Intergenic
1122393619 14:101407469-101407491 CCTTGCCTGGAGAAGGCGGCTGG - Intergenic
1122779642 14:104138347-104138369 CCTGCCCCGGGGAGGGGCGCTGG - Intergenic
1122889468 14:104725699-104725721 GCGGCCCAGGACAAGGTGGCGGG - Intronic
1122906691 14:104804938-104804960 CTTGCCCTGGGGAAGGAGGCTGG + Intergenic
1122945360 14:105006161-105006183 CCTGCCCCTCAGTGGGTGGCTGG + Intronic
1124420083 15:29513491-29513513 CCCTCCACGGAGAAGGTGGAGGG - Intronic
1127036435 15:54923536-54923558 CCTGCTCCAGTGGAGGTGGCAGG + Intergenic
1127483631 15:59399818-59399840 CCTGCCCTGGAGGGAGTGGCTGG - Intronic
1128374443 15:67065470-67065492 CCCTCCCCGGAGCAGGGGGCGGG + Intronic
1129226541 15:74173825-74173847 CCTGCCCCAGACAGGGTGCCTGG - Exonic
1129379662 15:75157034-75157056 CCGGCCCTGGGAAAGGTGGCAGG - Intergenic
1129854590 15:78814178-78814200 CCTGCTCAGGAGAATGTGGAGGG + Intronic
1130821623 15:87502146-87502168 CCTGGCCTGGAGGAGGTGGAGGG - Intergenic
1131324839 15:91432235-91432257 TCTTCCCTGGAGAAGGTGGGTGG + Intergenic
1132012475 15:98288162-98288184 CCATCCCTGGAGAAGGTAGCTGG + Intergenic
1132607641 16:800226-800248 CCTGCACCGGGGATGGGGGCGGG - Intronic
1132691174 16:1182591-1182613 CCTGGCCAGGGGAACGTGGCCGG - Intronic
1132807501 16:1781947-1781969 GCGGCCCAGGAGACGGTGGCGGG - Intronic
1133968971 16:10553485-10553507 CATGCCCAGGAGAAGGTGCCGGG - Intronic
1134007183 16:10825796-10825818 CCTGCGCCTGACAAGGTGGATGG - Intergenic
1134030054 16:10984815-10984837 CCTGCCCGAGACCAGGTGGCTGG - Intronic
1139509080 16:67416241-67416263 GCTGCCCCGGGGAGGGTGGAAGG - Exonic
1141344894 16:83235280-83235302 CCTGCCCCAGAGAATGACGCAGG + Intronic
1142940755 17:3378389-3378411 TCTGCCCTGGAGCAGGTGCCAGG + Intergenic
1142968173 17:3593781-3593803 CCTGCCCAGGAGGAGGTCACAGG - Intronic
1143183801 17:4998918-4998940 ACTGCCCTGGGGAAGGTGCCAGG - Intronic
1146799695 17:35808887-35808909 TCTGACCCTGAGAATGTGGCGGG - Intronic
1146955001 17:36932308-36932330 CCTGCCACGAAGAAGGCCGCGGG - Intergenic
1148825707 17:50392441-50392463 CCTGTCCTGGCCAAGGTGGCAGG - Exonic
1148830825 17:50429908-50429930 CCTTCCCCAAAGAAGGTGGATGG + Intronic
1149427481 17:56569253-56569275 CCTGCCCCTGTGAAGCAGGCAGG + Intergenic
1149574764 17:57703609-57703631 CCTGCCCCCTAAATGGTGGCAGG - Intergenic
1149894901 17:60421920-60421942 CCTGCCCCAGGGAAGGCCGCGGG + Intronic
1149896342 17:60431479-60431501 CCTGCCACTTAGAAGGTGGCTGG - Intergenic
1150282123 17:63934775-63934797 CCTGGGCTGGAGAAGGAGGCAGG - Intergenic
1152784597 17:82241245-82241267 CCTGTGCCGGGGGAGGTGGCGGG + Intronic
1152911078 17:83005084-83005106 CCTGCCCCAGACAAGGCGCCAGG + Intronic
1153164335 18:2244707-2244729 CCTGCTCCAGTGGAGGTGGCAGG - Intergenic
1153293194 18:3521370-3521392 CCTGCCCTGCTGAAGGGGGCTGG - Intronic
1153396331 18:4625580-4625602 CCTGCTCCAGTGGAGGTGGCAGG + Intergenic
1153425052 18:4953485-4953507 CTTGCTCCGGTGGAGGTGGCAGG - Intergenic
1153669139 18:7393633-7393655 CCAGCCCCTGGGAAGGTGTCTGG - Intergenic
1155415797 18:25598000-25598022 CCTGCTCTAGAGAAGGAGGCAGG - Intergenic
1156020967 18:32598561-32598583 CCTGCTCTGGTGGAGGTGGCAGG - Intergenic
1156344697 18:36246510-36246532 CCTGCTCTAGTGAAGGTGGCGGG + Intronic
1156502213 18:37566967-37566989 CCCGCCCCGGAGAGCGCGGCTGG + Intergenic
1157276214 18:46312759-46312781 CCTGCCCAGGGGAGGCTGGCAGG + Intergenic
1157674833 18:49561391-49561413 ACCGCCTCGGAGAAGCTGGCTGG + Intronic
1158002663 18:52636924-52636946 CCTGTTCCGGTGGAGGTGGCGGG - Intronic
1158945136 18:62441529-62441551 TTTGCCCCGGCGAAGGTGGAGGG - Intergenic
1159453994 18:68638293-68638315 CCTGCTCTGGTGGAGGTGGCAGG + Intergenic
1160165507 18:76507651-76507673 CCTGCCACGGAGAAAGCGGGTGG + Intergenic
1160673142 19:375759-375781 CTTCCCCCCGAGGAGGTGGCCGG - Exonic
1160941519 19:1622312-1622334 CCTGCCACGTAGAAGGGGGCGGG + Exonic
1161270801 19:3388206-3388228 GGTGCCCTGGAGAGGGTGGCAGG + Intronic
1161281591 19:3448664-3448686 CGAGCCCTAGAGAAGGTGGCAGG - Intronic
1161282569 19:3453871-3453893 CCTCCCTCGGAGGTGGTGGCGGG - Exonic
1162086836 19:8254508-8254530 CCTGCCCCTGAGCCGGTGGCTGG + Exonic
1162153869 19:8663819-8663841 CATCCCCCAGAGCAGGTGGCTGG - Intergenic
1162307404 19:9883550-9883572 CCAGCCCTGGAGAAGCTGGGGGG - Intronic
1162551617 19:11361338-11361360 GCCGATCCGGAGAAGGTGGCAGG - Exonic
1162940259 19:14005349-14005371 CCTCCCAGAGAGAAGGTGGCAGG + Intronic
1163106063 19:15123650-15123672 CCTGCCCCAGGTAAGGGGGCAGG + Intronic
1163665928 19:18604126-18604148 CCTGCCCAGGCCAAGCTGGCGGG - Intronic
1164158036 19:22608222-22608244 CCTGCCCCGCAGGAGGGGGCTGG - Intergenic
1164670646 19:30070319-30070341 CCTGCTCCGGAGAAGATGAAGGG - Intergenic
1164832286 19:31331909-31331931 CCTGCCCAGAAGAAAGTGCCCGG - Intronic
1165837659 19:38769711-38769733 CCTGCCCTGGAGTGGGTGGGCGG - Intronic
1166701725 19:44886065-44886087 CCTGGCAGGGAGAAGCTGGCTGG + Intronic
1167317930 19:48777063-48777085 CCTACCCCGGAGACTGAGGCAGG - Intergenic
1167493841 19:49806768-49806790 TCTGCCCCGGGGGATGTGGCCGG + Exonic
1167685507 19:50953201-50953223 CCTGGCCCGGAGAATGGGGAGGG + Intergenic
1167879486 19:52444386-52444408 CCTGCTCCAGTGTAGGTGGCAGG + Intronic
1168323636 19:55525796-55525818 CCTGTCCCCAAGATGGTGGCGGG - Intergenic
1168414745 19:56160815-56160837 CCTGCCCCCGTGAAGCTGGTTGG + Exonic
925056390 2:860628-860650 CCTGCCCCAGAGCCGGGGGCTGG - Intergenic
925441853 2:3894984-3895006 CCTGCTCTGGTGAAGGTAGCAGG + Intergenic
927328290 2:21832220-21832242 CCTGTTCCGGTGGAGGTGGCAGG + Intergenic
927606557 2:24491471-24491493 CCTGCTCCGGAGGAGGGGGCCGG + Intergenic
928135122 2:28682270-28682292 CCTGCCCCAGAGTAGGTGGGGGG - Intergenic
928443178 2:31310946-31310968 CCTGCTCCAGTGGAGGTGGCAGG + Intergenic
929537523 2:42792817-42792839 GGCGCCCCGGAGACGGTGGCGGG - Intergenic
929791405 2:45025596-45025618 GCAGGCCCGGAGAAGGTGGGGGG + Intergenic
930159968 2:48144790-48144812 CCTGCTCTGGTGGAGGTGGCAGG + Intergenic
930634207 2:53787007-53787029 TCTGCCCCGGAAACGGTGACAGG + Intronic
931136936 2:59413952-59413974 CCTGCTCCAGTGGAGGTGGCAGG + Intergenic
931602731 2:64019686-64019708 CCAGTCCCGGGGAAGGCGGCAGG - Intergenic
932098568 2:68874814-68874836 CCTGGTCCTGAGAAGGTAGCAGG - Intergenic
934111348 2:88746643-88746665 CCTGCTTCGGTGGAGGTGGCAGG + Intronic
935007179 2:99090018-99090040 CCTGCTCTGGTGGAGGTGGCAGG - Intronic
936104932 2:109615168-109615190 CCTCCCCCGGAGGAGCTGCCCGG - Exonic
936857756 2:116980629-116980651 CCTGCTCTGGTGAAGCTGGCAGG - Intergenic
937914565 2:127092576-127092598 CATGCCCCTGAGCTGGTGGCTGG - Intronic
938038030 2:128052909-128052931 CCTGTTCCGGTGTAGGTGGCAGG + Intergenic
938599494 2:132822312-132822334 CCTGCCCTGGTAGAGGTGGCAGG - Intronic
938900231 2:135793226-135793248 CCTGCTCCAGTGCAGGTGGCAGG - Intronic
940172316 2:150842749-150842771 CCTGTTCTGGAGGAGGTGGCAGG + Intergenic
940784928 2:157971373-157971395 CCTGCTCTGGTGGAGGTGGCAGG + Intronic
941357936 2:164515317-164515339 GCTGCTCCAGTGAAGGTGGCAGG - Intronic
941702161 2:168614978-168615000 CCAGCTCCAGAGGAGGTGGCAGG - Intronic
942743682 2:179207492-179207514 CCTGCTCAGGTGGAGGTGGCAGG - Intronic
944615078 2:201451686-201451708 CCAGCCCCGGGGAGGGAGGCGGG + Exonic
946403863 2:219482831-219482853 CCTCTCCCGGCGGAGGTGGCAGG + Exonic
946445620 2:219737635-219737657 CATGCCCTGCAGAAGTTGGCTGG + Intergenic
947744541 2:232500808-232500830 ACTGCCCTGGAGCAGCTGGCTGG - Intergenic
947792062 2:232873999-232874021 CCAGCCCTGGGGAATGTGGCAGG + Intronic
948295702 2:236858767-236858789 GCTGCCCTGGAGATGTTGGCTGG + Intergenic
948714028 2:239847377-239847399 CCTGCTCCGGTAGAGGTGGCAGG - Intergenic
948788084 2:240363433-240363455 CCAGCCTGGGAGAAGGTGGGGGG - Intergenic
948867638 2:240783673-240783695 CCTGCTCCAGAGTGGGTGGCAGG - Intronic
1169397856 20:5250701-5250723 CCTGTTCTGGTGAAGGTGGCAGG + Intergenic
1169535712 20:6537756-6537778 ACTGCTCCAGAGAAGGTGGTGGG + Intergenic
1169833862 20:9855729-9855751 CTTGCCCCTGGGAATGTGGCTGG + Intergenic
1169908617 20:10628695-10628717 CCTGCCCTGGACATGGGGGCTGG + Intronic
1170245709 20:14219911-14219933 CCTGTTCCGGTGGAGGTGGCGGG + Intronic
1170865377 20:20150660-20150682 CCTGCTCTGGTGGAGGTGGCAGG - Intronic
1171346785 20:24471168-24471190 CCTAGCACGGAGAAGTTGGCCGG - Intronic
1172204834 20:33155880-33155902 CCTGCCCTGAAGAGGGAGGCAGG - Intergenic
1172605061 20:36208439-36208461 CCTGGCCGGGTGAAGGTGACTGG - Intronic
1172934977 20:38613580-38613602 CCTGCCCTGGAGAAGGTCTCTGG + Intronic
1173495252 20:43513912-43513934 GGTGCCCCGGAGCAAGTGGCCGG + Exonic
1173837985 20:46138303-46138325 CCTGCCCCAGTGAAGGTGGCAGG + Intergenic
1175569699 20:60009550-60009572 CCTGCCCCGCAGAGGGAGGAGGG - Intronic
1175787017 20:61718180-61718202 CCTGCCCTGGGGAAGGCAGCAGG - Exonic
1176052413 20:63127042-63127064 CCTGCCCCTGAGAATGGAGCTGG + Intergenic
1176079537 20:63265410-63265432 CCTGCCCAGGAAAGGGGGGCAGG - Intronic
1176082952 20:63283115-63283137 CCTGCTCCCAACAAGGTGGCCGG - Intronic
1176083354 20:63284908-63284930 CCTGCGCAGGAGAAGGTAACGGG + Exonic
1176177298 20:63734835-63734857 GCTGCCCTGGAGAAGTGGGCAGG + Intronic
1176658631 21:9613104-9613126 CCTGCTCTGGTGGAGGTGGCAGG + Intergenic
1178707336 21:34886818-34886840 ACTGGCCCGGAGAGGGTGGTGGG - Intronic
1179443395 21:41411806-41411828 CCTGCCCTGGTGGAGGTAGCAGG - Intergenic
1179679176 21:43005852-43005874 GCTGCCTGGGAGGAGGTGGCTGG - Intronic
1180912824 22:19464804-19464826 CCTGCCCCACAGAAGCTGACAGG - Intronic
1181171896 22:21014602-21014624 ACTGCACTGGGGAAGGTGGCGGG + Intronic
1182145105 22:27992718-27992740 CTTTCCCCTGGGAAGGTGGCAGG - Intronic
1183099783 22:35576786-35576808 CCAGCCAAGGAGAAGGCGGCAGG - Intergenic
1183608853 22:38883931-38883953 CCTGCCCTGGAGCAGAGGGCTGG + Intergenic
1184065464 22:42116855-42116877 CCTGCCCTGGTGGAGGTGGGAGG + Intergenic
1184234338 22:43175005-43175027 TCTGCCCCAGAGGAGGTGGAGGG + Intronic
1184570314 22:45319444-45319466 CCTGCCCCACAGCAGGAGGCCGG + Intronic
1184734930 22:46392341-46392363 CCCGCCCCGGAAAACGGGGCAGG + Intronic
1185008570 22:48300072-48300094 CCTGCACCGGGGATGGTCGCCGG - Intergenic
950687643 3:14629972-14629994 CTTGCTCAGGAGAATGTGGCAGG + Intergenic
950912265 3:16606497-16606519 CCTGCCCGGGATATGGGGGCTGG + Intronic
952601570 3:35089365-35089387 CCTGCTCCAGTGCAGGTGGCAGG - Intergenic
953071939 3:39529651-39529673 CTTTCCCCGAAGGAGGTGGCAGG + Intergenic
953801907 3:46031093-46031115 CCTGCCCCTTAGAAGTTGGTGGG + Intergenic
954316690 3:49805385-49805407 GCTGCCCAGGAGCAGGTGCCTGG + Exonic
954750659 3:52811640-52811662 CCTGCCCCGCAGGTGCTGGCAGG + Intergenic
955060632 3:55489027-55489049 CCTGCCACGGAGATCTTGGCGGG + Intronic
955350614 3:58190543-58190565 CCTGCCCAGGAGCAGGTTACTGG - Intergenic
957392764 3:79599013-79599035 CCTGCTCTGGTGGAGGTGGCAGG - Intronic
959009685 3:101060944-101060966 CCTGCCCCAGGGGAGGTAGCAGG + Intergenic
959361854 3:105403355-105403377 CCTGCTCCGGTGAAGGTATCAGG - Intronic
959419224 3:106111564-106111586 CCTGTCCGGGAGGAGGTGGGGGG - Intergenic
959436184 3:106317651-106317673 CCTGTTCCAGTGAAGGTGGCAGG - Intergenic
961449959 3:126998225-126998247 ACTTCACCAGAGAAGGTGGCTGG + Intronic
961978034 3:131047660-131047682 CCTGCTCCAGTGGAGGTGGCAGG + Intronic
962191917 3:133319633-133319655 CCTGCTCTGGTGGAGGTGGCAGG - Intronic
963023537 3:140896744-140896766 CCTGCTCTGGTGAAGGTGGTGGG + Intergenic
963050999 3:141143503-141143525 CCTGCTCTGGTGGAGGTGGCAGG + Intronic
963171196 3:142252691-142252713 CTTGCCCTGGTGGAGGTGGCAGG - Intergenic
964041766 3:152269257-152269279 CCTGCCCGGGGGAAGGCGGGAGG + Intronic
965060980 3:163785968-163785990 CCTGCTCCAGTGGAGGTGGCAGG + Intergenic
968636815 4:1684965-1684987 CCTGCAGAGGAGAGGGTGGCGGG + Intergenic
968810554 4:2797821-2797843 CCTGCCCAGGAGTGGGAGGCTGG - Intronic
969253920 4:5990019-5990041 TGAGCCCTGGAGAAGGTGGCTGG + Intergenic
970856216 4:20651712-20651734 CCTGCTCTGGTGGAGGTGGCAGG - Intergenic
972048870 4:34702885-34702907 CCTGCTCTGGAGATGGTGGCAGG - Intergenic
972097274 4:35364131-35364153 CCTGCTCTGGTGGAGGTGGCAGG + Intergenic
972189022 4:36568327-36568349 CCTGTTCCGGTGGAGGTGGCAGG + Intergenic
972826841 4:42768403-42768425 CCTGCTCCGGTGGAGGTAGCAGG - Intergenic
974583387 4:63836707-63836729 CCTGCCCTGGTGGAGGTAGCAGG + Intergenic
974801770 4:66827851-66827873 CCTGCTCTGGTGGAGGTGGCAGG + Intergenic
975238739 4:72031962-72031984 TCTGCACCGGACAAGGAGGCGGG + Exonic
975928648 4:79491568-79491590 CCTGCCCCAGTGGAGGTAGCAGG + Intergenic
975944961 4:79695380-79695402 CCTGCTCTGGTGGAGGTGGCAGG + Intergenic
976963059 4:91003133-91003155 CCTGCTCTGGTGGAGGTGGCAGG + Intronic
977777592 4:100939272-100939294 CCTGCTCCGGTGGAGGTAGCAGG - Intergenic
977826139 4:101533860-101533882 CCTGCTCCAGTGGAGGTGGCAGG - Intronic
977929839 4:102738356-102738378 CCTGCTCCAGTGGAGGTGGCAGG - Intronic
977979867 4:103308442-103308464 CCTGCGCTGGAGATGGTGCCTGG - Intergenic
980807974 4:137837951-137837973 TCTGCCACAGAGAATGTGGCAGG - Intergenic
981077069 4:140602632-140602654 CCTGCTCTGGTGGAGGTGGCAGG + Intergenic
983754739 4:171320535-171320557 CCTGCCCTGGTGGAGGTAGCAGG - Intergenic
983894498 4:173067846-173067868 CCTGCTCTGGTGGAGGTGGCAGG + Intergenic
985416775 4:189742963-189742985 CCTGCTCTGGTGGAGGTGGCAGG - Intergenic
985585987 5:734588-734610 CCTGCTCCGGTGGAGGTGACAGG - Intronic
985592084 5:770841-770863 CCGCCCCCAGAGCAGGTGGCTGG + Intergenic
985600406 5:826000-826022 CCTGCTCCGGTGGAGGTGACAGG - Intronic
986726600 5:10602596-10602618 CCTGCCTCAGAGCAGCTGGCTGG + Intronic
988723503 5:33903053-33903075 CCTGTTCCGGTGGAGGTGGCAGG + Intergenic
988875830 5:35444642-35444664 CCTGCTCTGGTGGAGGTGGCAGG - Intergenic
989818364 5:45764393-45764415 CCAGCCTTGAAGAAGGTGGCTGG + Intergenic
990243555 5:53839171-53839193 CCTGCTCTGGTGGAGGTGGCAGG - Intergenic
990347480 5:54884221-54884243 CCTGCCCCCGAGATGTTGGGGGG - Intergenic
991543231 5:67752443-67752465 CCTGCCCTGGTGAAGGTGGCAGG - Intergenic
995374952 5:111463597-111463619 CCTGCTCCAGTGGAGGTGGCAGG - Intronic
995526939 5:113057693-113057715 CCTGCCGCTGAGCAGGTTGCAGG - Intronic
995533450 5:113113078-113113100 GCTGGCCCTCAGAAGGTGGCAGG - Intronic
996631908 5:125643031-125643053 CCTGCTCTGGAGGAGGTGGCAGG - Intergenic
997732348 5:136191021-136191043 CCTGCCCTGGAGAACCTGGCAGG - Intergenic
1001579758 5:172790533-172790555 CCTGGCCCAGAGAAGGTGCTTGG - Intergenic
1001746667 5:174098000-174098022 CCTTCCCAGCAGAAGGTGGCTGG + Intronic
1005940283 6:30555580-30555602 CCAGCCCCTGAGAAGGCTGCTGG + Exonic
1007221420 6:40281973-40281995 CCTCCCCAGGAAAAGGTGTCTGG - Intergenic
1007251738 6:40500015-40500037 CCTGCCACGGAGAGGATGGGAGG - Intronic
1007943099 6:45800458-45800480 GCTGTCCCTGGGAAGGTGGCAGG - Intergenic
1008250843 6:49238044-49238066 CCTGCTCCAGTGGAGGTGGCAGG + Intergenic
1008250859 6:49238126-49238148 CCTGCTCCAGTGGAGGTGGCAGG + Intergenic
1008276728 6:49551105-49551127 CCTGCACGGGAAGAGGTGGCCGG + Exonic
1008528562 6:52433562-52433584 CCTGCTCCAGTGGAGGTGGCAGG + Intronic
1011366072 6:86584260-86584282 CCTGCTCCAGTGGAGGTGGCAGG + Intergenic
1011564300 6:88658352-88658374 CCTGCCCCGGTGAAGGTGACAGG - Intronic
1011817776 6:91213206-91213228 CCTGCTCTGCTGAAGGTGGCAGG + Intergenic
1012299179 6:97563397-97563419 CCTGCCCCGTTGGAGGTAGCAGG + Intergenic
1012450635 6:99349765-99349787 CCGGCCCCGGCGGAGGCGGCCGG - Intronic
1013221267 6:108080035-108080057 CCTGCTCTGGAGGAGGTGGCAGG + Intronic
1013589172 6:111605842-111605864 CTGGGCCCGGAGAAGGTGGAGGG - Exonic
1014278539 6:119416146-119416168 CCTGCTCCAGTGATGGTGGCAGG + Intergenic
1014420238 6:121235094-121235116 CCTGCTCTGGTGGAGGTGGCAGG + Intronic
1014481983 6:121950653-121950675 CCTGCCCTGGTGGAGGTAGCAGG + Intergenic
1014658136 6:124132711-124132733 CCTGCCCTGGTGGAGGTGGCTGG - Intronic
1016271892 6:142300170-142300192 CCTGCCTCAGAAAAGGTAGCTGG + Intergenic
1016289964 6:142518321-142518343 CCTGCTCTGGGGAAAGTGGCAGG + Intergenic
1017542106 6:155413450-155413472 CATGGCCCGCAGCAGGTGGCAGG + Intronic
1018353479 6:162987742-162987764 CCTGCTCTGGTGGAGGTGGCAGG + Intronic
1018393082 6:163355618-163355640 CCTCCCCCTGAGAGGCTGGCGGG - Intergenic
1018781724 6:167073896-167073918 CCTGCTCTGGTGGAGGTGGCAGG + Intergenic
1018901064 6:168051947-168051969 GCTGCCCAGCAGAAGGTGGTGGG - Intergenic
1020332303 7:7032190-7032212 CCTGCTCTGGTGGAGGTGGCAGG + Intergenic
1022223003 7:28332594-28332616 CTGGCCCAGGAGAAGGTTGCTGG - Intronic
1022894814 7:34739791-34739813 CCTGCTCTGGTGCAGGTGGCAGG + Intronic
1024250805 7:47504401-47504423 CATGCCCTGGAGCATGTGGCTGG - Intronic
1024455818 7:49605325-49605347 CCTGCTCCAGTGGAGGTGGCAGG - Intergenic
1024840074 7:53575224-53575246 CCTGCTCCAGTGGAGGTGGCAGG - Intergenic
1026968545 7:74454592-74454614 CCAGACCGGGAGAAGGTGGAGGG - Intronic
1028401655 7:90431514-90431536 CCTGCTCCAGTGGAGGTGGCAGG - Intronic
1029435830 7:100563633-100563655 CCTGCCCGGGGGTACGTGGCAGG - Intronic
1029457562 7:100678886-100678908 CGTGGCCCGGGGAAGGGGGCTGG - Exonic
1029547270 7:101217085-101217107 CCTGGCCCGGAGAGGGTCGGAGG - Intronic
1030289347 7:107856907-107856929 CCTGCTCCAGGGAAGGTGGTTGG - Intergenic
1030390398 7:108920731-108920753 CCTGCTCTGGTGGAGGTGGCAGG + Intergenic
1031110644 7:117604505-117604527 CTTGCCCTGGAGAAGGTCACAGG + Intronic
1031138917 7:117919515-117919537 CCTGCTCCAGTGGAGGTGGCAGG - Intergenic
1031799337 7:126223146-126223168 CCTGCTCTGGTGGAGGTGGCAGG + Intergenic
1031828013 7:126589734-126589756 CCTGCTCCAGTGGAGGTGGCAGG - Intronic
1032182467 7:129692093-129692115 CCTGCCACCGGGAGGGTGGCAGG - Intronic
1033279603 7:139996352-139996374 GCTTCCCAGGGGAAGGTGGCAGG - Intronic
1033401189 7:141026798-141026820 CCTGCTCTGGTGGAGGTGGCAGG + Intergenic
1033657320 7:143382387-143382409 CCTCCTCCGGAGGAGGCGGCGGG - Exonic
1034705434 7:153139196-153139218 CCTGCTCCAGTGGAGGTGGCAGG + Intergenic
1035560705 8:601727-601749 CCTGGCCAGGAGCAGGGGGCAGG + Intergenic
1035582875 8:751061-751083 CCTTCCCGTGAGAGGGTGGCCGG - Intergenic
1035582885 8:751101-751123 CCTTCCCGTGAGAGGGTGGCCGG - Intergenic
1035582895 8:751141-751163 CCTTCCCGTGAGAGGGTGGCCGG - Intergenic
1035582905 8:751181-751203 CCTTCCCGTGAGAGGGTGGCCGG - Intergenic
1035582915 8:751221-751243 CCTTCCCGTGAGAGGGTGGCCGG - Intergenic
1035582925 8:751261-751283 CCTTCCCGTGAGAGGGTGGCCGG - Intergenic
1035591430 8:817849-817871 CCTGCTCCGGCGGAGGGGGCAGG + Intergenic
1038992130 8:32879165-32879187 GCTGCCCAGGGGAGGGTGGCAGG - Intergenic
1039000944 8:32979616-32979638 CCTGCTCTGGTGGAGGTGGCAGG + Intergenic
1039270599 8:35876041-35876063 CCTGGCCTGGAGAATGAGGCTGG + Intergenic
1039810451 8:41043688-41043710 CCTGCTCCAGCGGAGGTGGCCGG + Intergenic
1039811199 8:41049758-41049780 CCTGCTCCAGTGAAGGTAGCAGG - Intergenic
1039912300 8:41834937-41834959 GCTGCCCGGGAGAAGCTGGAGGG + Intronic
1040569218 8:48592918-48592940 CCTGCCCCGGGGATGTTGGTAGG + Intergenic
1041248459 8:55911689-55911711 CCTGCCCTGGAGACTGAGGCAGG + Intronic
1041763600 8:61393791-61393813 CCTGCTCCAGTGGAGGTGGCAGG + Intronic
1042431454 8:68710922-68710944 CCTTCCCCGGGGGAGGTAGCAGG - Intronic
1042467075 8:69140536-69140558 CCTGTTCCGGTGGAGGTGGCAGG + Intergenic
1043986267 8:86696032-86696054 CCTGCTCTGGTGGAGGTGGCAGG + Intronic
1044729838 8:95220881-95220903 CCTTCCTCAGAGAAGGGGGCAGG - Intergenic
1045387482 8:101685850-101685872 TCTGATCCTGAGAAGGTGGCTGG - Intergenic
1046631898 8:116629741-116629763 TCTGCCCCTGTGAAGGAGGCAGG - Intergenic
1046969988 8:120212136-120212158 GCTCCCCAGGAGAAGGTGGGTGG - Intronic
1048110820 8:131466248-131466270 GCTCCCCGGGAGAATGTGGCTGG + Intergenic
1048332306 8:133479194-133479216 CAGGCCCTGGACAAGGTGGCTGG + Intronic
1048371642 8:133783771-133783793 CCTGCTCCAGTGGAGGTGGCAGG + Intergenic
1048859236 8:138711663-138711685 CCAGCCCCAGAGAAGGAGGATGG + Intronic
1049194452 8:141307935-141307957 CCTCCCCCGGAGAAGGTGCGGGG + Intronic
1049312790 8:141942379-141942401 GCTGCTCTGCAGAAGGTGGCTGG + Intergenic
1049392028 8:142376673-142376695 CATGGCCTGGAGAAGGTGTCAGG + Intronic
1049422432 8:142522895-142522917 GCTGCCAGGGAGAAGCTGGCTGG - Intronic
1049471207 8:142775775-142775797 CCTGCCCCGGGGAAGGTGACGGG - Intronic
1049769211 8:144372104-144372126 CCTGCCCCCGAGGGTGTGGCGGG - Intergenic
1049869727 8:144965355-144965377 CCTGCTCCAGTGGAGGTGGCAGG + Intergenic
1051079692 9:13279661-13279683 GCTGCCGCGGAGGCGGTGGCGGG + Intergenic
1051687638 9:19675239-19675261 CCTGCTCCAGTGGAGGTGGCAGG + Intronic
1052624855 9:30962116-30962138 CCTGCTCCAGTGGAGGTGGCAGG + Intergenic
1052894647 9:33735543-33735565 CCTGCTCTGGTGGAGGTGGCAGG - Intergenic
1052941132 9:34132865-34132887 CCTGCCCCTGGGATGGGGGCTGG + Intergenic
1055773920 9:79747685-79747707 CCTGCACCATAGAGGGTGGCAGG - Intergenic
1056026707 9:82505052-82505074 CCTGCTCTGGTGGAGGTGGCAGG - Intergenic
1058342956 9:103920720-103920742 CCTGCTCTGGTGGAGGTGGCAGG - Intergenic
1058784502 9:108374130-108374152 CCTGCTCCAGTGGAGGTGGCAGG + Intergenic
1060204245 9:121673247-121673269 CCAGCCCCAGAGAAGATGGAGGG - Intronic
1060484744 9:124039994-124040016 CCTGCACCAGAGAAGTGGGCAGG - Intergenic
1061511908 9:131066854-131066876 GCTGCTCCGGGGAAGGTGGAGGG + Intronic
1062326144 9:136013441-136013463 CCTGTCCCTTAGAGGGTGGCTGG - Intronic
1062375019 9:136258202-136258224 GCTGCCCAGGAGAGCGTGGCTGG - Intergenic
1062419516 9:136473121-136473143 ACTGCCCCGGGGAATGGGGCTGG - Intronic
1062463590 9:136671807-136671829 CCTGCCGCGGAGGCGGGGGCTGG + Intronic
1203759071 EBV:2682-2704 CCGGCCCCGGAGCAGATGCCAGG + Intergenic
1203636358 Un_KI270750v1:116683-116705 CCTGCTCTGGTGGAGGTGGCAGG + Intergenic
1187360021 X:18617283-18617305 GCTGCTCTGGAGAAGGTGCCAGG + Intronic
1189182380 X:39016485-39016507 CCTGCTCAGAAGATGGTGGCAGG + Intergenic
1189663327 X:43326843-43326865 CCTGCTCTGGTGGAGGTGGCAGG + Intergenic
1189668380 X:43381435-43381457 CCTGCTCTGGTGGAGGTGGCAGG - Intergenic
1189869490 X:45367460-45367482 CCTGCCACATAAAAGGTGGCTGG - Intergenic
1191077234 X:56468406-56468428 CCTGCTCTGGTGGAGGTGGCAGG + Intergenic
1191138667 X:57093135-57093157 CCTGCTCCTGTGGAGGTGGCCGG - Intergenic
1191903521 X:66064082-66064104 CCTGCTCTGGTGGAGGTGGCAGG + Intergenic
1192921571 X:75712841-75712863 CCTGCTCTGGTGGAGGTGGCAGG + Intergenic
1192929630 X:75792166-75792188 CCTGTCCTGGTGGAGGTGGCAGG - Intergenic
1193950757 X:87795383-87795405 CCTGCTCTGGTGGAGGTGGCAGG - Intergenic
1194165404 X:90508415-90508437 CCTGCTCCAGTGGAGGTGGCAGG - Intergenic
1194299033 X:92162719-92162741 CCTGCTCTGGTGGAGGTGGCAGG + Intronic
1195231919 X:102859133-102859155 CCTGCTCCAGTGGAGGTGGCAGG + Intergenic
1197055441 X:122113480-122113502 CCTGCTCCAGTGGAGGTGGCAGG + Intergenic
1197132458 X:123020425-123020447 CCTGTTCCGGTGGAGGTGGCGGG - Intergenic
1199553616 X:149081957-149081979 CCTGCTCCGGTGGAGGTGGCAGG - Intergenic
1199586902 X:149424141-149424163 CCTGTTCTGGTGAAGGTGGCAGG - Intergenic
1200091916 X:153640016-153640038 CCAGCCCCGGGCAAGGTGGAGGG - Intergenic
1200511672 Y:4086225-4086247 CCTGCTCCAGTGGAGGTGGCAGG - Intergenic
1200616636 Y:5387553-5387575 CCTGCTCTGGTGGAGGTGGCAGG + Intronic
1202282094 Y:23200062-23200084 CCTGCCCTGGATATGGGGGCTGG + Intergenic
1202283797 Y:23218457-23218479 CCTGCCCTGGATATGGGGGCTGG - Intergenic
1202433766 Y:24814447-24814469 CCTGCCCTGGATATGGGGGCTGG + Intergenic
1202435473 Y:24832843-24832865 CCTGCCCTGGATATGGGGGCTGG - Intergenic