ID: 1085524100

View in Genome Browser
Species Human (GRCh38)
Location 11:77154426-77154448
Sequence TTCCACGAATGACACCCACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 70
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 63}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085524100 Original CRISPR TTCCACGAATGACACCCACA TGG (reversed) Intronic
900624361 1:3601334-3601356 ATGCACGCATGACATCCACAGGG + Intronic
912974324 1:114314382-114314404 TTGTGCGAAAGACACCCACAGGG - Intergenic
914968773 1:152287658-152287680 TTCCAAAGAAGACACCCACATGG + Intergenic
922346359 1:224699867-224699889 CTCCCCTAATGACCCCCACATGG - Intronic
1072993034 10:100216368-100216390 AGCCAAGAATGACATCCACATGG + Intronic
1075078488 10:119367615-119367637 TCCCAAGAATGACAGCCAAAGGG + Intronic
1075859019 10:125657738-125657760 GTCCAGGAATGGCACCTACAGGG + Intronic
1080115115 11:28613365-28613387 TGCCACGAAAGAAACCCAGAAGG - Intergenic
1080666783 11:34343369-34343391 TCCCAGGAATGCTACCCACATGG + Intronic
1082952696 11:58834454-58834476 TTCCACTGATGCCAGCCACAAGG + Exonic
1082968690 11:58995788-58995810 TTCCACTGATGCCAGCCACAAGG + Intronic
1085524100 11:77154426-77154448 TTCCACGAATGACACCCACATGG - Intronic
1085758845 11:79224482-79224504 TTCAACCCATAACACCCACATGG - Intronic
1085840477 11:80005952-80005974 TACCAGGTATGACGCCCACAGGG - Intergenic
1089041763 11:115458064-115458086 TTCCACAGCTGAGACCCACAGGG - Intronic
1101245498 12:102880400-102880422 TTCAATGAATGGCACCCACCTGG + Intronic
1104787496 12:131459118-131459140 TCCCAGGACTGACACCGACACGG + Intergenic
1108452358 13:50579841-50579863 TTCCACACATGACACCAACAGGG - Intronic
1108513782 13:51178339-51178361 TCCCACAAATGACACTCACTTGG + Intergenic
1109648283 13:65290697-65290719 TTCCATGATTGACACCTACATGG - Intergenic
1113961201 13:114127259-114127281 TTCCAGGAATGACGCCCCCAGGG + Intronic
1121851986 14:97229576-97229598 ATCCACCAATGACACCCCTATGG - Intergenic
1124376990 15:29134669-29134691 TTCCGACAATCACACCCACAAGG - Intronic
1126603409 15:50451676-50451698 GTCCATGAAAGACACCAACATGG - Intronic
1136064472 16:27749532-27749554 TTCCACACATGCCACTCACAGGG + Intronic
1136388508 16:29946021-29946043 TTCAAAGAATACCACCCACAAGG - Intronic
1138522525 16:57578942-57578964 CTCCACAAATGAGACACACAGGG - Intronic
1158042246 18:53109179-53109201 TTTCACAAAAGACACCCAAACGG - Intronic
925306380 2:2850280-2850302 TTCCAGGAAGGGCAGCCACACGG - Intergenic
925858616 2:8153662-8153684 TTACAACAATGACACCAACACGG - Intergenic
927131127 2:20061714-20061736 TTCCACTATAGAAACCCACATGG - Intergenic
928397630 2:30955251-30955273 TTCTACAAAAGACACCCATAAGG + Intronic
930931299 2:56886459-56886481 TTCCATGAGTGCCACCCACATGG - Intergenic
941340043 2:164295871-164295893 TTGCACGTATAACACCCAGATGG + Intergenic
942473640 2:176290662-176290684 TTCCTAGAATGATACCTACATGG + Intronic
946603507 2:221376769-221376791 TTCCACCAATGACAGCCATTTGG - Intergenic
1169490997 20:6071345-6071367 TACCACGCATGAAACCCACGTGG - Intergenic
1169555120 20:6741289-6741311 TGCCAAGAATGACAGCCCCATGG + Intergenic
1170295686 20:14822362-14822384 TTATACAAATGATACCCACAAGG - Intronic
1172225409 20:33302211-33302233 TTCCACCAATGACAGACACATGG + Intronic
1181429657 22:22871305-22871327 CTCCACTCATGACACCCACCTGG + Intronic
949271513 3:2223254-2223276 TACCACCACGGACACCCACAGGG - Intronic
976049696 4:80997321-80997343 GTACACTAATGACACTCACATGG + Intergenic
981557925 4:146015571-146015593 CTCCAGGAATGACTCCCAGAAGG - Intergenic
982932584 4:161428224-161428246 TTCCACAAATCTCACCCCCACGG + Intronic
987156034 5:15090443-15090465 TTCAAAGAGTCACACCCACAAGG + Intergenic
998280024 5:140796955-140796977 TTCCACCAACGACACTAACACGG - Exonic
1003157696 6:3610077-3610099 TTCTGGGCATGACACCCACAGGG + Intergenic
1006363963 6:33603911-33603933 TTCAACGAAGAGCACCCACAGGG - Intergenic
1008030410 6:46688172-46688194 GTCCACGAAGGACACCCGCAGGG - Exonic
1011693342 6:89889350-89889372 TTCCACTAATGAGCCACACACGG + Intergenic
1012265198 6:97133139-97133161 TCCCACAAATGCCACCTACAAGG + Intronic
1013581481 6:111539112-111539134 TTCCACCCATCACAACCACAAGG + Intergenic
1019583598 7:1782716-1782738 TTCCAGGAAAGACAGCCAAAGGG - Intergenic
1022544314 7:31171478-31171500 TTTCAGGAATGACACCTGCAAGG + Intergenic
1024225774 7:47325779-47325801 TTCCATGCATCACACCCACCAGG + Intronic
1027243204 7:76346924-76346946 TTCCCTGAATGCCACCAACAAGG + Intronic
1031583084 7:123501129-123501151 TTCCATGAATGCCACCTTCAAGG - Intronic
1032307956 7:130754623-130754645 TTCCCCCAATGCCACTCACAAGG + Intergenic
1035014504 7:155753403-155753425 TCCCCTGAATGACACTCACAAGG - Intronic
1041022449 8:53651957-53651979 ACCCACGAATGACACCCATTCGG + Intergenic
1046877747 8:119275260-119275282 TGCCTCTAATGACACCCCCAAGG - Intergenic
1049445570 8:142629162-142629184 TACCACCCATGACACCCACCTGG + Intergenic
1056793703 9:89641999-89642021 TTCCTTTAATGACACCCAAAAGG + Intergenic
1189926978 X:45965562-45965584 TTCCAGGAATGACTCACTCATGG + Intergenic
1190596552 X:52057754-52057776 TTCCACGAATAAATCCCACGTGG + Intergenic
1190612272 X:52196319-52196341 TTCCACGAATAAATCCCACGTGG - Intergenic
1194671954 X:96744787-96744809 TACAAGGAAAGACACCCACAAGG - Intronic
1198278171 X:135117080-135117102 TTCCAGAAGTGACACTCACAAGG - Intergenic
1198292791 X:135255436-135255458 TTCCAGAAGTGACACTCACAAGG + Intronic