ID: 1085525456

View in Genome Browser
Species Human (GRCh38)
Location 11:77161106-77161128
Sequence CTGTGAACAGGTACCGCGTG GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 44
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 40}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085525448_1085525456 16 Left 1085525448 11:77161067-77161089 CCATCGGCCTCCTGGACATCTTT 0: 1
1: 1
2: 1
3: 26
4: 181
Right 1085525456 11:77161106-77161128 CTGTGAACAGGTACCGCGTGGGG 0: 1
1: 0
2: 0
3: 3
4: 40
1085525452_1085525456 6 Left 1085525452 11:77161077-77161099 CCTGGACATCTTTGGGTTTGAGA 0: 1
1: 0
2: 2
3: 14
4: 167
Right 1085525456 11:77161106-77161128 CTGTGAACAGGTACCGCGTGGGG 0: 1
1: 0
2: 0
3: 3
4: 40
1085525451_1085525456 9 Left 1085525451 11:77161074-77161096 CCTCCTGGACATCTTTGGGTTTG 0: 1
1: 0
2: 1
3: 10
4: 153
Right 1085525456 11:77161106-77161128 CTGTGAACAGGTACCGCGTGGGG 0: 1
1: 0
2: 0
3: 3
4: 40

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085525456 Original CRISPR CTGTGAACAGGTACCGCGTG GGG Exonic
905481744 1:38266450-38266472 CTGTGTACAGGTACTGCGGCAGG - Intergenic
920201415 1:204261971-204261993 CTGCGAGCAGGTACTGCGGGCGG + Intronic
923839214 1:237649909-237649931 CTGTGCAAAGGTACCGATTGAGG - Exonic
924323369 1:242871156-242871178 CTGTGAACAGGGACAGAGTGAGG - Intergenic
1064980464 10:21161622-21161644 CTGTGAACAGGAACAGGGGGTGG - Intronic
1065433150 10:25680376-25680398 CTGTGGAAAGGTACCTCCTGGGG - Intergenic
1085046916 11:73359006-73359028 CTGTGACCAAGAACCCCGTGGGG - Intronic
1085525456 11:77161106-77161128 CTGTGAACAGGTACCGCGTGGGG + Exonic
1102806354 12:115784141-115784163 CTGCGAACAGGAACCCCCTGAGG + Intergenic
1105738328 13:23295679-23295701 CTGTGAACAGGCACCAAGTGTGG - Intronic
1105857529 13:24386192-24386214 CTGTGAAAAGGGGCCGGGTGGGG - Intergenic
1117898335 14:60509724-60509746 CTGTGGACAAGTACCGAGTAAGG + Exonic
1123066738 14:105622775-105622797 TTGGGGACAGGTACAGCGTGGGG + Intergenic
1126474881 15:49054960-49054982 CTGTGGACAGGTACAGTCTGTGG + Intergenic
1135889437 16:26343983-26344005 CTGTGAACACTTACTGCTTGTGG - Intergenic
1150659828 17:67065613-67065635 CTGAGAACAGGTACCCAATGTGG - Intergenic
1153794067 18:8606632-8606654 CTGTGGACTGATACCGTGTGCGG + Intergenic
1154194341 18:12254662-12254684 CTGGGCACAGGTACCAGGTGTGG + Intronic
1161474634 19:4477463-4477485 CTGGGGACAGGCACAGCGTGAGG - Intronic
1163392001 19:17036743-17036765 GTGTGAACAGCTCCCGCGTGAGG - Intergenic
1163979251 19:20883205-20883227 CAGTGAACAGGTACCCACTGTGG - Intergenic
937065148 2:119011936-119011958 CTGTGAACTGGTACACTGTGGGG + Intergenic
937789460 2:125943273-125943295 GTGGGAACGGGTACTGCGTGCGG - Intergenic
938694687 2:133824597-133824619 CTCAGAGCAGGTACCTCGTGTGG - Intergenic
942623652 2:177875846-177875868 CTGAGAACAGGTAGGGCTTGTGG - Exonic
1170277843 20:14612504-14612526 CTGAGAACAGGGACAGGGTGGGG + Intronic
1178984421 21:37290727-37290749 CTATGAATATGTACCACGTGTGG + Intergenic
951954617 3:28241110-28241132 CTGTGAACAACTAGTGCGTGTGG + Intergenic
953204618 3:40813607-40813629 CAGTCAACATGTACCGCGTTTGG - Intergenic
967823294 3:193858356-193858378 CTGTGCACAGGTCCCTCGAGGGG + Intergenic
975627416 4:76363619-76363641 CTGTGTACAGGTAACGTGTCTGG + Intronic
979028016 4:115602118-115602140 CTGTGAACTGGTACTGTTTGGGG + Intergenic
995547899 5:113251090-113251112 CTGTGAACAGTTACGATGTGTGG - Intronic
1000924933 5:167181919-167181941 CTGTGTCCAGGTACTGTGTGTGG + Intergenic
1006614846 6:35319324-35319346 CGGTGAACAGATGCCACGTGGGG - Intronic
1021784374 7:24137480-24137502 CTGGGAACAGGCACCTCATGGGG + Intergenic
1030184931 7:106752239-106752261 CTCTGAACAGGTCCAGAGTGGGG - Intergenic
1033564192 7:142562663-142562685 CTGTAACCAGGTACCAAGTGTGG - Intergenic
1039897736 8:41728074-41728096 CTGTGGACAGGTGCTGCTTGAGG + Intronic
1040820706 8:51553360-51553382 CTGTGAAAAGGCACTGCCTGGGG + Intronic
1051188519 9:14486143-14486165 ATGTGAACAGGGACAGAGTGGGG + Intergenic
1061325042 9:129858589-129858611 CTCTGAACAGGTAACCTGTGTGG + Exonic
1062459451 9:136656802-136656824 CTGTGAGCAGGTGCTGCGTTCGG - Intergenic
1199232970 X:145460780-145460802 CTGAGAACATGTGCCCCGTGTGG - Intergenic