ID: 1085526597

View in Genome Browser
Species Human (GRCh38)
Location 11:77167614-77167636
Sequence AGCACCATGCTGTTGCTAAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 128
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 117}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085526597 Original CRISPR AGCACCATGCTGTTGCTAAG GGG (reversed) Intronic
903573189 1:24321586-24321608 AGGATCCTGCTGTTGGTAAGTGG - Intronic
908235528 1:62144061-62144083 AGCAGAAAGCTGGTGCTAAGAGG + Intronic
911246477 1:95523949-95523971 AGGAACATGCTGTTGGTAACTGG + Intergenic
914352652 1:146853754-146853776 ATCACCAGTCTGTTGCTCAGTGG - Intergenic
917801758 1:178577687-178577709 CCAACCATGCTGTTGTTAAGTGG - Intergenic
1065086614 10:22185004-22185026 AGATCCATGCTGTTGCCCAGAGG + Intergenic
1065122538 10:22543471-22543493 AGCCCCATGCTGTTTCCACGAGG - Intronic
1067261887 10:44700031-44700053 AGGAACATGCTGCTGCTGAGGGG + Intergenic
1068136816 10:52957038-52957060 AGCAGAAAGCTGATGCTAAGAGG - Intergenic
1070358502 10:75663811-75663833 AACACCATGCTGTTGGGAATAGG - Intronic
1071608560 10:87015603-87015625 ATCACCGTACTGTGGCTAAGAGG + Intergenic
1073219498 10:101858318-101858340 AGCTCCATCCTGCTGCTAACTGG - Intronic
1074184564 10:111089328-111089350 GGCACCGTGCTGCTGCTGAGAGG + Intergenic
1078692607 11:13597174-13597196 AGCAGCATGCTGCTTCTAAGTGG - Intergenic
1080947550 11:36991434-36991456 AGCAGTATGTTCTTGCTAAGAGG - Intergenic
1083333022 11:61907815-61907837 AGCTTCATGCTGTGGCTAAACGG - Intronic
1085526597 11:77167614-77167636 AGCACCATGCTGTTGCTAAGGGG - Intronic
1087070906 11:94079563-94079585 AGAACCATGAGGTTGCTTAGTGG + Intronic
1089992437 11:122874160-122874182 GGTACCATCCTGTTGCTAATGGG - Intergenic
1092788543 12:12051738-12051760 AGCACCATGCTTGTGCCAAGTGG + Intronic
1094296391 12:28911627-28911649 TGTATCATGCTGTTGCTGAGTGG + Intergenic
1095166531 12:38980049-38980071 TGCACCTTTCTGTTGCCAAGTGG - Intergenic
1095192052 12:39269613-39269635 AGCTCCATCTTGTTGCTATGTGG - Intergenic
1098392526 12:69984692-69984714 AGCACCATGATGTCTCTGAGAGG - Intergenic
1107228259 13:38076754-38076776 TGCACCATGCTGCTGCTACTGGG - Intergenic
1114821070 14:26019746-26019768 AGCACCACGCCGTTGCTTAAAGG + Intergenic
1118709724 14:68509341-68509363 AGGACCATGCTGTGACTCAGAGG + Intronic
1119202513 14:72767049-72767071 AACACCTTGTTGTTGCTGAGTGG - Intronic
1128769790 15:70273275-70273297 ATCACCATGCTTTTGTTCAGAGG - Intergenic
1128894339 15:71358559-71358581 AAGGCCATGCTGTTGATAAGTGG - Intronic
1133658543 16:7891301-7891323 AGCACCATGCTTTTACTTTGGGG + Intergenic
1139981377 16:70861764-70861786 ATCACCAGTCTGTTGCTCAGTGG + Intronic
1149645139 17:58235410-58235432 CTCAGCATGCTGTGGCTAAGTGG + Intronic
1151808397 17:76421089-76421111 AGCACCACCCATTTGCTAAGTGG + Intronic
1151917386 17:77128282-77128304 GGCGCCGTGCTGGTGCTAAGAGG - Intronic
1151994418 17:77599617-77599639 AGCACCAGCCTGTGTCTAAGAGG - Intergenic
1152651382 17:81495083-81495105 ACATCCATGCTGTTGCTGAGGGG - Intergenic
1154061886 18:11070035-11070057 AGCATATTGCTGATGCTAAGAGG - Intronic
1154354881 18:13616994-13617016 TGCACCATGCTGTTGCCCTGAGG - Intronic
1156295328 18:35784185-35784207 AGCACCATGGTGTTGGGCAGAGG - Intergenic
1156749018 18:40427786-40427808 AGCACCATGGTCTTGCTAGAGGG + Intergenic
1161586323 19:5107724-5107746 AGCAGGAGGCTGCTGCTAAGGGG + Intronic
1165102787 19:33448750-33448772 AGCACCACGCTGCTGCTCTGTGG + Intronic
1165193929 19:34086491-34086513 AAGATCATGCTGTTGATAAGTGG - Intergenic
1167160769 19:47765937-47765959 AGGACCATGGTGGTGCTATGAGG - Intergenic
925458311 2:4038074-4038096 AGCACCATGCTGGTACCAAGAGG - Intergenic
926699410 2:15793280-15793302 ACCACCATGCTGGTGCCAGGAGG + Intergenic
930845034 2:55894839-55894861 AGCACCATGCTTATGGTAATAGG + Intronic
939423773 2:142008026-142008048 AGCACCATGGTTTGGCTAACTGG - Intronic
939443328 2:142276864-142276886 TGCACCATGCTGCTGCTGGGGGG + Intergenic
944062211 2:195582113-195582135 AGAACCATCCTGTTACAAAGTGG + Intronic
946028096 2:216684321-216684343 AGCACCGGGGTGTGGCTAAGAGG - Intronic
1169808828 20:9588111-9588133 AGCACCATGCTCTTACTATAAGG + Intronic
1171490138 20:25510930-25510952 AGCCCCTTGCTGCTGCTAGGCGG - Intronic
1174700362 20:52602289-52602311 GGCACCATTCAGTTGCAAAGTGG + Intergenic
1181893379 22:26084540-26084562 AGTAGCATGCTTATGCTAAGTGG + Intergenic
1185138924 22:49089479-49089501 ACCACCATGCTGCTGTGAAGGGG + Intergenic
949167221 3:957449-957471 AGCAACCTTCTGTTGCTAACTGG + Intergenic
949202664 3:1397860-1397882 AACCCCATGCTGTTACTTAGAGG + Intronic
949624963 3:5855031-5855053 AGCCACATGCTGTTTATAAGAGG - Intergenic
950459990 3:13115454-13115476 AGCACCAGGACTTTGCTAAGAGG - Intergenic
953106072 3:39880520-39880542 AAAACAATGCTGATGCTAAGAGG + Intronic
954038548 3:47867039-47867061 ATCACCATGCTGGTGTTTAGGGG + Intronic
954855219 3:53638434-53638456 GGCACCATGCTGTTCCTGGGTGG + Intronic
958757003 3:98260994-98261016 AGCACCATGCTGCTGCTGGTGGG + Intergenic
960052229 3:113249865-113249887 AGCAGCCTGCTGTGGCTAGGAGG - Exonic
963751544 3:149184876-149184898 AGCAACAAACAGTTGCTAAGGGG + Intronic
963811794 3:149784703-149784725 AGAACCATGATGTTGGTCAGGGG + Intronic
964594233 3:158404903-158404925 AGCACCAAATTTTTGCTAAGTGG - Intronic
965309348 3:167109933-167109955 CACACCATGCTCTTACTAAGAGG + Intergenic
968894929 4:3393948-3393970 AGCACCATGCTGGGTCTATGGGG + Intronic
969091112 4:4694589-4694611 AGAACCATGCTGCTGCAAAACGG - Intergenic
977606607 4:98990982-98991004 AGCATCTTGCTATTGCTAAATGG + Intergenic
980645419 4:135636574-135636596 GGCTCCATGCTGTTCCTAGGTGG + Intergenic
989412815 5:41140039-41140061 AGCACCTTCCAGGTGCTAAGTGG + Intergenic
989572202 5:42955104-42955126 ATCTCCATGCTATTTCTAAGAGG - Intergenic
989694925 5:44189399-44189421 AGCAGCATGCTGTTTGCAAGTGG + Intergenic
994316788 5:98341957-98341979 ATTACAATGCTGTTGCTATGTGG - Intergenic
995259032 5:110080352-110080374 ACCACCATTCTGTTTCTATGAGG - Intergenic
995499458 5:112788442-112788464 AGGATCATGGTGTTGCTAAGTGG - Intronic
998072965 5:139212999-139213021 AGCAGCATTCTGATGCCAAGTGG + Intronic
999759151 5:154687011-154687033 AGCACCATGCTGTGACTGAGGGG - Intergenic
1001138873 5:169126384-169126406 AACACCATGATGTTGCTAAAGGG + Intronic
1001789853 5:174446720-174446742 CTCACCATGCAGTTGCTAAGAGG + Intergenic
1006373032 6:33657079-33657101 AGCCACATGCTGTTGCTTTGTGG + Intronic
1010063297 6:71650052-71650074 AGCACCATGTAGTTGCTACTGGG + Intergenic
1017494906 6:154975073-154975095 AGCACCAGGAGGTTTCTAAGTGG + Intronic
1017773271 6:157659952-157659974 AGAACCATGCTGTGGATAGGTGG + Intronic
1018251893 6:161879889-161879911 AATGGCATGCTGTTGCTAAGTGG - Intronic
1018262845 6:161987903-161987925 AGCATCATCCGGTTGCTAAGAGG + Intronic
1019179096 6:170176002-170176024 AGCACCGGGCTGTGGCTCAGAGG + Intergenic
1020902646 7:14025056-14025078 AGGACCATGCATTTTCTAAGAGG - Intergenic
1024109564 7:46131503-46131525 AGCACCATGATGATGCTCAAAGG + Intergenic
1024379752 7:48682903-48682925 AGCTCCATGCTGTTTCTGAAGGG + Intergenic
1024764311 7:52639130-52639152 AGCACCATGCAGTTCCTCACAGG + Intergenic
1026312659 7:69200923-69200945 AGGGCCATGCAGCTGCTAAGAGG + Intergenic
1029520637 7:101059537-101059559 GGCACCATGCCGTTTCTCAGCGG + Intergenic
1030639070 7:111983953-111983975 AGGACCATGCTGTAACTAATGGG - Intronic
1032888817 7:136171004-136171026 TGCCCCATGATGATGCTAAGTGG - Intergenic
1035612878 8:979961-979983 AGAACCATGGAGCTGCTAAGGGG + Intergenic
1039580069 8:38658360-38658382 TGCACTCTGCTGTTGCTAAGTGG - Intergenic
1045451680 8:102332982-102333004 TGCACCATGCTCTTGCTATTGGG - Intronic
1049804000 8:144530727-144530749 AGCACCATGCGGTTGATGCGGGG + Exonic
1051824054 9:21198930-21198952 GGCACCATGCTGTTCCTGGGTGG - Intergenic
1054336234 9:63812946-63812968 ACCACCCTGCTGTTGCTGGGGGG - Intergenic
1056420972 9:86425933-86425955 AGCACCATGCAGGAGTTAAGGGG - Intergenic
1057090493 9:92253867-92253889 AGCACAATTCAGATGCTAAGAGG + Intronic
1059638136 9:116190670-116190692 AGCACCATGCTGGTGTGGAGGGG + Intronic
1059660784 9:116397879-116397901 AGAACCTTGCTGTTGCTCTGAGG + Exonic
1062031137 9:134362522-134362544 AGCACCATGCTGTGACCACGAGG - Intronic
1186969580 X:14826246-14826268 AGCACCATACAGCTGCTAAAAGG + Intergenic
1187362727 X:18643205-18643227 AGCACCATGACTTTGGTAAGAGG - Intronic
1189097190 X:38153060-38153082 GGCACCATGTTGGCGCTAAGTGG - Intronic
1189949097 X:46210391-46210413 AGGGCAATGATGTTGCTAAGAGG - Intergenic
1190973828 X:55379749-55379771 ACCACCATGCTGCTGCTATTGGG + Intergenic
1191675103 X:63785129-63785151 AGCACCATGCAGTGGATAAGGGG - Intronic
1193683839 X:84553537-84553559 AGCACCATTCTGATGCTACAGGG + Intergenic
1193978503 X:88153056-88153078 AGCACCATGCTGTTTTTAGAAGG + Intergenic
1196141135 X:112264918-112264940 ACCACCATGCTGGTGCTTATGGG - Intergenic
1196461492 X:115936238-115936260 AGCACCATGCTGCTGCTGCCAGG + Intergenic
1196739590 X:119012937-119012959 AGCCCCATGCTGTGGCTCAAGGG - Intronic
1196864582 X:120059288-120059310 AGCATCAAGCTGTTGCAAATTGG - Intergenic
1196878519 X:120177043-120177065 AGCATCAAGCTGTTGCAAATTGG + Intergenic
1199162244 X:144627541-144627563 AGCACCATGCTGTGGCTGCTGGG - Intergenic
1200182542 X:154159478-154159500 TGCACCATGCTGATGCTGATCGG - Intergenic
1200188196 X:154196592-154196614 TGCACCATGCTGATGCTGATCGG - Intergenic
1200193846 X:154233732-154233754 TGCACCATGCTGATGCTGATCGG - Intergenic
1200199601 X:154271536-154271558 TGCACCATGCTGATGCTGATCGG - Exonic