ID: 1085531992

View in Genome Browser
Species Human (GRCh38)
Location 11:77197385-77197407
Sequence CCTTCTAGCCAGGAGCAGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 277
Summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 253}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085531992 Original CRISPR CCTTCTAGCCAGGAGCAGCC TGG (reversed) Intronic
902697422 1:18149692-18149714 CCTTCGGGGCAGGATCAGCCTGG + Intronic
903290735 1:22312633-22312655 TTTTCTATCCAGGAGCTGCCTGG + Intergenic
903741426 1:25560709-25560731 CTTTTGAGCCATGAGCAGCCTGG + Intronic
904009796 1:27383065-27383087 CCGTCTCCCCAGGAGCAGCCTGG - Intronic
904479296 1:30783948-30783970 CCTTCCACCCATGAGTAGCCAGG + Intergenic
905252145 1:36656380-36656402 CCTGCTTTCCAGGACCAGCCAGG - Intergenic
905312279 1:37057899-37057921 CCTTGTGGCCAGGAGTAGACTGG + Intergenic
905393963 1:37655611-37655633 CCCTCTAGCCAGGAACAGGGTGG + Intergenic
906487658 1:46244125-46244147 GCTTGAACCCAGGAGCAGCCTGG - Intergenic
907113715 1:51950230-51950252 CCTTCAAGCCAAAAACAGCCTGG - Intronic
909035385 1:70589974-70589996 CCTTCTCGCCAGGCTGAGCCAGG + Intergenic
911064053 1:93771981-93772003 CCTTCTTGCCAAGGGCTGCCAGG - Intronic
911725052 1:101234308-101234330 ACTTCTAGGCAGCAGCAGACAGG + Intergenic
912755788 1:112324077-112324099 CATTCCTGCCAGTAGCAGCCAGG + Intergenic
912939454 1:114032236-114032258 CTTTTGAGCCAGGATCAGCCAGG - Intergenic
914492791 1:148162601-148162623 CCGGGTAGCCAGGAGCAGGCCGG + Intergenic
917095635 1:171396621-171396643 TCTTCTAACAAAGAGCAGCCTGG + Intergenic
920901619 1:210114859-210114881 CGGCCTAGCAAGGAGCAGCCTGG + Intronic
923383354 1:233443244-233443266 CCTTCCAGCCAGGAGGATCCTGG + Intergenic
923956737 1:239031025-239031047 CCTTTGAGCCAGGATGAGCCAGG - Intergenic
1062907230 10:1187229-1187251 CCTACTAGGCAGGGGCCGCCTGG + Intronic
1062930666 10:1350385-1350407 CGGTCTGGCGAGGAGCAGCCTGG - Intronic
1062983553 10:1745719-1745741 CCATGAAGCCTGGAGCAGCCTGG + Intergenic
1063510225 10:6637488-6637510 CCTTCCAGCCAGCAGGAGCACGG + Intergenic
1066048240 10:31612953-31612975 CCATCTAGAAAGGAGCTGCCAGG - Intergenic
1067022092 10:42810000-42810022 CCTTGAAGCCAAGACCAGCCTGG - Intronic
1067360748 10:45575854-45575876 CTTTCGAGCCAGGATGAGCCAGG - Intronic
1067797558 10:49331864-49331886 CATACTGGCCAGGAGCTGCCAGG + Intergenic
1069769932 10:70891761-70891783 CCTTCAAGCCAAAAACAGCCTGG - Intergenic
1069874177 10:71551616-71551638 CCTTCCAGCAGGGAGCACCCAGG + Intronic
1069878540 10:71577804-71577826 CCTTGCAGCCAGGATCAGCCTGG + Intronic
1070993506 10:80754151-80754173 CCTTCCAACAAGGAGCAGCAGGG - Intergenic
1071450887 10:85790643-85790665 CCTCCTGGCAGGGAGCAGCCAGG + Intronic
1074966077 10:118491700-118491722 CCATTTAGCCAGGAACAGTCCGG + Intergenic
1075106430 10:119542802-119542824 CCTCCTAGCCAGGCGCCGCGTGG + Intergenic
1075521805 10:123147921-123147943 GCGTCTAACCAGGGGCAGCCAGG - Intergenic
1076862415 10:133144983-133145005 CCTGCAGGCCAGCAGCAGCCAGG + Intergenic
1077154179 11:1084124-1084146 CTATCTAGCCAGGAGCTGCCTGG + Intergenic
1077394585 11:2314847-2314869 CCTTCAAGCCAGTTCCAGCCTGG + Intronic
1077424355 11:2467379-2467401 CCCTCTTCCCTGGAGCAGCCAGG + Intronic
1077431248 11:2517032-2517054 CCTCCTTTCCAGGAGCAGCCTGG - Intronic
1078187699 11:9066356-9066378 ACTTCTGGCCAGCAGGAGCCAGG - Intronic
1079074902 11:17378606-17378628 CCTTCCAGCAGGAAGCAGCCAGG + Intergenic
1079424542 11:20327602-20327624 CTTTCAAGGCAGGAGCAGACTGG - Intergenic
1084047078 11:66575256-66575278 CCGCCTGGCAAGGAGCAGCCTGG - Intergenic
1084095935 11:66911397-66911419 CCTTCTTTACAGGAGCAGCCTGG + Intronic
1084146303 11:67266941-67266963 CCCCCCAGCCCGGAGCAGCCCGG + Intronic
1084381037 11:68812910-68812932 CATTCTAGACAGTAGCAGGCTGG - Intronic
1085314316 11:75535167-75535189 CCTTATCTCCAGGAGCAGCAGGG + Intergenic
1085531992 11:77197385-77197407 CCTTCTAGCCAGGAGCAGCCTGG - Intronic
1089864595 11:121620620-121620642 CCCTATACCCAGAAGCAGCCTGG + Intronic
1090116611 11:123980010-123980032 CCTTCATGCCAGGGACAGCCTGG - Intergenic
1090251310 11:125253814-125253836 CCTTCATCGCAGGAGCAGCCAGG + Intronic
1091543004 12:1479785-1479807 CCTGCTCGCCTGGAGAAGCCAGG + Intronic
1092054964 12:5501232-5501254 TATTCTAGACAGGAACAGCCTGG + Intronic
1092474927 12:8810334-8810356 CCTTTGAGCCAGGATGAGCCAGG - Intergenic
1096535580 12:52270674-52270696 CCTACCAGCTGGGAGCAGCCAGG - Intronic
1097054845 12:56243176-56243198 CCCTACAGCCAGGAGCGGCCCGG - Exonic
1097592872 12:61592686-61592708 CTTTCGAGCCAGGATGAGCCAGG - Intergenic
1098436874 12:70476959-70476981 CTTTGTAGCGAGGAGGAGCCTGG + Intergenic
1099836407 12:87912714-87912736 CTTTTGAGCCAGGAGGAGCCAGG + Intergenic
1101574285 12:105983123-105983145 CCTGGTAGCCTGAAGCAGCCAGG + Intergenic
1101645904 12:106630614-106630636 AGTTCTGGCCAGGTGCAGCCAGG + Intronic
1104862616 12:131931973-131931995 CCCCCTAGCATGGAGCAGCCCGG + Intronic
1105438130 13:20394693-20394715 CCTGCAAGCCGAGAGCAGCCCGG + Intergenic
1106512733 13:30425265-30425287 CATGCTGGCCAGGACCAGCCAGG - Intergenic
1108512908 13:51171540-51171562 CGGCCTGGCCAGGAGCAGCCTGG - Intergenic
1109716831 13:66230413-66230435 CAGCCTGGCCAGGAGCAGCCTGG + Intergenic
1110128565 13:71978804-71978826 ACTTGCAGCCAGGACCAGCCTGG + Intergenic
1110386050 13:74911995-74912017 CCTTCTAACAATTAGCAGCCAGG + Intergenic
1111679814 13:91428576-91428598 CCTTCAAGCCAAGGACAGCCTGG - Intronic
1113426948 13:110216094-110216116 CCTTCAGGCCAGCAGCATCCAGG + Intronic
1115047712 14:29016876-29016898 CCTTCAAGGAAGAAGCAGCCGGG + Intergenic
1116703667 14:48268096-48268118 CCTTCAAGCCAGGATGAGTCAGG + Intergenic
1117281631 14:54247121-54247143 CCTTCTAGCTAGAAATAGCCAGG - Intergenic
1119052810 14:71386693-71386715 TCTTCTAGTCAGGAGCTGCCAGG - Intronic
1120521602 14:85532607-85532629 CGCTCTTGCCAGAAGCAGCCAGG + Intronic
1122183646 14:99972450-99972472 CCTTCCAGCCCGGAGGAGGCTGG + Intronic
1126109706 15:45168123-45168145 TCCTCTTCCCAGGAGCAGCCAGG - Exonic
1126530241 15:49703184-49703206 CGTCCTGGCGAGGAGCAGCCTGG + Intergenic
1126831253 15:52608189-52608211 TCTTCTAGTCAGAAGCACCCAGG - Intronic
1126843663 15:52740261-52740283 CCGCCTGGCGAGGAGCAGCCTGG - Intergenic
1127250845 15:57236077-57236099 GTTACTAGGCAGGAGCAGCCAGG + Intronic
1127394214 15:58530418-58530440 CCTGCAAACCAGGAGCAGCCAGG + Intronic
1129279904 15:74476341-74476363 CCTGCTAGACAGGAGTGGCCAGG - Intergenic
1129510173 15:76115818-76115840 CCATCTACCCATGTGCAGCCAGG + Intronic
1129700276 15:77763714-77763736 CTTTCTATCCAGGAGGAGACAGG + Intronic
1132705161 16:1240358-1240380 TCTTGTAGCCTGGGGCAGCCAGG + Intergenic
1132708290 16:1255721-1255743 TCTTGTAGCCTGGGGCAGCCAGG + Intergenic
1134776128 16:16855202-16855224 CCTTCTAGACAGGATCTGGCTGG + Intergenic
1135128027 16:19827777-19827799 CCTGCGAGCCAGGAGCACCAAGG - Intronic
1135922390 16:26663003-26663025 CCTTTTAGCCTGGAGCTTCCAGG - Intergenic
1135986796 16:27189916-27189938 CCTTCAAGCCAGGGACAGGCTGG + Intergenic
1136615880 16:31398063-31398085 ACTTCTACCCTGGAGCAGCAGGG - Intronic
1138278887 16:55757623-55757645 CATTCTAGCCACGTGCAGGCTGG - Intergenic
1138289646 16:55835965-55835987 CATTCTAGCCACGTGCAGGCTGG + Intergenic
1138456984 16:57126728-57126750 CCTCCTAGAGAGGGGCAGCCAGG + Intronic
1143597227 17:7922590-7922612 ACTTCCTGCCAGGACCAGCCTGG + Exonic
1144217389 17:13068390-13068412 CCTTCAAGCCAAAAACAGCCTGG - Intergenic
1144754298 17:17669873-17669895 CCTGTCAGCCATGAGCAGCCGGG - Intergenic
1144787058 17:17837753-17837775 ACTTATTCCCAGGAGCAGCCAGG + Intergenic
1147165625 17:38591699-38591721 CCTTCCAGGCAGGAGGAGTCAGG - Intronic
1147562476 17:41517591-41517613 CATTCCAGCCAGTAGCAACCTGG + Intronic
1147911151 17:43857055-43857077 CCTTGAAGCCAGGAGTAGCCGGG - Intronic
1150006144 17:61470172-61470194 CCTTCTAGCCTGGAGATCCCTGG + Intronic
1150854061 17:68733817-68733839 TCTTCTAACAAAGAGCAGCCTGG + Intergenic
1151223458 17:72631240-72631262 CCTTCCAGCCTGATGCAGCCCGG - Intergenic
1152817868 17:82418778-82418800 GCTTCCAGCCAGGAGCCGCCCGG - Intronic
1153626777 18:7028832-7028854 CCTTCGAGCCCGTAGCTGCCCGG - Intronic
1155394851 18:25376684-25376706 CCTTCAAGCCTGGAGAACCCTGG + Intergenic
1155943342 18:31821740-31821762 TCTTCTAACAAAGAGCAGCCTGG + Intergenic
1158576790 18:58645026-58645048 CAGTCTGGCGAGGAGCAGCCTGG + Intergenic
1160078655 18:75702738-75702760 CTTTCTGTCCTGGAGCAGCCCGG - Intergenic
1160108685 18:76004673-76004695 CCTTCTCACCAGGAGGATCCTGG + Intergenic
1160374857 18:78403949-78403971 CCTTGCAGCCAGGACCAGGCTGG - Intergenic
1160717709 19:583893-583915 CCCACTCTCCAGGAGCAGCCAGG - Intergenic
1162539332 19:11284696-11284718 CCTTCCCGCCAGGCGCAGCAGGG + Intergenic
1165053125 19:33155838-33155860 GCATCTAGCCAGGAGAGGCCAGG + Intronic
1165876906 19:39014315-39014337 CCTTCTAGCCTGCAGCATCTTGG - Intronic
925179388 2:1807117-1807139 CCTGGGAGACAGGAGCAGCCTGG + Intronic
925346747 2:3176961-3176983 CCCCGTGGCCAGGAGCAGCCTGG - Intergenic
925612018 2:5709465-5709487 ACTTCTTGCCAGTAGCTGCCTGG - Intergenic
925817657 2:7769041-7769063 CCTTTTCTCCAGGCGCAGCCGGG - Intergenic
927111898 2:19869450-19869472 CCTGCCAGCCTGGAGGAGCCTGG - Intergenic
928975609 2:37083847-37083869 CCCTCTGGCCAGGTGCAGCGCGG - Intronic
929675786 2:43927176-43927198 TCCTCTAGACTGGAGCAGCCAGG - Intronic
931565864 2:63615130-63615152 CCTTTTAACAAAGAGCAGCCTGG + Intronic
931808009 2:65826772-65826794 CCTGCCAGCCAGGAGCAACAGGG - Intergenic
932064042 2:68534399-68534421 CATTCTTGCCAGGAGCAGTTTGG + Intronic
933163648 2:79053062-79053084 CCGCCTGGCAAGGAGCAGCCTGG - Intergenic
934032703 2:88062530-88062552 CCTTCTAGCAAAGAACAGCCTGG - Intergenic
934637830 2:96007132-96007154 CCCTCTGTCCAGGAGCACCCAGG - Intergenic
934795832 2:97098279-97098301 CCCTCTGTCCAGGAGCACCCAGG + Intergenic
935632959 2:105227136-105227158 CCTTCTAGACAGGGGTAGCATGG - Intergenic
935798713 2:106671112-106671134 CCTTTTAGCCAGGAGTAGCTGGG - Intergenic
936638279 2:114284111-114284133 CCTTCTCGCCAGGAGTCACCAGG - Intergenic
938421285 2:131149012-131149034 CCCTTCAGCCAGAAGCAGCCAGG - Intronic
938558719 2:132450630-132450652 CCTACTAGCAACCAGCAGCCTGG - Intronic
940182849 2:150954696-150954718 CAGTCTGGCAAGGAGCAGCCTGG - Intergenic
942387228 2:175455320-175455342 CTTTCCTGCCTGGAGCAGCCTGG + Intergenic
945723958 2:213452150-213452172 TCTTCTAACAAAGAGCAGCCTGG - Intronic
945803493 2:214462349-214462371 GCTTCTAGCCAGTCCCAGCCTGG + Intronic
946195462 2:218030175-218030197 CCGGGGAGCCAGGAGCAGCCAGG + Intergenic
946334307 2:219027342-219027364 CCTCCTAGCCAGGAGCCCCAGGG + Intronic
947713217 2:232327392-232327414 CCTCCTGGGCAGGAGCATCCAGG - Intronic
947720292 2:232365860-232365882 CCTCCTGGGCAGGAGCATCCAGG - Intergenic
948524108 2:238559876-238559898 CCTGCAAGCCTGGTGCAGCCTGG + Intergenic
948587737 2:239029878-239029900 CCTTCTAGAATGGAGCGGCCAGG - Intergenic
948657633 2:239486545-239486567 CCTTCGAGCCTGGAGCTCCCTGG - Intergenic
948660945 2:239506063-239506085 CCATCTGGCCAGGAGAAGCGGGG + Intergenic
1172239928 20:33406156-33406178 CCTTCTGGCCATCAGCAGTCTGG - Intergenic
1172244706 20:33437965-33437987 CCTTCCAGCCAGGATCAGAGAGG - Intronic
1173117925 20:40263586-40263608 CCTTGTATCTAGTAGCAGCCAGG + Intergenic
1174049726 20:47759215-47759237 CCTGTGAGCCATGAGCAGCCAGG - Intronic
1174249415 20:49207330-49207352 CCTTCTGTCCTGGAGGAGCCAGG + Intergenic
1175063391 20:56264144-56264166 CGTCCTTCCCAGGAGCAGCCTGG + Intergenic
1175313678 20:58029845-58029867 TCTTCTGGCCAGAGGCAGCCTGG - Intergenic
1175753675 20:61515974-61515996 CATTCTACCCTGGAGCAGCCAGG - Intronic
1175885223 20:62286524-62286546 CCTCCTGGCCAAGAGCGGCCTGG + Intronic
1176953388 21:15071850-15071872 CCTACTAAGCAGGAGTAGCCAGG + Intergenic
1177100537 21:16893836-16893858 CCTTCTAGCCAGGCCAAGCTAGG + Intergenic
1179285904 21:39977134-39977156 CCTTCTCTGCAGGAGCAGACTGG + Intergenic
1180193872 21:46182274-46182296 ACTGCCAGCCAGGACCAGCCTGG + Intronic
1180953227 22:19730145-19730167 CCTTCTAGGCAGGAACAGGTTGG + Intergenic
1183428076 22:37750316-37750338 CCACCTAGCCCGGAGGAGCCAGG - Intronic
1184403574 22:44287416-44287438 CCTCCCAGCCAGGAGCTCCCAGG - Intronic
1184916239 22:47570937-47570959 CCTTCTAGCCTGGAGCTGACAGG - Intergenic
1185094740 22:48800150-48800172 CCTTCTTTCCTGCAGCAGCCGGG + Intronic
949283687 3:2376437-2376459 CCTTTTGGGCAGGAGCAGTCAGG + Intronic
949670795 3:6397778-6397800 CTTTTTAGCCAGGATGAGCCAGG - Intergenic
950556834 3:13701129-13701151 CCCTGTAGGCAGGAGCACCCAGG - Intergenic
950630845 3:14280885-14280907 CCTACTAGCCAGGGGCACCAAGG - Intergenic
952897291 3:38086043-38086065 CCATGTGGCCAGCAGCAGCCTGG + Intronic
953419404 3:42742771-42742793 CCTTCTAGGCAGGAGACACCTGG - Intronic
954626284 3:52023718-52023740 CCTGCTGGCCAGGGGCACCCTGG + Intergenic
954631995 3:52052766-52052788 CCCACTAGCCAGGCCCAGCCTGG + Intronic
957156476 3:76551010-76551032 CCTTCTAGGCAGGGACAGCTAGG + Intronic
958470581 3:94512785-94512807 CCCTCTAACCAGTAACAGCCAGG - Intergenic
960574445 3:119216211-119216233 CCTGCTAGGCAGGTGAAGCCAGG + Intronic
961368948 3:126418096-126418118 CCTTCTAGCCAGGACCTGAATGG - Intronic
961498824 3:127315904-127315926 CCTTCAAGCCCCGGGCAGCCAGG + Intergenic
962316448 3:134362432-134362454 CCATGTAGCCAGAGGCAGCCTGG - Intronic
962326115 3:134433631-134433653 CCTACAAACCAGAAGCAGCCAGG - Intergenic
963052203 3:141151890-141151912 CCATCTAGCCAGGAACACCTGGG - Intergenic
963135214 3:141896964-141896986 CTGTATAGCCAAGAGCAGCCTGG + Intronic
964530608 3:157663771-157663793 CCTACTAGCCATGAGCTGTCAGG - Intronic
964732553 3:159882878-159882900 CCTACTGGCCAGGAGCAGGAGGG - Intronic
965074000 3:163953543-163953565 GCCTCTTGCCATGAGCAGCCTGG - Intergenic
966853604 3:184179170-184179192 CCTTCAGGCCAGGCCCAGCCTGG - Intronic
968871930 4:3246709-3246731 CCTCCCAGGCAGGAGCAGCTGGG + Intronic
969122819 4:4922390-4922412 TCTACTAGCCAGGAGGAGGCTGG - Intergenic
969238935 4:5887370-5887392 CCATGTATGCAGGAGCAGCCCGG - Intronic
969285865 4:6201347-6201369 CTTTCTAGCAAGGAGAAGGCAGG + Intergenic
969464205 4:7345017-7345039 CCTTCCAGCCAGCAGCAGGAGGG - Intronic
971041286 4:22754988-22755010 CAGTGCAGCCAGGAGCAGCCTGG - Intergenic
971904569 4:32710191-32710213 CCTTCTAACCAGGAACATTCAGG - Intergenic
974935719 4:68407417-68407439 CTTTTGAGCCAGGAGGAGCCAGG + Intergenic
976884661 4:89968832-89968854 CGGTCTGGCGAGGAGCAGCCTGG + Intergenic
977324576 4:95558786-95558808 CCCACTAGCCAAGAACAGCCAGG + Intergenic
980111459 4:128641117-128641139 CTTTTGAGCCAGGAGGAGCCAGG + Intergenic
980244812 4:130224817-130224839 TCTCCCAGCCAGGATCAGCCAGG - Intergenic
980903850 4:138929544-138929566 CCGCCTGGCGAGGAGCAGCCTGG - Intergenic
983062016 4:163171703-163171725 CTTTCTAACAAAGAGCAGCCTGG + Intergenic
983063788 4:163187691-163187713 TCTTCTAACAAAGAGCAGCCTGG - Intergenic
985876678 5:2604188-2604210 CCTTCTGGCCTGGATAAGCCAGG + Intergenic
987291886 5:16516602-16516624 CCTTGAAGCCAGGAGGAGACTGG + Intronic
987654380 5:20787071-20787093 CCTTCCAGCCAGGGACAACCAGG + Intergenic
988741254 5:34074738-34074760 CCTTCCAGCCAGGGACAACCAGG - Intronic
990935104 5:61139687-61139709 CCTTCAAGCCAAAAACAGCCTGG + Intronic
991772887 5:70056410-70056432 TCTTCTAACAAGGAGCAGCCTGG + Intronic
991852180 5:70931834-70931856 TCTTCTAACAAGGAGCAGCCTGG + Intronic
992750112 5:79853822-79853844 CCTTCTTGACATGAGCTGCCTGG + Intergenic
994126417 5:96172196-96172218 CCTTTGAGCCAGGATGAGCCAGG + Intergenic
995530209 5:113085006-113085028 CCTTCTATGCAGGAGCTGCAAGG - Intronic
997646810 5:135487436-135487458 ACTTCTCCCCTGGAGCAGCCTGG + Intergenic
998212882 5:140214575-140214597 CCTTTCACCCAGGAGCAGCCTGG + Intronic
999315264 5:150579466-150579488 ACTTCTTGCCATGAACAGCCTGG + Intergenic
1000248083 5:159466413-159466435 TCTTCTAGCAAGGAGAAGACAGG + Intergenic
1000295372 5:159908922-159908944 ACTTTTAGACAGGAGCAGCCTGG - Intergenic
1000606838 5:163335690-163335712 CCTTCTTGCCAGGCCGAGCCAGG + Intergenic
1001547662 5:172580422-172580444 CCTGCTCTCCAGGAGCAGCTGGG - Intergenic
1002072444 5:176688269-176688291 CCTGATAGCAAGGAGAAGCCAGG + Intergenic
1002528338 5:179827976-179827998 CCTCCCAGCCAGGAGCAGCCTGG - Intronic
1006027573 6:31157408-31157430 ACCTCTGGCCAGGAGCAGCAGGG - Exonic
1009343266 6:62586145-62586167 CCTTTGAGCCAGGATGAGCCAGG - Intergenic
1009379060 6:63006950-63006972 CTGCCTAGCAAGGAGCAGCCTGG - Intergenic
1012718827 6:102714254-102714276 CCCACTAGCCAGTTGCAGCCTGG + Intergenic
1012864176 6:104597632-104597654 GCTTCTAGCCTGGATCAGCCAGG + Intergenic
1015167621 6:130215798-130215820 TCTCCTAGCCAGGAGAAGCAAGG - Exonic
1015673983 6:135724249-135724271 CCTTGTATCCAGAAGCAACCAGG + Intergenic
1015715046 6:136183760-136183782 CCTGCCTGCCAGGAGCAGGCTGG - Intronic
1016204187 6:141452989-141453011 CCTTTGAGCCAGGATGAGCCAGG - Intergenic
1016461537 6:144284866-144284888 CCTCCCAGCCCGCAGCAGCCCGG - Intergenic
1018027875 6:159819785-159819807 CCTTCCAGTCAGGAGGTGCCCGG + Intronic
1018813916 6:167316995-167317017 CCTTCTAGTCAGTGTCAGCCAGG + Intergenic
1020315961 7:6905460-6905482 CATCCTGGCGAGGAGCAGCCTGG - Intergenic
1020430876 7:8114922-8114944 CCTTCTAGCTGAGAGCAGCTAGG + Intronic
1020794115 7:12661230-12661252 CAGCCTGGCCAGGAGCAGCCTGG - Intergenic
1021396335 7:20153116-20153138 CTCTTTAGCCAGGAGCAACCAGG - Intronic
1021526260 7:21592392-21592414 ACTTTGAGGCAGGAGCAGCCTGG + Intronic
1022838306 7:34137713-34137735 CCTTCCAGTCAGGAATAGCCAGG + Intronic
1022898619 7:34778673-34778695 CCTTCTACCCAGGAGAAAGCGGG - Intronic
1024576334 7:50767630-50767652 CCTGCTGGCCAGGAGCCGCAGGG - Intronic
1024609835 7:51054960-51054982 CTTTCTTCCCTGGAGCAGCCTGG + Intronic
1035397340 7:158543889-158543911 CCTTGTGGGCAGGGGCAGCCTGG - Intronic
1036486524 8:9184310-9184332 CCTTTGAGCCAGGATGAGCCGGG + Intergenic
1038012181 8:23483900-23483922 CCCTCCAGCCAGATGCAGCCTGG + Intergenic
1038896762 8:31792005-31792027 ACTTCAAGCCAGCAGCAGCCAGG + Intronic
1040476444 8:47782348-47782370 CCTACTGGCTGGGAGCAGCCTGG + Intronic
1040985522 8:53290232-53290254 CCCTCTAGCCCAGGGCAGCCAGG + Intergenic
1043449078 8:80348854-80348876 GCTTGAGGCCAGGAGCAGCCTGG - Intergenic
1044115150 8:88326977-88326999 CCTTGTAGCTCAGAGCAGCCTGG - Intronic
1045501108 8:102745121-102745143 CCTGCTGGCCTGGAGCAGCCAGG + Intergenic
1047639022 8:126798381-126798403 CATTTTAGCCAGGAGCATCAAGG - Intergenic
1049359601 8:142206052-142206074 CCATCTGGCAGGGAGCAGCCTGG - Intergenic
1049374939 8:142284928-142284950 CCTTCTGTGCAGGAGCACCCAGG - Intronic
1049375808 8:142288534-142288556 CCTTCTGCCCAGGAGGACCCGGG - Intronic
1049726269 8:144147958-144147980 CCTTCTGGCCACCCGCAGCCTGG - Intergenic
1050118112 9:2281278-2281300 CTTTTTAGCCAGGATGAGCCAGG - Intergenic
1052387179 9:27835820-27835842 CCTTCTAGCCAAGAGGACTCTGG + Intergenic
1052988006 9:34502078-34502100 CCTGCCAGCCAGCAGCAGCTTGG - Intronic
1055132899 9:72795459-72795481 CCTACAAGCCAGAAGCAGTCAGG + Intronic
1056203762 9:84300825-84300847 CCTCAAAGCCAGGATCAGCCTGG - Intronic
1056598998 9:88031362-88031384 GCTTCCAGCCAGGAGCATCTTGG + Intergenic
1057422901 9:94926665-94926687 CCTGCTGGCCAGGAGCACCTGGG - Intronic
1057821123 9:98331886-98331908 CCTTCTAGGCATGAGCAGGTTGG - Intronic
1059546494 9:115180149-115180171 CTTTCCAGCCAGGATGAGCCAGG + Intronic
1062581596 9:137231388-137231410 CCTTCCAGTCAGGACCAGCAAGG + Intronic
1185684682 X:1918537-1918559 TCTTCTAACAAAGAGCAGCCTGG - Intergenic
1189023805 X:37370639-37370661 CCTTGGGGCCAGGAGCAGACAGG + Intronic
1189166972 X:38870067-38870089 CCTACTCCCCAGAAGCAGCCTGG - Intergenic
1189379973 X:40495735-40495757 TCTTCCAGCCAGCAGCATCCAGG + Intergenic
1190110223 X:47584577-47584599 CATTCTAGCCAGGAGGAGACAGG - Intronic
1193635972 X:83949117-83949139 CCTTCTCAGCAGGAGCAGCTAGG + Intergenic
1193834440 X:86324063-86324085 TCTTCTAACAAAGAGCAGCCTGG - Intronic
1196330739 X:114468435-114468457 CCGCCTGGCGAGGAGCAGCCTGG - Intergenic
1199688912 X:150291254-150291276 CCTCCTGGCCAGGGGCATCCTGG - Intergenic