ID: 1085532341

View in Genome Browser
Species Human (GRCh38)
Location 11:77199375-77199397
Sequence CAGGCAAAGGAGAAGTAGGC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 493
Summary {0: 1, 1: 0, 2: 3, 3: 48, 4: 441}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085532334_1085532341 29 Left 1085532334 11:77199323-77199345 CCTGGAGGAAGTGGCATGTAGGT 0: 1
1: 1
2: 4
3: 42
4: 292
Right 1085532341 11:77199375-77199397 CAGGCAAAGGAGAAGTAGGCCGG 0: 1
1: 0
2: 3
3: 48
4: 441

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085532341 Original CRISPR CAGGCAAAGGAGAAGTAGGC CGG Intronic
900202085 1:1412895-1412917 CAGACAAGGGAGCAGTAAGCAGG + Intergenic
900916267 1:5640942-5640964 AAGGCAAAGGGGAAGCAGACAGG + Intergenic
903436947 1:23357120-23357142 TAGGAACAGGAGAAGCAGGCAGG + Intergenic
903571297 1:24307588-24307610 CAGGAAAAGGAGAAGGAAGTGGG + Intergenic
903918544 1:26782645-26782667 CAGGCAAAGCAGAAGCAGGGAGG - Intergenic
903959445 1:27047468-27047490 CAGGCCAAGGGGAAGGAGGTGGG + Intergenic
904389402 1:30171916-30171938 AAGGGAAAGGGGAAGAAGGCTGG + Intergenic
904866001 1:33579421-33579443 CAGGGAAAGGAGAGGTTGGATGG + Intronic
904916136 1:33971863-33971885 GAGGCAAAGGAGAATTTGGGTGG + Intronic
906561386 1:46760401-46760423 CAAGCCCAGGAGAAGTAGGAAGG - Intronic
906660458 1:47578070-47578092 CAGGCAGAGGAGGGGTTGGCAGG - Intergenic
906822822 1:48947094-48947116 GAGGCAAAGGAGAAGTAACAGGG - Intronic
907981009 1:59480794-59480816 GAGGAAACAGAGAAGTAGGCAGG + Intronic
908931347 1:69319469-69319491 AAGGCAAAGGGGAAGCAGGTAGG - Intergenic
910524723 1:88164767-88164789 AAGGCAAAGGGGAAGCAGGCGGG - Intergenic
910605749 1:89082090-89082112 CTAGCAAGGTAGAAGTAGGCTGG + Intergenic
910725688 1:90336314-90336336 AAGCCACAGAAGAAGTAGGCAGG + Intergenic
911212486 1:95156955-95156977 CAGGCAAAGGATAACTCGGAAGG + Intronic
911680557 1:100710635-100710657 CCTGCAAAGCAGAAGAAGGCAGG - Intergenic
911911928 1:103648327-103648349 CAGACAAGGGAGCAGTAAGCAGG + Intergenic
911916526 1:103703621-103703643 CAGACAAGGGAGCAGTAAGCAGG - Intronic
911919343 1:103742465-103742487 CAGACAAGGGAGCAGTAAGCAGG + Intronic
912155344 1:106911845-106911867 AAGGGAAAAGAGAAGAAGGCAGG - Intergenic
912664665 1:111568327-111568349 AAGGCAAAGCAGGAGCAGGCAGG + Intronic
914901198 1:151712054-151712076 CAGGCCACGAAGAAGGAGGCTGG - Intronic
914932742 1:151949472-151949494 CAGCCACAGGAGCAGGAGGCTGG + Intergenic
915339679 1:155169844-155169866 GAGGCACAGGAGAACTAGGGAGG + Exonic
915594644 1:156889224-156889246 CAGGTAAAGGAGATGAAGGCAGG - Intergenic
915723081 1:157998236-157998258 CTGGCAAAGGAGAAGGGTGCAGG - Intronic
915724927 1:158010719-158010741 CAGGCAAAGGGGAGGGAGGAGGG - Intronic
916766845 1:167869228-167869250 CAAGCAAGGGAGCAGTAAGCAGG - Intronic
917975833 1:180237089-180237111 CAGGGGAAGGAGAAGGAGGGAGG - Intronic
918148877 1:181781348-181781370 CAGGGAAAGGAGAAGGAAGTGGG - Intronic
918212885 1:182367236-182367258 CAGTCAAAGGAGGAGAAGCCAGG + Intergenic
918327321 1:183422358-183422380 AAGGCAAGGGGGAAGCAGGCAGG - Intergenic
919538339 1:198816245-198816267 TAGGCTAAGGAGAAGTAGAAAGG - Intergenic
919590631 1:199497779-199497801 CAGAAAAAGAAGAACTAGGCCGG + Intergenic
919727233 1:200892096-200892118 TAAGCAAAGGTGAAGTGGGCTGG - Intronic
920309697 1:205041860-205041882 CTGGAAAAGGAGAAGGAGTCGGG - Intergenic
920450570 1:206058229-206058251 CAGACAAGGGAGCAGTAAGCAGG - Intronic
920461831 1:206146407-206146429 CAGGGAAAAGAGAACTAGACAGG - Intergenic
920508415 1:206533248-206533270 CAGGCCTGGTAGAAGTAGGCAGG + Intronic
920764212 1:208816131-208816153 GAGGAAAAGGAGAAGCAGGGAGG - Intergenic
921151738 1:212408284-212408306 CTGGCACAGGAGAAGCAGTCAGG + Intronic
921310546 1:213838734-213838756 CAGGCAAAGGCTAAGCTGGCAGG + Intergenic
922226848 1:223652871-223652893 CTGCCAATGGAGAAGGAGGCTGG - Intronic
922541607 1:226424459-226424481 GAGGGAAAGGAGGAGTAGGGTGG - Intergenic
1063228152 10:4035273-4035295 CAGGCAAAGGAGCTGGATGCAGG + Intergenic
1063542594 10:6949482-6949504 AAGGAAGAGGAGAAGAAGGCAGG - Intergenic
1063721679 10:8588658-8588680 CCGGCAAAGGAGAAAGAGGCAGG + Intergenic
1063845082 10:10118729-10118751 CCAGTAAAGGAGATGTAGGCAGG - Intergenic
1063874752 10:10462453-10462475 AAGGCAAAGAAGAAGCAGGGTGG - Intergenic
1064360618 10:14661076-14661098 AAGGTGAAGGGGAAGTAGGCAGG - Intronic
1064555987 10:16547634-16547656 AAGGCAAAGGAGGAGCAGGCAGG - Intergenic
1065094387 10:22266217-22266239 AAGGCACAGTAGAAGAAGGCTGG - Intergenic
1065845953 10:29743552-29743574 CAGGCAAAAGCCAAGTGGGCTGG - Intergenic
1065859328 10:29858354-29858376 CTGGGAAAGGAGAAAGAGGCAGG + Intergenic
1065881390 10:30040483-30040505 AAGGCAAATGAGAACGAGGCTGG - Intronic
1068231862 10:54178103-54178125 CAGCCAACAGAGAAGTAGGATGG + Intronic
1068453612 10:57226407-57226429 CAGGAAGAGCAGAAGTAGGGAGG + Intergenic
1068719419 10:60227509-60227531 CAGGCAAAGGAGAAAGAGAATGG - Intronic
1069240298 10:66130016-66130038 CTGGCAGAGGTGAAGCAGGCAGG - Intronic
1069694400 10:70376213-70376235 CAGTCAAAGGACAAGCAGGCAGG + Intronic
1070037182 10:72737814-72737836 CAGAAAAAGGGGAAATAGGCTGG - Intronic
1070120400 10:73570839-73570861 CACTCAAAGTAGAAGCAGGCTGG + Intronic
1070263343 10:74879124-74879146 AAGGCAAAGGAGAAGATGGTGGG + Intronic
1070307744 10:75249690-75249712 CAAGAAAAGGAGAGGAAGGCTGG - Intergenic
1071288159 10:84167846-84167868 CAGACAAAGGAGCAGTAAGCAGG + Intergenic
1071946668 10:90653627-90653649 CAAGCAAAGGAGAATTAAGTTGG - Intergenic
1072688680 10:97555045-97555067 CTGGCAAAGAGGAAGGAGGCAGG + Intronic
1072688801 10:97556119-97556141 CAGACAAGGGAGCAGTAAGCAGG + Intronic
1074405385 10:113176797-113176819 CAGGGGAAGGAGAAGCAGCCAGG - Intergenic
1074416673 10:113273096-113273118 CAGGCTGAGGAGCACTAGGCAGG - Intergenic
1074808138 10:117074723-117074745 CAGGAAATGCAGCAGTAGGCAGG + Intronic
1075042986 10:119123390-119123412 CAGGAAGAGGAGAAGGGGGCAGG + Intronic
1075427252 10:122351384-122351406 GAGGCCAAGGAGGAGAAGGCAGG - Intergenic
1076534312 10:131167153-131167175 CAGGCACAGGAGAGGGATGCCGG - Intronic
1076874056 10:133207374-133207396 CCGGAAAAGGAGACGTAGCCCGG + Intronic
1077283471 11:1755825-1755847 GAGGCAAAGGCGGAGGAGGCTGG - Intronic
1077344343 11:2039463-2039485 CAGGCAAAGGCGAAGGCCGCAGG - Intergenic
1080458204 11:32433717-32433739 CAGGCGAAAGAGAGGTGGGCGGG + Intronic
1082133945 11:48526230-48526252 CAGGCAAGGAAGAAGTACACTGG - Intergenic
1082566292 11:54683042-54683064 CAGGCAAGGAAGAAGTACACTGG - Intergenic
1083048419 11:59755984-59756006 CAGGAAAGGGAGAAGGAGGCTGG - Intronic
1083624826 11:64067120-64067142 CAGGCCAGGGCCAAGTAGGCAGG + Intronic
1083824345 11:65189966-65189988 CAGGCACAGGTGCAGAAGGCTGG - Intronic
1084113412 11:67027870-67027892 CCGGCAAGGCAGAAGCAGGCTGG + Intronic
1084860508 11:72014930-72014952 GAGGCAAAGGAGAAGGTGGCAGG - Exonic
1085532341 11:77199375-77199397 CAGGCAAAGGAGAAGTAGGCCGG + Intronic
1085824886 11:79834934-79834956 AAGGGAAAGGAGGAGTAGGGAGG - Intergenic
1085895854 11:80638692-80638714 AAGGCAAAGGAGAAGAAGAAGGG + Intergenic
1086734847 11:90293766-90293788 CAGTCAAAGCACAAGCAGGCTGG - Intergenic
1087202514 11:95360061-95360083 AAGGCAAAGGAGAGATGGGCAGG + Intergenic
1087583989 11:100094734-100094756 CAGGGAAAGAAGAAGGAGGGAGG + Intronic
1087814255 11:102641152-102641174 CAGGCAAAGGAAAAGTGGCACGG + Intergenic
1089841850 11:121425498-121425520 AAGGCAAAGGGGGAGCAGGCAGG + Intergenic
1090854600 11:130600657-130600679 AAGGCGAAAGAGAAGCAGGCAGG + Intergenic
1090960309 11:131550549-131550571 AAGGCGAAGGGGAAGAAGGCAGG - Intronic
1202827329 11_KI270721v1_random:94652-94674 CAGGCAAAGGCGAAGGCCGCAGG - Intergenic
1093593684 12:20937672-20937694 CAAACAAGGGAGCAGTAGGCAGG + Intergenic
1095357747 12:41296327-41296349 CAGCCAAAGCAAAAGTAGACAGG + Intronic
1095404187 12:41849511-41849533 TAGGCAAAGAAGAAGGAGGTGGG - Intergenic
1095611023 12:44128218-44128240 CAGACAAAGGAAGAGAAGGCTGG - Intronic
1095783753 12:46087915-46087937 CAGGCAAATGGGAAGTAAACTGG + Intergenic
1096705036 12:53415405-53415427 CAGGGAAAGGAAAAGAAGGGGGG + Intronic
1096778222 12:53976538-53976560 CAGGCAGAGGTGAGATAGGCCGG + Exonic
1097498174 12:60369501-60369523 CAGTCAAAGCAAAAGTAGACTGG - Intergenic
1097594866 12:61616658-61616680 CAGGCAAAGGAGAAGGAGATTGG - Intergenic
1098450610 12:70614030-70614052 GAGGAAAAGGAGAAGGAGGAGGG + Intronic
1098621322 12:72603230-72603252 CAGGCAAATGGAAAGTAAGCTGG + Intronic
1100122819 12:91388549-91388571 CTGGCAAATGAGAACTAGGTTGG + Intergenic
1101311039 12:103579642-103579664 GAGGCAAAGTGGAAGCAGGCAGG + Intergenic
1102777677 12:115534823-115534845 AAGAAAAAGGAGGAGTAGGCAGG + Intergenic
1103947103 12:124532733-124532755 GAGGCAGAGGAGGAGGAGGCTGG + Intronic
1104512994 12:129398569-129398591 CAGGCAAAGGAGGAGGGGGTTGG + Intronic
1105227243 13:18447533-18447555 AAGGCAAAGGAGAAGCACACTGG - Intergenic
1105591501 13:21796830-21796852 CAGGGAGAGGAGAAGAAGGCAGG - Intergenic
1106181690 13:27374730-27374752 CAGAAAACTGAGAAGTAGGCAGG - Intergenic
1107315423 13:39126424-39126446 CAGGGAGAAGAGAGGTAGGCAGG + Intergenic
1109642584 13:65209770-65209792 AAGGCAAAGGGGAAGTAGGCTGG + Intergenic
1110033980 13:70655104-70655126 AGGGCAAAGGGGAAGCAGGCAGG - Intergenic
1110961705 13:81634425-81634447 CAAGCAAAGGAGAAATGGACAGG - Intergenic
1111390277 13:87585202-87585224 AAGGCAAAGTAGAAGAAGACAGG - Intergenic
1112082110 13:95983026-95983048 GAAGCAAAGGAGAAGTGGCCTGG - Intronic
1113014929 13:105818041-105818063 AAGGCCAGGGAGAAGTGGGCAGG + Intergenic
1113156472 13:107328211-107328233 TAGGAAAAGGAAAAGTAGCCAGG - Intronic
1113167386 13:107457473-107457495 CAAGCACAGGAGAAGCAGGAAGG + Intronic
1113766981 13:112887891-112887913 CAGGGAGAGGAGATGTAGCCAGG - Intergenic
1114011694 14:18375987-18376009 AAGGCAAAGGAGAAGCAAACTGG - Intergenic
1114350386 14:21843959-21843981 CTGGGAAAGGAGATCTAGGCTGG + Intergenic
1115362043 14:32514791-32514813 CTGGGAAAGGATAAGTAGGAGGG + Intronic
1116984899 14:51208011-51208033 GAGGGAAAGGAGAAGAAGGGAGG - Intergenic
1117166516 14:53039709-53039731 TAGGCAGTGGAGAAGCAGGCAGG + Intronic
1117689177 14:58287771-58287793 CAGTCAAAGCAAAAGCAGGCTGG - Intronic
1118378520 14:65198495-65198517 CAGGCAAAGGAGGGGGATGCTGG + Intergenic
1118775308 14:68970195-68970217 CAGGCCAAAGAGCAGTCGGCTGG - Intronic
1118830691 14:69428752-69428774 CAGTCAAAGCAGAAGTGGGTCGG + Intronic
1118900398 14:69981063-69981085 AAGGCAGAGCAGAAGGAGGCTGG + Intronic
1119719694 14:76882706-76882728 CAGGGGAAGCAGAAGCAGGCAGG - Intergenic
1119865034 14:77966298-77966320 CAGGCAAAGGGGAGGGAGGCAGG - Intergenic
1120133264 14:80832674-80832696 CAAGCAAAGGAGAAGGAGTTGGG + Intronic
1121406379 14:93721572-93721594 AAGGCAAAGGAGGGGGAGGCAGG + Intronic
1121577518 14:95000458-95000480 AAGGCGAAGGGGAAGCAGGCAGG + Intergenic
1122025146 14:98870446-98870468 ACAGCAAATGAGAAGTAGGCAGG + Intergenic
1122322255 14:100862120-100862142 AAGGAAGAGGAGAAGAAGGCAGG - Intergenic
1122879584 14:104684210-104684232 GAGGCAACCGAGAAGGAGGCTGG + Intergenic
1125065894 15:35486134-35486156 AAGGCAAAGGAGAAGCAGGCAGG + Intronic
1125263641 15:37854743-37854765 AAGGCAAAGGGGGAGTGGGCAGG - Intergenic
1125532397 15:40422144-40422166 CAGGCAAAGGCCATATAGGCTGG - Intronic
1125596584 15:40891146-40891168 GAGGCAAAGGAGAAGCAGTGAGG - Intergenic
1127705608 15:61544649-61544671 CAGGTAGAGGAGAAGCATGCAGG + Intergenic
1127723042 15:61721484-61721506 CAGGGAAAGGAGAAGACAGCTGG + Intergenic
1127774838 15:62256473-62256495 CAGGCCATGAAGCAGTAGGCAGG + Intergenic
1127775092 15:62258148-62258170 CAGGCAGAGGAGCAGCTGGCTGG + Intergenic
1127775431 15:62260699-62260721 CAGGCCATGAAGCAGTAGGCAGG + Intergenic
1128055703 15:64698652-64698674 CAAGAAAGGGACAAGTAGGCAGG - Intronic
1128610706 15:69070947-69070969 AAGGCAAAGGGGGAGTAGGCAGG + Intergenic
1128990543 15:72256091-72256113 TATACAAATGAGAAGTAGGCTGG - Intronic
1129301882 15:74630231-74630253 CAGGCACAGAAGAGCTAGGCAGG + Intronic
1129460688 15:75698707-75698729 CAGGCAAGGGAGAAGCTGTCTGG + Intronic
1129724181 15:77893333-77893355 CAGGCAAGGGAGAAGCTGTCTGG - Intergenic
1130110342 15:80958925-80958947 CAGGCTAAGGAAGAGAAGGCTGG + Intronic
1133217875 16:4304390-4304412 CAGGGAAAGGAAAACAAGGCAGG + Intergenic
1135207833 16:20498021-20498043 CATCCAAAGGAGAAGTAAACAGG + Intergenic
1135211066 16:20525679-20525701 CATCCAAAGGAGAAGTAAACAGG - Intergenic
1135728185 16:24873192-24873214 AAGGGAAAGGAGAAGAAGGAAGG + Intronic
1135848236 16:25938728-25938750 CAGTAAAAGGGGAAGTAGACAGG - Intronic
1136955377 16:34778745-34778767 AAGGCAAATGAGAAGAGGGCAGG + Intergenic
1137490212 16:48926109-48926131 AAGGCAAAAGAGCAGTAGGTAGG - Intergenic
1137748487 16:50841129-50841151 CTGGGAAAGGAGAAGTTGGAAGG + Intergenic
1138319948 16:56103268-56103290 CAGGCAAAGGAGGAGTAACCAGG + Intergenic
1139619464 16:68125541-68125563 CAGGGAAAGGCGCAGTAGGAAGG + Intronic
1140291467 16:73662839-73662861 CAAGCAAAGGGGAAGTGGGCGGG + Intergenic
1141473356 16:84254400-84254422 CAGGCATGGGAGAAGAATGCTGG - Intergenic
1141645387 16:85364726-85364748 CAGGCCAACGGGAAGTGGGCAGG - Intergenic
1141888061 16:86906641-86906663 CAGGAAAAGGAGAAGTCTCCTGG + Intergenic
1143254629 17:5546520-5546542 CAGACAAAGGAGAAATTGGCGGG - Intronic
1143382821 17:6507120-6507142 CAGGGGAAGGAGAAGAAAGCTGG + Intronic
1144796419 17:17894406-17894428 CAGACAAGGGAGGAGCAGGCAGG - Intronic
1145783230 17:27577650-27577672 CAGGCAAGGGAGAGGGTGGCAGG - Intronic
1146004430 17:29151924-29151946 GAAGCAAAGGAGGAGTAGGAAGG + Intronic
1146314809 17:31798422-31798444 CAGCCAAGGGAGAGGGAGGCAGG + Intergenic
1147304061 17:39551129-39551151 CAGGAAAAGGAAAGGTAGGTAGG + Intronic
1147426669 17:40348990-40349012 CAGGGAAAGGAGGAGAAGCCGGG - Intronic
1147459939 17:40561815-40561837 GAGGCAGAGGAGAAGCAGGGAGG + Intronic
1148686766 17:49505454-49505476 CAGAATAAGGAGAAGGAGGCTGG - Intronic
1148765716 17:50037262-50037284 CAGGAATAGGAGAAGGAGGTGGG + Intergenic
1148791747 17:50177092-50177114 GAGGAAAAGGAGAAGGAGGCTGG - Intergenic
1150562853 17:66309809-66309831 CAGAGAAAGGAGAAGAAGACAGG + Intronic
1152219506 17:79054866-79054888 AAGGCAAAGGGGAAGCAGGCTGG - Intergenic
1152350893 17:79783704-79783726 AAGATAAAGGAGAAGTTGGCTGG - Intronic
1153273342 18:3344587-3344609 GAGGAAAAGGAAAACTAGGCAGG + Intergenic
1153553057 18:6282677-6282699 TAAGCAAAGGAAAGGTAGGCAGG + Intronic
1154183260 18:12156135-12156157 AAGGCAAAGGGGGAGCAGGCGGG - Intergenic
1154526132 18:15291942-15291964 AAGGCAAAGGAGAAGCAAACTGG + Intergenic
1156701862 18:39835503-39835525 TAGGAAAAGGAGTTGTAGGCAGG - Intergenic
1157654189 18:49369263-49369285 CAGGCAATGGGGAAGGAGGGTGG - Intronic
1157946330 18:51984726-51984748 AAGGCAAAGGGGAAGCAGGGAGG + Intergenic
1160099244 18:75904873-75904895 CAAGCAAAGGAGAAGGAAACAGG + Intergenic
1160261193 18:77295763-77295785 CAGGCAAGGGAGAAGGTGGCTGG + Intergenic
1160417713 18:78723009-78723031 CATTCAAAGCTGAAGTAGGCAGG - Intergenic
1161016137 19:1984626-1984648 CAGGCAATGGAGATGGAGGCTGG - Intergenic
1162753147 19:12841035-12841057 GAGGCAAACGAGAAGTGGGCGGG - Exonic
1163934193 19:20426756-20426778 CAGACAAGGGAGCAGTAAGCAGG + Intergenic
1164142426 19:22484792-22484814 GAGACAAGGGAGAATTAGGCAGG + Intronic
1164216492 19:23155164-23155186 CAAACAAAGGAGCAGTAAGCAGG + Intergenic
1165957993 19:39514095-39514117 CAGGTAAAGGAGGAGTTAGCTGG - Intergenic
1167026655 19:46924505-46924527 CAGGCAAAGGAAAATCAGACAGG - Intronic
1167553401 19:50176893-50176915 AAGATAAAGGAGAAATAGGCTGG - Intergenic
1168099401 19:54133297-54133319 CGGGCACAGGCGAAGCAGGCAGG + Intergenic
925094673 2:1186586-1186608 AAGCCAAAGGGGAAGCAGGCAGG + Intronic
925885233 2:8389820-8389842 CTGGCAAAGGAGAGGATGGCTGG + Intergenic
926145681 2:10395996-10396018 CAGGCAGAGAAGAGGGAGGCGGG + Intronic
926334892 2:11855612-11855634 ATGGCAAAGAAGAAGAAGGCAGG + Intergenic
927211425 2:20641295-20641317 CAGGCAGAGGGGCAGCAGGCGGG - Intronic
927292923 2:21422282-21422304 CAGGGAGAGGAGAAGAAGGAGGG + Intergenic
927716528 2:25356716-25356738 AAGGCAAAGGAAGAGCAGGCAGG - Intergenic
928105430 2:28467795-28467817 GAGGCAAAGGAGCAGAAGCCAGG + Intronic
929029147 2:37634769-37634791 CAAGCACAGGAGAAGGAGGATGG + Intergenic
929299030 2:40280815-40280837 CAGGCAAAGGTGCTCTAGGCAGG + Intronic
929389362 2:41451401-41451423 CAGGCAAAGCAAAAGCAGGCTGG + Intergenic
931524100 2:63133645-63133667 AAGGCAAAGGAGAAGCAGACAGG - Intronic
931799667 2:65746601-65746623 CAAGCAAAGGATAAGTACGGCGG - Intergenic
931928397 2:67100294-67100316 AAGGCAAAGGGGAAGCAGGCAGG + Intergenic
932198115 2:69801760-69801782 CTTGCAAAGCAGAAGTAGGCTGG + Intronic
932764933 2:74463468-74463490 GAGGGAAAGGAACAGTAGGCAGG + Intronic
933813405 2:86047542-86047564 AAGGAAAAGGAGAAGTAGAGGGG + Intronic
933895373 2:86806437-86806459 CAGGCCAAGGACAAGGAGGAAGG - Intronic
935300783 2:101692239-101692261 CAGGAAAAGAAGAAGCAGACAGG - Intergenic
936165648 2:110116979-110117001 CAGGCAAAGGCCAAGCTGGCTGG - Intergenic
936527871 2:113254281-113254303 CAGGCTAGGGATAGGTAGGCTGG + Intronic
937178914 2:119971187-119971209 AAGGCAAAGGGGAAGCAAGCAGG + Intronic
937327142 2:120996801-120996823 GAGGAAAAGGAGAAGGAGGAGGG - Intergenic
938099708 2:128490439-128490461 CAGGCAAAGGAGAAGGAGGAAGG + Intergenic
938525235 2:132123307-132123329 AAGGCAAAGGAGAAGCAAACTGG + Intergenic
939905148 2:147904140-147904162 CAGGCAAAAGAAAAGTGAGCTGG - Intronic
939967367 2:148623682-148623704 CAAGAAAAGGAGAAGAAGGATGG - Intergenic
941620025 2:167766917-167766939 CAGGCAAAGAAAAAGTGGACTGG - Intergenic
943786454 2:191883032-191883054 TGGGCAAAGGTGAAGGAGGCAGG - Intergenic
944258815 2:197654089-197654111 CTGGCCAAGGAAAATTAGGCTGG + Intronic
945009392 2:205445458-205445480 AAGGCAAAGGGGAAGCAGGCAGG + Intronic
945147135 2:206750204-206750226 GAGGCAGAGGAGAAGCAGGAAGG - Intronic
945233660 2:207614515-207614537 CAGCCTAAGGAGAAGTGGACTGG - Intronic
945534509 2:210997712-210997734 CAGGAATAGGGGAAGTAGGAGGG + Intergenic
945739486 2:213642869-213642891 CATGGAAAAGAGATGTAGGCTGG - Intronic
945841637 2:214894051-214894073 CAGTCAAAGTAGAAATAGCCTGG - Intergenic
946480589 2:220052108-220052130 CAGGCACAGCTAAAGTAGGCAGG - Intergenic
948457328 2:238111221-238111243 CATTCAAAGGATAACTAGGCCGG - Intronic
948662002 2:239513349-239513371 CAGGCGAAGGGGGAGCAGGCAGG - Intergenic
949059596 2:241949303-241949325 CAGGCAAAAGAGAGGTTGGGGGG - Intergenic
1169792364 20:9425025-9425047 AAGACAAAGGAGAAGGAGGAAGG - Intronic
1170634914 20:18095752-18095774 TGGGCTAATGAGAAGTAGGCAGG - Intergenic
1171304269 20:24091899-24091921 CAGGGAAAGGAGAGGGAGGAGGG - Intergenic
1171462718 20:25308059-25308081 CAGGGAACTGAGAGGTAGGCAGG + Intronic
1172008844 20:31834601-31834623 CAGGCCCAGGAGAATTAGGAAGG + Exonic
1172031551 20:31985433-31985455 CAGGGAGAGGAGGAGCAGGCAGG + Intronic
1172147120 20:32764481-32764503 CAGGAAAAGGAGAGGCTGGCAGG - Intronic
1172392367 20:34574595-34574617 CAGGCAGAGGAGAAGGGGGCCGG - Intronic
1172892833 20:38279050-38279072 CAGGCAGAGGGGAAGTGGTCAGG + Intronic
1173189349 20:40864319-40864341 CAGGGAGAGGAAAAGTAGGGTGG + Intergenic
1173900384 20:46583447-46583469 CAGTGAAAGGAGAAGCAGGAAGG + Intronic
1175309422 20:58001397-58001419 CAGGCATATGAGAAGCAGACAGG - Intergenic
1176236153 20:64054458-64054480 CTGGCAGGGGAGAAGGAGGCTGG - Intronic
1176771288 21:13076547-13076569 AAGGCAAAGGAGAAGCAAACTGG - Intergenic
1176968155 21:15235143-15235165 CAGGCAAAAGAGAAGAGGGCAGG - Intergenic
1177354899 21:19995820-19995842 CAAGCAAGGGAGTAGCAGGCAGG + Intergenic
1177783189 21:25641184-25641206 AAGGCAACAGAGAGGTAGGCTGG + Intronic
1178123793 21:29496033-29496055 CAGGAAAAGGATAAGAAGGAAGG - Intronic
1178691672 21:34755064-34755086 CAGGAAAAGGAGAAGAAGGAAGG + Intergenic
1179073761 21:38098700-38098722 CAGGAAAGGGAGTAGGAGGCAGG - Intronic
1179086156 21:38219659-38219681 CATGCAAAGGCAAAGTTGGCAGG - Intronic
1179092839 21:38283888-38283910 CAGGCAAAGGAGACTGAGGAGGG - Intronic
1179480932 21:41678250-41678272 CAGGCAGGGGAGAAGAAGGTTGG + Intergenic
1179638904 21:42734021-42734043 AAGGCAACGGAGAAGCAGGAGGG - Intronic
1179831541 21:44000254-44000276 CAGGCATGGGAGAAAGAGGCAGG - Intergenic
1180031379 21:45210818-45210840 CAGGAAAAGGAGGAGCTGGCAGG + Intronic
1180436187 22:15306795-15306817 AAGGCAAAGGAGAAGCAAACTGG - Intergenic
1180518432 22:16170992-16171014 AAGGCAAAGGAGAAGCAAACTGG - Intergenic
1180874890 22:19170614-19170636 CAGGAACAGGAGAAGGAGTCAGG - Intergenic
1181850844 22:25748911-25748933 CAGGCTTGGGTGAAGTAGGCTGG + Intronic
1181923772 22:26341596-26341618 GAGGCAAGGGAGGAGTTGGCAGG - Intronic
1182106755 22:27695205-27695227 CAGGAAGAGGAGAAAGAGGCGGG + Intergenic
1182522875 22:30894030-30894052 CAGGCAAAGGAGAGGGAAGGAGG + Intronic
1183029859 22:35095473-35095495 CTGGCAATGGAGAAGGAGGTTGG + Intergenic
1183257335 22:36770968-36770990 AAGAAAAAGGAGAAGCAGGCGGG - Intronic
1183653789 22:39173687-39173709 CAGGCAATGGAGAAAGAGCCAGG + Intergenic
1184879598 22:47296581-47296603 AAGGGAAAGGAGAAATTGGCCGG + Intergenic
1185074388 22:48675503-48675525 CAGCAAAAGGGGAAATAGGCTGG + Intronic
1185207855 22:49550370-49550392 CAGGCACAGGAGGAGCAGGTGGG - Intronic
1185336163 22:50271734-50271756 CAGCTAAAGGAGGAGGAGGCCGG + Intergenic
950055882 3:10024091-10024113 CAGGGAAAGAACAAGTGGGCTGG - Intergenic
950484756 3:13266604-13266626 CAAGCAAAGGAGAACTATTCAGG + Intergenic
950674768 3:14548114-14548136 CACTCAAAGGTGAGGTAGGCAGG + Intergenic
950786304 3:15438872-15438894 AGAGCAAAGGAGAAGTAAGCTGG - Intronic
951117943 3:18887165-18887187 CAGTCAAAGCAGAAGTTGGGGGG - Intergenic
951297447 3:20956212-20956234 CAGTCAAAGCAGAAGCAGACAGG + Intergenic
951881178 3:27483380-27483402 CAGGCCAAGTAGAAGGAGGAGGG - Intronic
952591466 3:34960007-34960029 CTGGTAAAGGTGATGTAGGCAGG + Intergenic
952806546 3:37360031-37360053 CTGGCATAGCAGAAGTAGTCTGG - Intronic
952962975 3:38604358-38604380 TGGGCAAGGGAGAAGGAGGCAGG + Intronic
958467103 3:94472164-94472186 CAGGCACAGTATAAATAGGCAGG - Intergenic
958899819 3:99872554-99872576 CAGGCAGGGGAGCAGTAGGGAGG - Intronic
959007113 3:101032396-101032418 CAGTCAAAGCAAAAGTAGACTGG + Intergenic
959901159 3:111663093-111663115 AGGGCAAAGGGGAAGTAAGCAGG + Intronic
959951159 3:112181936-112181958 AAGACAAAGCTGAAGTAGGCAGG + Intronic
960096535 3:113695984-113696006 CAGGAAAAGGTGAAGGAGGCGGG + Intronic
960097127 3:113699291-113699313 CAGGAAAAGGTGAAGGAGGCGGG - Intergenic
960630413 3:119725153-119725175 CAGGTAAAGGAAAGGGAGGCTGG - Intronic
960913555 3:122674504-122674526 AAGGCAAAGGGGAAGCAAGCAGG + Intergenic
961518789 3:127455287-127455309 CAGGCGAAGGTGGAGGAGGCGGG + Intergenic
961717612 3:128869506-128869528 CAGGGAAAGAACAAGTGGGCTGG - Intergenic
962056473 3:131877029-131877051 AAGGCAAGGGAGAAGGATGCCGG - Intronic
962624290 3:137210195-137210217 CAGGCAGAGCAGAAATAGGTTGG - Intergenic
962930852 3:140034598-140034620 CTGGCAAAAGAGAGGAAGGCAGG - Intronic
963631001 3:147729652-147729674 CAGGAAAAAGAGAGGGAGGCAGG + Intergenic
965611359 3:170547131-170547153 GAGGAAAAGGAGAAGAAGGAAGG - Intronic
966834357 3:184037979-184038001 GGGGCAAGTGAGAAGTAGGCTGG - Intronic
967778008 3:193404651-193404673 AAAGCAAAGGGGAAGCAGGCAGG - Intronic
968514471 4:1010471-1010493 CAGGCCGAGGAGAGCTAGGCGGG - Intronic
968586041 4:1416495-1416517 CAGGAAAAGGAGAGGAAGGGTGG - Intergenic
969296102 4:6271294-6271316 CAGACACAGGAAAAGTTGGCTGG + Intronic
970852535 4:20618170-20618192 CAGACAAAGGAGAAGGAGGAAGG - Intronic
971001951 4:22333150-22333172 AAGGTGAAGGAGAAGCAGGCAGG - Intergenic
972107379 4:35506363-35506385 AAGGCAAAGGGGAAGTAAACAGG - Intergenic
972296909 4:37747902-37747924 AAGGCAAAGGGGAAGGAAGCAGG + Intergenic
973118474 4:46489318-46489340 CAGGCTGAGGAAGAGTAGGCAGG - Intergenic
974940684 4:68463928-68463950 GAGGCAAATGAGAAGTAGAAAGG - Intronic
976989952 4:91353775-91353797 CAGACAAGGGAGCAGTAAGCAGG + Intronic
981292975 4:143097907-143097929 CACGCAAAGGGGAAGAGGGCAGG - Intergenic
981817098 4:148843097-148843119 CAGGAAGAGGAGAAGGAAGCAGG - Intergenic
982316527 4:154037546-154037568 ATGGCAAAGGAGAAGGAGGTTGG - Intergenic
983708863 4:170690060-170690082 CAAACAAAGGAGCAATAGGCAGG - Intergenic
985164623 4:187079341-187079363 CAGGCACAGCAGCAGCAGGCAGG + Intergenic
985202095 4:187494374-187494396 AAGGCGAAGGGGAAGCAGGCAGG - Intergenic
985494970 5:199253-199275 CAGGCCAAGGAGATATACGCAGG + Exonic
985810607 5:2081505-2081527 TAGGCAAGGGAGGAATAGGCTGG + Intergenic
986387521 5:7249041-7249063 AAGGCAGAGGAGAAGGCGGCTGG + Intergenic
986393281 5:7304316-7304338 CAGGCCAGGAAGCAGTAGGCAGG + Intergenic
987011787 5:13773854-13773876 CAGACAAAGGAGGAGTGGGTGGG + Intronic
987123949 5:14793584-14793606 CAGGCAAAGGACAAGCAGCCAGG + Intronic
989263570 5:39446626-39446648 AAGGGAAGGAAGAAGTAGGCAGG + Intronic
989512697 5:42306533-42306555 CAGACAAAGGAGAAGTTGGAAGG + Intergenic
990202098 5:53387299-53387321 CAGGCAAGAGAGAAGTGTGCTGG + Intergenic
991609292 5:68434288-68434310 CAGGCAGAGGGGACGTGGGCGGG + Intergenic
993196772 5:84758463-84758485 CAGGTAAAAGAGAAGTGAGCAGG - Intergenic
994703344 5:103166125-103166147 CAGTCAAAGCAGAAGCAGACTGG + Intronic
995460775 5:112400496-112400518 AAGGCAAAGGGGGAGCAGGCAGG + Intronic
997439234 5:133897566-133897588 CAAGCCAAGGATAAGGAGGCAGG + Intergenic
997681096 5:135751232-135751254 CAGGCCCAGGAGAAGGAGGAGGG - Intergenic
998359633 5:141573803-141573825 CAGGCAAAGGAGGAGGTGGGGGG + Exonic
998385387 5:141754378-141754400 CAGGTGAAGTAGAAGTAGGGCGG + Intergenic
998548289 5:143050892-143050914 CAGGCAAAGGTGATGGTGGCTGG - Intronic
999035419 5:148343500-148343522 CAGCCAAAACAGAAGTAGGGTGG - Intergenic
999592046 5:153158838-153158860 CAGGAAAAGGAAAAGCAGGCGGG - Intergenic
999822073 5:155238396-155238418 CATTCAAAGCAGAAGTAGGGAGG - Intergenic
1002335395 5:178474272-178474294 CAAGGAAAGAAGAACTAGGCGGG - Intronic
1003402685 6:5803949-5803971 CAGGAACAGTAGAAGTAGGAAGG + Intergenic
1003431407 6:6041933-6041955 CTGGCAAAGGTGATGTGGGCAGG - Intergenic
1003914276 6:10771095-10771117 CAGGCAGAGGGCAAGTGGGCAGG + Intronic
1004281422 6:14282597-14282619 CAGGGATGGGAGAAGCAGGCAGG + Intergenic
1004491621 6:16122629-16122651 CAGGGTAAGGAGAAGCAGACTGG + Intergenic
1005446562 6:25930112-25930134 CAGGAAAAGGAGAACATGGCCGG - Intronic
1005510789 6:26509918-26509940 CAGGCAAGGGAGAAACAGGAGGG - Exonic
1005713653 6:28526189-28526211 CTGGCAAAGAAGAAGAAAGCAGG - Intronic
1006725046 6:36193277-36193299 CAGGCAAAGGGAAAATATGCAGG - Intergenic
1007739187 6:44000719-44000741 CAGTCAAAGGAGAAGGGGGCAGG + Intronic
1007889485 6:45272890-45272912 CAGGCAAAGCAAAAGCAGACTGG - Intronic
1008518798 6:52343664-52343686 AAGGCAAAGGGGGAGCAGGCAGG - Intergenic
1010355681 6:74930024-74930046 GAGGAAGAGGAGAAGTAGGAAGG + Intergenic
1011203796 6:84869178-84869200 GTGACAAAGGAGAAGAAGGCAGG - Intergenic
1011841703 6:91508844-91508866 AAGGCAAAGGGGTAGCAGGCAGG - Intergenic
1012140007 6:95614874-95614896 CAGGGAAAAGAGAAGGAGGAGGG - Intergenic
1012150235 6:95741066-95741088 AAGGCAAAGGGGAAGCAAGCTGG + Intergenic
1012874545 6:104711153-104711175 CAGGCATATGTGAAGGAGGCAGG - Intergenic
1013325235 6:109039081-109039103 GAGGAAAAGGAGAAGGAGGGAGG + Intronic
1014250011 6:119105464-119105486 AAGGCAAAGGGGAAGCAAGCAGG - Intronic
1014546472 6:122742146-122742168 CAAGCAAGGGAGCAGTAAGCAGG + Intergenic
1015882559 6:137883640-137883662 CAGGAAAGAGAGAAGTAGGCAGG + Intergenic
1016709396 6:147152840-147152862 CAAACAAAGGAGAAGAGGGCAGG - Intergenic
1016986710 6:149900814-149900836 CAGCAAAAGGAGAAGCAGTCTGG - Intergenic
1017028913 6:150203957-150203979 CAGGCAATGGATAAGAAGACTGG - Intronic
1017610794 6:156184431-156184453 CAAGCAAAGGAAAATTAGGAGGG - Intergenic
1017804198 6:157929209-157929231 CAAACAAAGGAGAAGGAGGGAGG - Intronic
1017858882 6:158376730-158376752 GAGACATAGGAGAAGTTGGCTGG + Intronic
1018041382 6:159926024-159926046 CTAGGAAAGGAGAAGCAGGCTGG - Intergenic
1018222347 6:161593600-161593622 CAGACAAAGGAAAAGGAGGCAGG + Intronic
1018813475 6:167314449-167314471 CAGCCTGAGGCGAAGTAGGCAGG - Intronic
1018849839 6:167578939-167578961 AAGGCAAAGGGGGAGCAGGCGGG + Intergenic
1019622005 7:1997251-1997273 CAGGTAAAGGAGCTGCAGGCTGG + Intronic
1019779294 7:2930105-2930127 CAGAGAAAGGAGAAGGGGGCCGG + Intronic
1019965276 7:4493819-4493841 GAGGCGAAGGAGAAGCAGGCAGG + Intergenic
1020865799 7:13560712-13560734 CAGACAAAGGAAAAGAAGGAAGG + Intergenic
1023215429 7:37857558-37857580 CAGGGAAAGGAAAAGTAAGATGG + Intronic
1023461316 7:40400389-40400411 AAGGCAAAGGAGGAGCAGGCAGG + Intronic
1023547775 7:41337225-41337247 CAGCCAAATGAGAAGTCGTCTGG - Intergenic
1024403982 7:48956309-48956331 CAGGAAAAAGTGAAGTAGACTGG + Intergenic
1024919210 7:54539975-54539997 TTGGCAAAGGAGAAATGGGCAGG + Intergenic
1026107897 7:67435444-67435466 CAGTCAAAGGGGAAGTGAGCAGG + Intergenic
1026218300 7:68369062-68369084 TAGGCATAGGAGAAGCAGGGAGG - Intergenic
1026502387 7:70953725-70953747 AAGGCAAAGGAGAAGCAGGATGG + Intergenic
1027924470 7:84443819-84443841 CAGTCAAAGCAAAAGTAGACTGG - Intronic
1028174144 7:87634015-87634037 GAGTCAAAGGGGAAGCAGGCAGG + Intronic
1028792297 7:94866724-94866746 AAGGCAAAGGGGAAGCAGGCAGG - Intergenic
1029065430 7:97843559-97843581 AAGACAAAGGAAAAGCAGGCAGG + Intergenic
1029486547 7:100846223-100846245 CAAACAAAGGAGCAGTAAGCAGG - Intronic
1029978131 7:104852935-104852957 CAGGCACAGGGAAAGCAGGCTGG - Intronic
1030139848 7:106293272-106293294 AAATCAAAGGGGAAGTAGGCAGG - Intergenic
1030344340 7:108415583-108415605 CATAAAAAGGAGAAGAAGGCCGG + Intronic
1030673888 7:112365145-112365167 AGAGCAAAGGACAAGTAGGCTGG - Intergenic
1030737131 7:113062563-113062585 CAGGCAAAGCAAAAGCAGGCTGG + Intergenic
1031123059 7:117742965-117742987 CAGGAAGAGGTGAAGCAGGCTGG - Intronic
1031738003 7:125391197-125391219 CTGGCAAGGAAGAAGTAGTCTGG - Intergenic
1031895699 7:127346205-127346227 CAGGCAAATGTGAAGTAAACAGG + Intergenic
1031957066 7:127953421-127953443 CAGGAAAAATAGAAGTAGGTGGG - Intronic
1032092904 7:128920579-128920601 CAGGCAGAGCAGAAGGAGGTCGG - Intergenic
1032522733 7:132558737-132558759 CAGGCAAAGGCGAAAGAGGCGGG - Intronic
1032783253 7:135181264-135181286 GAGACAAGGGAGAATTAGGCAGG - Intergenic
1033202757 7:139387707-139387729 CATTCAAGGGAGAAGTAGCCTGG - Intronic
1033956389 7:146854054-146854076 CAGGGAGATGAGAAGGAGGCTGG + Intronic
1034562553 7:151890568-151890590 AATGGAAAGGGGAAGTAGGCTGG - Intergenic
1034847804 7:154463501-154463523 TAAGAAAAGGAGAAGTAGGCTGG - Intronic
1035459960 7:159032427-159032449 CAGGCATGGGACAAGAAGGCTGG + Intronic
1036659949 8:10701496-10701518 GTGGCAAAGGAGAGATAGGCGGG - Intronic
1037622412 8:20576405-20576427 GAGACTATGGAGAAGTAGGCAGG + Intergenic
1038044026 8:23750819-23750841 CAGGGAAAGGAGAACAAGGAAGG - Intergenic
1039088798 8:33806265-33806287 CAGGGAAAGGAAAAATAGGGAGG - Intergenic
1039400332 8:37263654-37263676 AAGGAAAAGGGGAAGCAGGCAGG + Intergenic
1039566734 8:38557391-38557413 CAAGCAAAGGAAAACCAGGCTGG - Intergenic
1039707638 8:40023525-40023547 CTGGCAAAGATGAGGTAGGCAGG + Intergenic
1039774080 8:40718645-40718667 GAGGGAAAGAAGAAGGAGGCTGG - Intronic
1039954522 8:42196845-42196867 AAGGCAAATGAGAAGAAGGAAGG + Intronic
1040365274 8:46709008-46709030 AAGACAAAGGAAAAGCAGGCAGG - Intergenic
1041027630 8:53703394-53703416 CAGGCTTAGGAAAAGCAGGCAGG + Intergenic
1042130474 8:65582718-65582740 GAGGAGAAGGAGAAGGAGGCAGG + Intergenic
1043182517 8:77103877-77103899 CAGGCAAAGAAGTGGTGGGCGGG - Intergenic
1043284646 8:78514343-78514365 AAGGCAAAGGGGAAGCAGGCAGG - Intergenic
1044401830 8:91781657-91781679 CAGGCAGAGGAGATGGAGGGGGG - Intergenic
1044543286 8:93431369-93431391 CAGGCAAGGAAAAAGGAGGCAGG + Intergenic
1045396948 8:101770535-101770557 CCTGCAAAGAAGAAGCAGGCTGG + Intronic
1046065987 8:109197237-109197259 AAGGCAAAGGAGGAGCTGGCAGG + Intergenic
1046731262 8:117728785-117728807 CAGGAAAAGGAGAACAAGGATGG - Intergenic
1048538852 8:135324091-135324113 GAGGCAGAGGTGAAGTAAGCTGG - Intergenic
1048865294 8:138756356-138756378 GAGGCCAAGGAGGAGGAGGCAGG - Intronic
1049284889 8:141769227-141769249 CAGGCAGAGGCGAGGTTGGCAGG + Intergenic
1049844280 8:144792518-144792540 CTGGAGGAGGAGAAGTAGGCGGG - Exonic
1050540203 9:6663321-6663343 CAGGCAGAGGATAAATAGACTGG - Intergenic
1050602040 9:7262596-7262618 CAGAAAAAAGGGAAGTAGGCAGG + Intergenic
1050684000 9:8146920-8146942 CAGGAAGAAGAGAAGTAGGAAGG - Intergenic
1051017611 9:12499596-12499618 AAAGCAGAGGAGAAGGAGGCAGG + Intergenic
1052838820 9:33273454-33273476 CAGGAAAAGGATAATTAGGCAGG - Intronic
1053589597 9:39498535-39498557 TAGGCAAAGGAGAACTGGGGAGG - Intergenic
1053703950 9:40730760-40730782 AAGGCAAAGGAGAAGCAAACTGG + Intergenic
1054414033 9:64854369-64854391 AAGGCAAAGGAGAAGCAAACTGG + Intergenic
1054576700 9:66866751-66866773 TAGGCAAAGGAGAACTGGGGAGG + Intronic
1055517390 9:77047126-77047148 CAGGGAAAGGAAAAGTATGGAGG - Intergenic
1055861618 9:80756980-80757002 AAGGTAAGGGAGAAGCAGGCAGG + Intergenic
1056242626 9:84663670-84663692 GAGGAAAGAGAGAAGTAGGCAGG - Intergenic
1058299116 9:103347610-103347632 CAGGCAAAGGAGAAAAATTCAGG + Intergenic
1058391408 9:104499350-104499372 CAGTCAAAGAAGAACTAGGAAGG - Intergenic
1058618790 9:106862525-106862547 GAGGCAAAGGAGAAGGAGAAGGG - Intergenic
1060307661 9:122430768-122430790 CAGGCAAAGGTATACTAGGCTGG - Intergenic
1060598421 9:124861947-124861969 GAGGGAAAGAGGAAGTAGGCGGG + Exonic
1060625852 9:125110651-125110673 AAGGTGAAGGAGAAGCAGGCAGG - Intronic
1061143406 9:128782077-128782099 CTGGCAATGAAGTAGTAGGCAGG + Intergenic
1061204125 9:129153192-129153214 CAAGCAGAGGAGCAGTGGGCTGG + Intergenic
1061347268 9:130036747-130036769 AAGAAAAAGGAGCAGTAGGCCGG + Intronic
1061504770 9:131025565-131025587 CAGGCAAAGGAGAGGAGAGCAGG + Intronic
1062077683 9:134600778-134600800 CGGGCAATGGAGAAGTAAACAGG + Intergenic
1062476307 9:136729045-136729067 CAGGCAAAGGCCAGGAAGGCCGG + Intergenic
1186386596 X:9116283-9116305 CAGGAATTGGAGGAGTAGGCTGG - Intronic
1186639502 X:11440511-11440533 CAGGCAAAGGAGAAATGGAAGGG - Intronic
1187063622 X:15811720-15811742 CAACAAAAGGAGAATTAGGCCGG - Intronic
1187066932 X:15850104-15850126 CAGGCAAAGGAGATGAAGAAGGG - Intronic
1187072872 X:15905660-15905682 CAGATAAAGGAGAAAAAGGCTGG - Intergenic
1187254574 X:17630431-17630453 CTTGTAAAGGAGATGTAGGCAGG - Intronic
1187882913 X:23862944-23862966 CAGGGAAGGGAGAAGGAGGGAGG + Intronic
1189481339 X:41394445-41394467 CAGGCACAGAAGAAGGAGGAGGG + Intergenic
1189763881 X:44349274-44349296 AAGACAAAGAAGAAATAGGCCGG - Intergenic
1190572640 X:51799806-51799828 TAGTCAAAGGAAAAGTAGACTGG - Intergenic
1192067074 X:67896627-67896649 AAGGCAAAGGAGACATAGGGTGG + Intergenic
1192330418 X:70170885-70170907 CAGGGAAAGGGAAAGTAGGTGGG - Intergenic
1192874130 X:75210635-75210657 CAGCCAAAGGAGAATAAGGAGGG + Intergenic
1193040540 X:76999266-76999288 CAGGGTAAGCAGAAGTAGGGTGG - Intergenic
1193861274 X:86671582-86671604 AAGGCAAAGGGGAAGGAAGCAGG - Intronic
1195619427 X:106938181-106938203 GAGACAAAGTATAAGTAGGCAGG + Intronic
1195681459 X:107550015-107550037 CAGGGAAAGGACAAGGAGACCGG - Intronic
1195747822 X:108136359-108136381 AAGGAAAGGGAGAAATAGGCAGG + Intronic
1197930415 X:131689296-131689318 AAGGCAAAGGGGAAGCAGGCAGG + Intergenic
1199600806 X:149540183-149540205 CAGCCACAGGAGAAGCAGGTCGG - Intergenic
1200194752 X:154240186-154240208 CAGGGAAAGAAGAGGAAGGCAGG + Intergenic
1201579315 Y:15494348-15494370 AAGGGAAAGGAGAACCAGGCTGG + Intergenic
1201697281 Y:16839918-16839940 CAGACAAGGGAGCAGTAAGCAGG - Intergenic
1202196957 Y:22306775-22306797 CAGGCACAGAAGAAGTGGGGAGG + Intergenic