ID: 1085532697

View in Genome Browser
Species Human (GRCh38)
Location 11:77201371-77201393
Sequence ATCTTCCCACAGAAGAACTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 280
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 260}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085532697_1085532699 8 Left 1085532697 11:77201371-77201393 CCTCAGTTCTTCTGTGGGAAGAT 0: 1
1: 0
2: 1
3: 18
4: 260
Right 1085532699 11:77201402-77201424 TCAGCCTGTCTCTGCCCCCATGG 0: 1
1: 0
2: 2
3: 44
4: 399

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085532697 Original CRISPR ATCTTCCCACAGAAGAACTG AGG (reversed) Intronic
901243920 1:7713383-7713405 ATTTTCCCACAGAAGAGTTTGGG - Intronic
901329619 1:8395696-8395718 ATATTCCCACAAAAGAATTTAGG - Intronic
902232023 1:15034294-15034316 TTCTCCCCACGGAAGAAATGAGG + Intronic
902777185 1:18682517-18682539 TTCTTCCCAGTGGAGAACTGGGG + Intronic
902864085 1:19266742-19266764 ATCTCCCCACAAAAAAACTTGGG - Intergenic
905477878 1:38241702-38241724 AGCTTCCCCCACCAGAACTGGGG + Intergenic
905802614 1:40854853-40854875 CTCTTCCCACAGAGGAGCTCAGG + Intergenic
906572778 1:46858685-46858707 GTATTTCCACAGCAGAACTGGGG + Intergenic
906598991 1:47107203-47107225 GTATTTCCACAGCAGAACTGGGG - Intronic
908431213 1:64060338-64060360 ATTATCCAACAGAAGAACTCTGG - Intronic
908483808 1:64570571-64570593 AACTGCAAACAGAAGAACTGGGG - Intronic
908971666 1:69842564-69842586 ATATTCCAACAGAATTACTGGGG + Intronic
910219770 1:84878639-84878661 ATCTTCCAACAGCTGAGCTGAGG - Intronic
912965018 1:114229853-114229875 CTGGTCCCACAGAAGAGCTGAGG - Intergenic
913328303 1:117646747-117646769 AGCTTCCTACAGAAGACCAGTGG + Intergenic
913468188 1:119164583-119164605 ATGTACCCACAAAAAAACTGAGG + Intergenic
915770555 1:158418040-158418062 ATCTTCCCACAGATGACCCATGG + Intergenic
916731173 1:167568218-167568240 ATTTCCCCACAGAATAACTGAGG + Intergenic
916910271 1:169338909-169338931 ATGTTCCCACAGTAGAACACTGG + Intronic
917826777 1:178830214-178830236 ATCTTCCACCAGCAGTACTGGGG - Intronic
919161001 1:193831341-193831363 ATCAAGCCACTGAAGAACTGTGG - Intergenic
919778183 1:201207425-201207447 ATCTAGCCTCAGAAAAACTGGGG + Exonic
920020359 1:202951046-202951068 GTCTTCCCACAAAGGATCTGTGG - Exonic
921620863 1:217324768-217324790 ATATTCCCACACAGAAACTGAGG - Intergenic
922967175 1:229700073-229700095 GTCTTCTCACAGAAGTCCTGAGG - Intergenic
924420165 1:243901399-243901421 AACTTACCACAGAAGAATGGAGG - Intergenic
924443425 1:244105404-244105426 ATCCTCCCAAAGAAGGACCGAGG + Intergenic
1063764843 10:9127086-9127108 CTCTTCCCACATAAGAAGAGCGG + Intergenic
1065710721 10:28514932-28514954 ATTTTCCAACACAAGAACTTTGG - Intergenic
1066544773 10:36487877-36487899 TTTTCCCCACAGAAGACCTGTGG - Intergenic
1067213577 10:44281789-44281811 CTCTGCCCACAGCAGGACTGTGG + Intergenic
1067471265 10:46540378-46540400 ACCTTCCCACTGAAGAATTTAGG - Intergenic
1067782746 10:49220958-49220980 ATTTGCACACAGAGGAACTGAGG + Intergenic
1067856299 10:49796463-49796485 ATCTCCACACAGTAGAACAGTGG - Intergenic
1070887822 10:79920715-79920737 ATATTTCCACACAGGAACTGGGG + Intergenic
1074064985 10:110006692-110006714 CTCTTCCCACATATGAAGTGTGG - Intronic
1075237671 10:120745759-120745781 ATCTTTCCCCAGGAAAACTGAGG - Intergenic
1075862706 10:125690881-125690903 TCCTTCCCTTAGAAGAACTGAGG - Intergenic
1076218887 10:128717348-128717370 ATCTTCCCAAAGGAGAGATGGGG - Intergenic
1076251563 10:128988064-128988086 ATCTTCCCACAGCAGAAGGTGGG + Intergenic
1077693837 11:4375357-4375379 ATGTTACCACAGAAGATTTGTGG + Intergenic
1079427502 11:20357496-20357518 ATGTTCCAACAGAGTAACTGAGG + Intergenic
1081602057 11:44502098-44502120 AAGTCCCTACAGAAGAACTGGGG - Intergenic
1083138134 11:60699370-60699392 ATGTCCCCACAGGAGAACAGAGG - Intergenic
1083664884 11:64268949-64268971 AGCGTCCCACAGAAGAAGTGAGG - Exonic
1085383598 11:76142223-76142245 ATCTGCCCACATAAAAACTTTGG - Exonic
1085532697 11:77201371-77201393 ATCTTCCCACAGAAGAACTGAGG - Intronic
1086148675 11:83583670-83583692 ATCGTCCAGAAGAAGAACTGAGG - Intronic
1088112748 11:106280700-106280722 AACTTCCCACAGAAGAGCTATGG + Intergenic
1089482932 11:118821641-118821663 TTCTTCCTACAAAATAACTGAGG + Intergenic
1091038257 11:132253301-132253323 ATTTTCTCATAGAAGAAATGGGG - Intronic
1091051249 11:132374611-132374633 ATCTTCCCAAACAAAAGCTGAGG + Intergenic
1091157559 11:133387511-133387533 AACTTCTCATAGAAGAACTCTGG - Intronic
1091268975 11:134292482-134292504 TTCTTGCCACAGAAAAACTATGG - Intronic
1092218709 12:6699276-6699298 ATCTTCCCAGAGAACAACAAGGG + Intronic
1092870121 12:12798779-12798801 ATCTTTCCACATCACAACTGTGG + Intronic
1095918963 12:47509742-47509764 ATCTCCCCACAGCAAATCTGAGG + Intergenic
1097239334 12:57564270-57564292 ATCTTCCCACTGAAGAGCCTGGG + Intronic
1097973358 12:65658942-65658964 ATCTTCCCAATGGAGAACTCTGG - Intergenic
1099082201 12:78198804-78198826 ATCTTGCCAGAGATGACCTGTGG + Intronic
1099205904 12:79726278-79726300 ATCTTCCCAGAGCAAAACTAAGG + Intergenic
1102127941 12:110501231-110501253 ACCTTCCTACATAAAAACTGGGG - Intronic
1103338855 12:120210586-120210608 ATCTTCCCCAAGAGGGACTGGGG - Exonic
1104336050 12:127896574-127896596 TTCTTCCCACAGAAGACATTTGG + Intergenic
1104569547 12:129912840-129912862 ATCTTCTCACATTAGAGCTGAGG + Intergenic
1105757176 13:23477751-23477773 AACTTCCCAAAGAAAATCTGAGG - Intergenic
1107104685 13:36630535-36630557 ATCAGCCCAAAGAAGAACTGGGG + Intergenic
1107396826 13:40026837-40026859 ATTTCCCCACAGAAGAAGTGTGG + Intergenic
1107452089 13:40518836-40518858 ATCTGCCCACAGAAAAACCTGGG + Intergenic
1108981117 13:56515910-56515932 ACATTCACACAGAAAAACTGGGG - Intergenic
1109185344 13:59261324-59261346 ATCTGCCCACACATGAGCTGGGG - Intergenic
1110416323 13:75257282-75257304 ATATTCCCAGAGAAGTGCTGGGG + Intergenic
1113675120 13:112201892-112201914 ATCTCCCCACTGGAGACCTGTGG + Intergenic
1113870688 13:113558119-113558141 ATCTTCCGCTAGAAGAACTAGGG + Intergenic
1114768097 14:25397681-25397703 AACTTTCCAGAGAATAACTGTGG - Intergenic
1115134095 14:30088227-30088249 ACCTTCCCAAAGAAAAGCTGAGG + Intronic
1115326989 14:32150735-32150757 AGTTTCCCACACAAGAACTTTGG + Intronic
1116609068 14:47043708-47043730 AGCTTTCCACAGAAACACTGTGG - Intronic
1116786514 14:49294384-49294406 TCTTTCTCACAGAAGAACTGAGG + Intergenic
1116836299 14:49771625-49771647 ATCTGCCTAGAGAAGAACTATGG + Exonic
1117354897 14:54914406-54914428 ATTTTCCCACTGAAAAGCTGGGG + Intergenic
1118690724 14:68337403-68337425 ACTTTCACACAGAAAAACTGTGG - Intronic
1119025495 14:71149117-71149139 GCCTTTCCAGAGAAGAACTGAGG - Intergenic
1123976974 15:25563031-25563053 ATCTTCCCAAAAAAGATATGTGG - Intergenic
1125458218 15:39882799-39882821 TTGTTCCCCCAGAAGCACTGTGG + Intronic
1125899189 15:43329635-43329657 TTCTTCCCGCAGAAGAACGCCGG - Exonic
1126362859 15:47864182-47864204 AATTTCCCACAGAATAAATGTGG - Intergenic
1126517422 15:49552189-49552211 ATATTCCCACACAAAAGCTGAGG - Intronic
1126754344 15:51910711-51910733 AGCTTCCCTCATAAGAACTGTGG + Exonic
1127819922 15:62645698-62645720 TTCTTCCCACGGAAGAAGGGAGG - Intronic
1128506923 15:68278876-68278898 ATCTTCCCACAGAGGGAATGAGG - Intronic
1129277679 15:74457771-74457793 ATCTATCCACAGAAAAACTCTGG + Intronic
1129681244 15:77659679-77659701 ACCTTCCCACACAGGAACAGAGG + Intronic
1131467453 15:92667289-92667311 ATCTTTCCCCAGAAAAGCTGAGG + Intronic
1133633530 16:7644492-7644514 ATATTCCCACAGAAACTCTGGGG - Intronic
1134807530 16:17138570-17138592 AGCCTCCCACAGATGAACTGGGG + Intronic
1137550128 16:49431808-49431830 AGGTTCCCCCAGAAGAACTCTGG - Intergenic
1138142157 16:54578139-54578161 ATCTTGTCACACAAGAGCTGTGG + Intergenic
1139329910 16:66179674-66179696 TCCTTCCCACAGAAGAACTAAGG + Intergenic
1140857528 16:78991083-78991105 AGCTTCCCAAAGAAGAGTTGTGG + Intronic
1141588707 16:85052622-85052644 AACTTTCCACAGCAGTACTGTGG - Intronic
1146537477 17:33665702-33665724 GTCTTTCCACAGAAGAATTCTGG + Intronic
1148442114 17:47716821-47716843 ACATTTCCAAAGAAGAACTGAGG + Intergenic
1149039254 17:52168410-52168432 ATCTTCCCACATAAAAAATAAGG - Intergenic
1150586552 17:66523430-66523452 TTCTGCCCACAGACAAACTGTGG - Intronic
1151073960 17:71249523-71249545 ATTTTCCCACAGAGGTAATGGGG - Intergenic
1151592091 17:75052024-75052046 ATCTGCCCTCAAAAGGACTGGGG - Intronic
1152360407 17:79830773-79830795 GTCTACACCCAGAAGAACTGGGG + Intergenic
1153129894 18:1843354-1843376 ATCTTCCAAAAGGATAACTGAGG + Intergenic
1153231525 18:2941493-2941515 AACATCCCTCAGAAGCACTGTGG + Intronic
1153863599 18:9239339-9239361 ATTTTCCCACGGAAGAAGGGAGG + Intronic
1154171557 18:12056580-12056602 TGCTTCCCCCAGAAGCACTGGGG - Intergenic
1156257837 18:35415066-35415088 ATGTTCCCACTTATGAACTGTGG - Intergenic
1157561348 18:48648582-48648604 ATCTTCTCAGAGAGCAACTGAGG - Intronic
1158956634 18:62546513-62546535 TTCTTCCCACAACAGAATTGTGG + Intronic
1162210560 19:9088244-9088266 TTCTGCCTACAGAAGTACTGAGG - Intergenic
1162361220 19:10221622-10221644 ATCCTCCCACTGGAGAGCTGGGG - Intronic
1163377755 19:16944179-16944201 CTCTTCCCACCGGAGGACTGTGG - Intronic
1164037344 19:21466583-21466605 ATCTCGCCACAGAAGCAGTGGGG + Intronic
1165124074 19:33581684-33581706 CTCCTCCTACAGCAGAACTGTGG + Intergenic
1165408132 19:35642985-35643007 AGCTTCCCACAGCTGGACTGGGG + Exonic
1166632491 19:44419279-44419301 ATCTTCCCAGAGCAGAGCAGTGG + Intronic
1166724973 19:45021526-45021548 AGCTTCCAACTGATGAACTGGGG - Intronic
1167777044 19:51565166-51565188 ACCTTCCCTCAGGAGAGCTGTGG + Intergenic
1168573812 19:57491672-57491694 TTCTTCCCAAAGCTGAACTGTGG + Intronic
1168575423 19:57504861-57504883 TTCTTCCCAAAGCTGAACTGTGG + Intronic
925013946 2:507736-507758 ATCTTTCCAAAGAAGATCTTTGG + Intergenic
925111417 2:1341518-1341540 AGCTGCCCTCAGAAGAACAGGGG + Intronic
925127810 2:1473342-1473364 ACTTTGTCACAGAAGAACTGGGG + Intronic
925321742 2:2975707-2975729 ATCTTACCAGATTAGAACTGAGG + Intergenic
925685903 2:6473227-6473249 ATCTTTCCACAAAATATCTGGGG - Intergenic
927336733 2:21933156-21933178 AACTCACCACAGAAGAACTTGGG - Intergenic
928451999 2:31385846-31385868 ATCCTCCCCCAGAAAAAGTGGGG + Intronic
930789184 2:55306213-55306235 ATCTTACCAAATAAGAAATGGGG - Intronic
932941097 2:76166625-76166647 CTCTTGCCACTGAAGAACCGAGG - Intergenic
933114776 2:78454621-78454643 AACTGTCCACAGAAGAAATGTGG - Intergenic
933340940 2:81025487-81025509 ATCTTCCTACAGATGAAAAGCGG - Intergenic
935578987 2:104739404-104739426 CACTTCCCACAAAAGAAATGAGG + Intergenic
937908874 2:127065718-127065740 ATGTTCCCACAGACAAGCTGCGG - Intronic
942297033 2:174527714-174527736 ATCATGCCACAGCAGGACTGAGG - Intergenic
942492183 2:176500399-176500421 AGCTCCCCAAAGAAAAACTGGGG + Intergenic
944086139 2:195850096-195850118 ATGTTACCACAGATGAACTCTGG + Intronic
944507176 2:200424778-200424800 AGCTTCCCAGAGATAAACTGGGG + Intronic
945853167 2:215034456-215034478 GGCTTCCCACAGAATAAGTGTGG + Intronic
1168814402 20:727046-727068 CTCTACCCACAGATGAACTTGGG + Intergenic
1169117602 20:3076046-3076068 ATCTGCCCACAGAGCACCTGAGG + Intergenic
1169506793 20:6220089-6220111 ACCTTCCCTCTGAAGAACTAGGG - Intergenic
1170098075 20:12668984-12669006 AGCTTCCCACAGAAGAGCCAGGG - Intergenic
1170668631 20:18408702-18408724 ATCTTCCCAAAGAAAAGCTAAGG + Intronic
1172468999 20:35176946-35176968 ATCTGCCCACTGAAGATTTGAGG + Exonic
1173081311 20:39870563-39870585 CTCTGGCCACAGGAGAACTGTGG - Intergenic
1173488534 20:43458771-43458793 TTCTTCCCACAGAGGAAGTAAGG + Intronic
1174565824 20:51463843-51463865 ATGTACCCACAGATGCACTGAGG - Intronic
1175374748 20:58516270-58516292 ATCATCCCACAGGGGAACAGGGG + Intergenic
1176088731 20:63309635-63309657 ATCTGTCCACAGAAGGGCTGGGG + Intronic
1177707821 21:24731888-24731910 ATCTTCCAACAGACTAACTTGGG - Intergenic
1177977759 21:27872316-27872338 ATCTTTGCACAGAAGAGGTGGGG + Intergenic
1179157548 21:38863241-38863263 ATCCTCCCACGGAAGAACATGGG - Intergenic
1181747377 22:24964996-24965018 TTCTTTCTGCAGAAGAACTGAGG - Intronic
1181885566 22:26019386-26019408 ATCTTCCCAAGTCAGAACTGAGG - Intronic
1182036409 22:27202082-27202104 ACCATCCCAGAGAAGAAGTGAGG + Intergenic
1182509151 22:30806675-30806697 GGCTTCCCACAGAGGCACTGAGG - Intronic
1182511656 22:30824423-30824445 ATTTTCACACAGAACACCTGAGG - Intronic
1182816077 22:33165183-33165205 ATTTTACCCCAGAAGAACTTCGG + Intronic
1183660701 22:39219317-39219339 ATCTCCCCACAGGGGGACTGTGG + Intergenic
1184624793 22:45716680-45716702 ATCCTCTCAAAGTAGAACTGTGG - Intronic
1184753159 22:46500573-46500595 AACTTGTCACAGAAGAACAGAGG + Intronic
950481629 3:13247841-13247863 ATCTTCCCACAGACACGCTGTGG + Intergenic
950568827 3:13787695-13787717 ACCTGCCCACACAAAAACTGGGG - Intergenic
951636516 3:24784434-24784456 ATCTTCCCTGAGAAGAATTCTGG + Intergenic
952681095 3:36094111-36094133 ATCTTTCCTTACAAGAACTGTGG + Intergenic
953816313 3:46160896-46160918 AGATTCCCACACAATAACTGTGG - Intergenic
955108194 3:55920879-55920901 ATTTGACCACAGAAGAACAGAGG + Intronic
955411259 3:58657037-58657059 CTCTACCCACAGAAAAATTGTGG + Intronic
959019367 3:101171404-101171426 ATCTTCTCAAAGACAAACTGAGG - Intergenic
960455220 3:117862980-117863002 CTCTTTCCATAGAAGAAATGAGG - Intergenic
961109903 3:124275140-124275162 ATCTTTCAACAGGAGAAGTGGGG + Intronic
961231850 3:125320029-125320051 ATCCTCCCACAGGAGAAAAGGGG - Intronic
961439231 3:126942703-126942725 ATCCTCCAACAGAAGGAATGTGG - Intronic
964341317 3:155711614-155711636 ATTTTCCCAGAGGAAAACTGGGG - Intronic
964628689 3:158784805-158784827 TTCTTCTCCCAAAAGAACTGTGG - Intronic
965117165 3:164505197-164505219 ATCTTCCAACAAAAAAACTCAGG - Intergenic
968983975 4:3865474-3865496 ATCTGCCCACAGGAGAAAGGAGG + Intergenic
970505144 4:16721562-16721584 ATCATCCAACAAAAAAACTGAGG + Intronic
970878075 4:20895875-20895897 ATTTTCCCAAAGCAGAACAGTGG - Intronic
970981955 4:22109283-22109305 ATCTTCTCAGAGAAGCACTGGGG + Intergenic
975178926 4:71320926-71320948 ATCTCGCCACTGATGAACTGAGG + Intronic
975288133 4:72644698-72644720 ATCTTACCCCTGAAGTACTGGGG + Intergenic
975313763 4:72929783-72929805 ATTTTCCCGCAGCAGGACTGAGG - Intergenic
975438243 4:74379251-74379273 ATCCTTCCACAGAATAGCTGGGG + Intronic
975575702 4:75860431-75860453 ATCTTCACAAAGTAGAACTTAGG - Exonic
977936013 4:102805460-102805482 TTATTGCCACAGAAGAGCTGAGG - Intronic
979502554 4:121456709-121456731 TTCTTCCCAAAGCAGAAGTGGGG - Intergenic
981528605 4:145732187-145732209 ATCTTACCAGAGAAGCAGTGGGG + Intronic
982718010 4:158829168-158829190 AAGATCCCCCAGAAGAACTGTGG - Exonic
983255384 4:165394334-165394356 ATCTATTCACAGAAGCACTGTGG - Intronic
983392187 4:167146340-167146362 AGACTCCCACACAAGAACTGTGG + Intronic
983489645 4:168373391-168373413 CTCTTCCCACAGCAAACCTGTGG + Intronic
986051426 5:4094085-4094107 TTCTGCCTACAGAAGAAATGCGG - Intergenic
986232319 5:5877643-5877665 ATTTTTCCACAGAAGAACCTGGG + Intergenic
987162797 5:15161880-15161902 ATCTTCCCACAGACTTAGTGAGG - Intergenic
987235870 5:15941161-15941183 ATATTCACACAGAAAATCTGTGG + Intergenic
987345128 5:16972233-16972255 CTTTGCCCACAGATGAACTGAGG + Intergenic
988799721 5:34684877-34684899 ACCATCCCAGAGGAGAACTGAGG - Intronic
989155147 5:38337848-38337870 ATTTTCCCACAGCTGAACAGAGG - Intronic
989232881 5:39105942-39105964 ATCTTCACAGAGATGAAGTGGGG - Intronic
989532021 5:42518776-42518798 ATCCTCCCACTGGAGAAATGTGG + Intronic
989573222 5:42964654-42964676 ATCTTCCCAAAGAAGAAGTGTGG - Intergenic
989951444 5:50302971-50302993 ATCTTCAAACAGAAGAGCTGAGG + Intergenic
990363726 5:55047910-55047932 ATCTTACTCCAGAAGAAATGAGG + Intergenic
991469552 5:66953614-66953636 ATATTCCCCGAGAAGAAATGTGG + Intronic
994086011 5:95759755-95759777 GTTTTCCCACAGAAGTGCTGTGG + Intronic
995833448 5:116377969-116377991 ATCTCCCCTCTGAACAACTGAGG + Intronic
996311670 5:122113107-122113129 ACCTTCCATCTGAAGAACTGGGG - Intergenic
998615298 5:143733855-143733877 AGCTTCCCACAGACTAGCTGAGG - Intergenic
999081292 5:148846207-148846229 ATATCCACACAGATGAACTGAGG + Intergenic
1002865529 6:1118855-1118877 AATTTCCCACAGATGAACTTTGG - Intergenic
1003119278 6:3306671-3306693 TCCTTCCCACAGAAGCCCTGGGG - Intronic
1003523021 6:6874717-6874739 CACTTCCCAGAGAAGAACTGAGG + Intergenic
1008638430 6:53435953-53435975 ATATACTCAAAGAAGAACTGAGG - Intergenic
1009776503 6:68211999-68212021 ATCTTCCCACTGAACCACGGAGG + Intergenic
1010001985 6:70957127-70957149 GTCTTCCCACAGGAGGACTTGGG - Intergenic
1010046924 6:71455894-71455916 ATATTCCCACAAAAGGGCTGAGG - Intergenic
1013145567 6:107387669-107387691 GTCTTCCTGCAGAATAACTGTGG - Intronic
1014503659 6:122226333-122226355 ATGTACCCTCAGAAGAAGTGTGG - Intergenic
1014609877 6:123528791-123528813 ATATTCACACAGAAAAACTGTGG + Exonic
1016033113 6:139357925-139357947 AGCTTCCCATGGATGAACTGAGG - Intergenic
1016692096 6:146949927-146949949 AAATTCCCAAAGAAGACCTGAGG - Intergenic
1019407551 7:891643-891665 TTCTTCCCACAGAACAAATATGG + Intronic
1019648685 7:2144604-2144626 CTCTTCCCACGGCAGAGCTGGGG + Intronic
1019867865 7:3729670-3729692 ATCATCCCAGAGAACATCTGCGG + Intronic
1021468428 7:20972402-20972424 AGCTCCCCACTGAAGAGCTGTGG + Intergenic
1022161000 7:27711321-27711343 ATCTTCCCAAAGAAGATCCCTGG + Intergenic
1022472978 7:30693045-30693067 CTCTTGCCACAGAGGAACAGGGG + Intronic
1022793103 7:33708614-33708636 ATATTACCACAGAAGAAATAGGG + Intergenic
1023284912 7:38608857-38608879 ATATTCCTACAGAAGAATTAGGG + Intronic
1024228017 7:47343065-47343087 ATATTCACACAGAAGAAGTCAGG - Intronic
1024896095 7:54263873-54263895 GTGTTCCCACAGAAGCCCTGGGG - Intergenic
1028397454 7:90386902-90386924 ATTTTCCCTGGGAAGAACTGAGG - Exonic
1031117093 7:117680497-117680519 ATCCGCCCACAGCAGAACAGGGG + Intronic
1032479551 7:132235518-132235540 TTCTTCCAACAGAAGAAATCTGG + Intronic
1032547655 7:132756985-132757007 AACTTCCCAGAGAAGTCCTGTGG + Intergenic
1033021699 7:137731759-137731781 AGCTTCAAACAGAAGACCTGTGG - Intronic
1033756415 7:144400953-144400975 ATCTACCCCCAGGAGACCTGAGG - Intronic
1034346640 7:150389296-150389318 CTCTTCCCACAGAGGCAATGAGG - Intronic
1037302822 8:17470690-17470712 ATCTTCACACACAAGTACTGTGG + Intergenic
1037587173 8:20285318-20285340 ATCTACACATGGAAGAACTGAGG - Intronic
1038114073 8:24533234-24533256 ATCTGCCCACAGAAGAATATTGG - Intergenic
1039196965 8:35043233-35043255 ATCTTCCCACAGAGAAACCAGGG - Intergenic
1039785762 8:40833003-40833025 TTCTTTCCACAGAAGGACAGTGG - Intronic
1040046119 8:42965424-42965446 TTCTTCCCACAGAAGATGTCTGG - Intronic
1043537048 8:81216892-81216914 ATTTTCCCACAGTGGAACAGAGG - Intergenic
1043927382 8:86052610-86052632 ATCTATCCACAAAAGAACTGAGG - Intronic
1045716490 8:105053012-105053034 ATTTTCCCACAGAAGCAATGAGG + Intronic
1046935057 8:119877769-119877791 ATCTTCCCACATAAGATTTGTGG + Intronic
1047695763 8:127402100-127402122 CTCTTCCCAGAGTAGAACAGGGG - Intergenic
1050143410 9:2540015-2540037 ATATTCCTAGAGAAAAACTGGGG + Intergenic
1050766180 9:9137450-9137472 ATATTCAGACAGAAAAACTGAGG - Intronic
1051364946 9:16315284-16315306 CTCATGCCACAGAAGCACTGAGG - Intergenic
1052570084 9:30209637-30209659 GTCTTCCCACAGGAGAATTCTGG + Intergenic
1053556522 9:39143478-39143500 ATCTTCCCACAAACTAGCTGGGG + Intronic
1053820635 9:41963777-41963799 ATCTTCCCACAAACTAGCTGGGG + Intronic
1054089500 9:60831905-60831927 ATCTTCCCACAAACTAGCTGGGG + Intergenic
1054110911 9:61107463-61107485 ATCTTCCCACAAACTAGCTGGGG + Intergenic
1054609946 9:67223662-67223684 ATCTTCCCACAAACTAGCTGGGG - Intergenic
1054804159 9:69381892-69381914 TTCTTCCCGAAGAACAACTGGGG - Intronic
1055757017 9:79569040-79569062 AACTTCCTACAGAGGCACTGTGG + Intergenic
1059853870 9:118373681-118373703 ATCCTAGCACAGGAGAACTGAGG - Intergenic
1060896002 9:127218095-127218117 ATCCTCCCACAGCAGTGCTGAGG + Intronic
1061621323 9:131813059-131813081 TCCTTCCCACAGAAGAGTTGAGG + Intergenic
1062244535 9:135558195-135558217 ATCTCCCCAGAGAAGATCTATGG - Intergenic
1062390961 9:136333693-136333715 ATCTTCCCACAGCAGCGCTGGGG + Intronic
1188280987 X:28269174-28269196 GTCTTCCCAAAGCAGAACTTAGG - Intergenic
1188443655 X:30235063-30235085 CTCTTCCCTCTGCAGAACTGGGG - Intronic
1193407672 X:81122184-81122206 ATCCTGCCAAAGCAGAACTGTGG + Intronic
1193449512 X:81648193-81648215 ATGTTCCCATAGAAAAACTTTGG - Intergenic
1198245184 X:134824243-134824265 ATTTTGCCTCAGAAAAACTGAGG - Intronic
1198412815 X:136388988-136389010 AACCTCCCACAAAAGAAATGTGG - Intronic
1199253803 X:145695596-145695618 TTCTTTCCCCAGAAGAAGTGGGG + Intergenic
1199848421 X:151708176-151708198 CACTTCCCACAGAAGAACCCTGG - Intergenic