ID: 1085532739

View in Genome Browser
Species Human (GRCh38)
Location 11:77201607-77201629
Sequence CCACTGTCACCATGCCACCG CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 118
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 109}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085532735_1085532739 1 Left 1085532735 11:77201583-77201605 CCACCGACAGTGTGTACGTCATG 0: 1
1: 0
2: 0
3: 2
4: 29
Right 1085532739 11:77201607-77201629 CCACTGTCACCATGCCACCGCGG 0: 1
1: 0
2: 0
3: 8
4: 109
1085532732_1085532739 22 Left 1085532732 11:77201562-77201584 CCAAGCAGCGTGGGGACTTCCCC 0: 1
1: 0
2: 0
3: 11
4: 135
Right 1085532739 11:77201607-77201629 CCACTGTCACCATGCCACCGCGG 0: 1
1: 0
2: 0
3: 8
4: 109
1085532734_1085532739 2 Left 1085532734 11:77201582-77201604 CCCACCGACAGTGTGTACGTCAT 0: 1
1: 0
2: 0
3: 13
4: 224
Right 1085532739 11:77201607-77201629 CCACTGTCACCATGCCACCGCGG 0: 1
1: 0
2: 0
3: 8
4: 109
1085532736_1085532739 -2 Left 1085532736 11:77201586-77201608 CCGACAGTGTGTACGTCATGCCC 0: 1
1: 0
2: 1
3: 4
4: 80
Right 1085532739 11:77201607-77201629 CCACTGTCACCATGCCACCGCGG 0: 1
1: 0
2: 0
3: 8
4: 109
1085532733_1085532739 3 Left 1085532733 11:77201581-77201603 CCCCACCGACAGTGTGTACGTCA 0: 1
1: 0
2: 0
3: 1
4: 39
Right 1085532739 11:77201607-77201629 CCACTGTCACCATGCCACCGCGG 0: 1
1: 0
2: 0
3: 8
4: 109

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085532739 Original CRISPR CCACTGTCACCATGCCACCG CGG Exonic
900473007 1:2863766-2863788 CCACTGGCACCAGGACACCACGG - Intergenic
900599648 1:3497538-3497560 CCCCTGCCACCTTGCCACCGGGG - Intronic
901984194 1:13060979-13061001 GCACTGTCACCATGCTACATCGG - Intronic
901997617 1:13165791-13165813 GCACTGTCACCATGCTACATCGG + Intronic
902807819 1:18871977-18871999 CCTGTGTCACCATGGCACAGTGG + Exonic
902821859 1:18948385-18948407 CCACTGTCCCCATTCCCACGTGG + Intronic
906727517 1:48054831-48054853 CCAGTGTCACCATGCTGCCTAGG - Intergenic
908774307 1:67625556-67625578 CCACTGGGAACAGGCCACCGGGG + Intergenic
909183082 1:72449837-72449859 TTACTGCCACCATGCCACCTAGG + Intergenic
911095300 1:94049972-94049994 CCACTGTCACCAGGCATCCAAGG + Intronic
917449590 1:175136043-175136065 CCTCTGTCTCCCTGCCACTGGGG - Intronic
919368881 1:196700725-196700747 CCAGTGCCCCCATGCCACTGGGG + Intronic
920232664 1:204480870-204480892 CCACTGTCCCTGTGCCATCGTGG + Intronic
1066562890 10:36689691-36689713 CCTCTGTCACCAACCCACCAGGG - Intergenic
1067343860 10:45424262-45424284 TCGCTGCCACCATGCCACCCTGG + Intronic
1070911855 10:80125930-80125952 CCACTGCCACCATGGCTCCCGGG + Intergenic
1075926420 10:126255002-126255024 CCCCTGTCCAAATGCCACCGGGG - Intronic
1082614443 11:55341331-55341353 CTAATGTCACCATGACATCGAGG + Intergenic
1082703659 11:56465681-56465703 CCACTTTCACTATGCCACCTTGG + Intergenic
1085083307 11:73650723-73650745 CCACAGTCACGGTGCCACAGAGG - Intronic
1085532739 11:77201607-77201629 CCACTGTCACCATGCCACCGCGG + Exonic
1098461467 12:70737116-70737138 CCACTGACTCCAGGCCACCCAGG - Intronic
1102036001 12:109770880-109770902 CCACTGCCACCATGGCCCCTTGG - Intergenic
1102650263 12:114437125-114437147 ACACTGCCACCCTGTCACCGTGG - Intergenic
1104711961 12:130993650-130993672 TCACTGTCCCCATGTCACAGTGG - Intronic
1104858202 12:131911695-131911717 CCACTCTCACCATGCAGCCTGGG - Intronic
1106511866 13:30419869-30419891 CCACTGTCCCCATGCCCCAAAGG + Intergenic
1113892204 13:113742396-113742418 CCTCTGTCACCATGTGACCGGGG - Intergenic
1116267157 14:42707313-42707335 CCAGTGTCTCCATGTCACTGAGG - Intergenic
1117742019 14:58828343-58828365 CCACGGTCTCCATGCTTCCGGGG + Intergenic
1118862702 14:69677088-69677110 CCACTGTCCCCATTCCTCCTTGG - Intronic
1119702608 14:76765531-76765553 CCACTGGCACCCTGGCACCCAGG - Intronic
1122581754 14:102776081-102776103 CCACACTCACCAGGCCACAGTGG - Intergenic
1125262387 15:37842106-37842128 CCACTATCAACATCCCACAGTGG + Intergenic
1126872245 15:53002234-53002256 CCACTGTCACTGTGTCACCCAGG + Intergenic
1128646600 15:69383170-69383192 CTACTGTCTCCATTCCCCCGCGG - Intronic
1129842044 15:78749912-78749934 CCACTGTCAGCACGCCCACGGGG - Intergenic
1131573937 15:93567431-93567453 CCAGTCTCACCAGGCCACCTGGG + Intergenic
1132934140 16:2472523-2472545 CGACTGTCGGCATGGCACCGAGG + Exonic
1139940461 16:70601750-70601772 CCTCTGTCCCCATCCCACCTGGG - Intronic
1141482830 16:84318298-84318320 CCATTGCCACCAAGCCATCGAGG - Exonic
1143158010 17:4850992-4851014 CCCCTGTCAGCCTGCCTCCGAGG + Intronic
1146054013 17:29572377-29572399 CCACTGTCTCCCTGCTGCCGGGG + Exonic
1151882801 17:76905092-76905114 CCCCTGTCCCCAGGCCAGCGGGG + Intronic
1152760615 17:82105411-82105433 CCACTGTCAGCACGGCACCCAGG + Intronic
1154326095 18:13391390-13391412 CCCCTGTCCCCATGCCACGTTGG + Intronic
1156262556 18:35458896-35458918 CCTCTGTCACCAATCCACAGTGG - Intronic
1156349854 18:36294928-36294950 CATCTGTCACCATGGCACCATGG - Intergenic
1156489779 18:37489321-37489343 CCACAGTCACCATGCCCCCAGGG - Intronic
1157402713 18:47401178-47401200 CCACAGTCATCCTCCCACCGGGG + Intergenic
1157403005 18:47402304-47402326 CCACAGTCATCCTCCCACCGGGG + Intergenic
1157403137 18:47402807-47402829 CCACAGTCATCCTCCCACCGGGG + Intergenic
1157689246 18:49667602-49667624 CCACTGTGACCATGTGACCTTGG + Intergenic
1159390938 18:67790924-67790946 GGACTGTGACCATGCCACCTTGG + Intergenic
1159832094 18:73289254-73289276 CCTCTGTCACCCTGTCACCCAGG - Intergenic
1160430738 18:78810906-78810928 TCACGGTCACCAAGCCGCCGGGG - Intergenic
1163440580 19:17320660-17320682 GTACTGTCACCATGCCTCAGGGG - Exonic
1164755578 19:30686513-30686535 CCCCTGGCACCGTGGCACCGTGG + Intronic
925288943 2:2733920-2733942 CCACTCTCTCCAAGCCACCAGGG + Intergenic
935245314 2:101213983-101214005 GCACTGACATGATGCCACCGTGG - Intronic
937016209 2:118608362-118608384 CCATCATCACCATGCCACTGAGG + Intergenic
937745120 2:125403253-125403275 CCACTGTCACCTTGTCATGGAGG + Intergenic
940219278 2:151334849-151334871 CCACGGCCACCATGAAACCGTGG - Intergenic
943026231 2:182632593-182632615 CCACTGTTACCATGCCCCACTGG + Intergenic
946938121 2:224742892-224742914 CCACTGTTACCAAGACACCAGGG - Intergenic
947425866 2:229982381-229982403 TCACTCTCACCTTGCCTCCGTGG + Intronic
948700119 2:239754253-239754275 CCATCGTCACAATGCCACCCTGG - Intergenic
1168893302 20:1307876-1307898 ACACTGTGGCCATGCCACGGAGG + Exonic
1171368772 20:24646645-24646667 CCACTCTCACTCTGTCACCGAGG + Intronic
1176232781 20:64040550-64040572 CCACTGTCACATTGCCCCAGGGG + Intronic
1179578623 21:42323322-42323344 TCACTGTCATCTTGCCACAGGGG - Intergenic
1181773439 22:25143140-25143162 CCACTGTCTCCTTGGCACCTTGG - Intronic
1185152864 22:49176068-49176090 CCACTGGCACCTTGCCAGAGTGG - Intergenic
950074117 3:10175049-10175071 CCACTGTACTCATGCCACCTGGG + Intronic
950115797 3:10449696-10449718 CCACTGTCACCAGCCCGCCTCGG - Exonic
953795978 3:45986356-45986378 CCACTGCCACCTTGCCCTCGTGG + Intronic
955205645 3:56893516-56893538 CCACTGCCAGCATGGCACAGTGG + Intronic
957126237 3:76164876-76164898 ACACTGGAACCATGCCACAGAGG + Intronic
958076627 3:88689907-88689929 CCACTGAGACCATGCCACCAGGG + Intergenic
962841355 3:139235535-139235557 CCACCCCCACCATGCCACCCAGG - Intronic
971834672 4:31748164-31748186 CCACTTTCAACATGCCTCCACGG + Intergenic
975829917 4:78358025-78358047 CCACTGTCACCATCCCCCATTGG - Intronic
976337294 4:83905079-83905101 CCACTGTCACCATTTCTCCTCGG + Intergenic
984213103 4:176875176-176875198 CTATTGTCAACAAGCCACCGTGG - Intergenic
986311324 5:6553120-6553142 CCGCTGTCCCCATGCCATGGTGG - Intergenic
996565536 5:124876519-124876541 CAACTGTCACCAAACCACAGTGG + Intergenic
998273162 5:140725628-140725650 CCTCTGTCACCCTGTCACCCAGG - Intergenic
999270479 5:150293952-150293974 CAGCTGTCACAATGCCACTGGGG - Intergenic
1003381293 6:5626508-5626530 CCACTGTCAACTTGTCACCTGGG + Intronic
1003978286 6:11364950-11364972 CCTCTCTCACCCTGGCACCGGGG + Intronic
1005861555 6:29906414-29906436 CCACTGCCACCATGCACCCTGGG - Intergenic
1013873242 6:114793610-114793632 CCACTGTTACCATGCCAAAGAGG + Intergenic
1016130056 6:140456950-140456972 CCACTGTCACCATGGGAAAGAGG + Intergenic
1018183326 6:161243398-161243420 CCACCGTCACCAAGGCAACGTGG + Intronic
1018477935 6:164161348-164161370 TCACAGGCACCATGCTACCGTGG - Intergenic
1019170087 6:170128950-170128972 CCGCTGTCACCAGGTCACAGAGG - Intergenic
1024469796 7:49755892-49755914 ACACTGTCCCCATGTCACTGAGG - Intergenic
1026952454 7:74356611-74356633 CCACCCTCACCAGGCCACTGCGG - Exonic
1026991074 7:74586173-74586195 CATCTGTCCCCATGCCACTGAGG - Intronic
1032325073 7:130920313-130920335 CCACTGTATCAATGCCACTGTGG + Intergenic
1034441493 7:151087921-151087943 CGAAGGTCACCATGCCACCGGGG - Intronic
1035588696 8:796797-796819 CCACTGGCACCATGACAGCCAGG + Intergenic
1037719337 8:21429595-21429617 CACCTGTCACCATGTCACCTTGG - Intergenic
1038117274 8:24571665-24571687 CCACTGTCATCATCCCACTGGGG - Intergenic
1038384920 8:27134809-27134831 CCACAGACACCATGCCAGAGAGG + Intergenic
1045320981 8:101080984-101081006 CCACCGTCACCATGGCTACGCGG + Intergenic
1051561625 9:18447810-18447832 CTACTGTCACCAGGCCCCTGAGG - Intergenic
1055563298 9:77543227-77543249 CCACTGTGGGCATGCCACCAGGG + Intronic
1058683726 9:107462902-107462924 GCACTGTCTCCAAGCCACCAGGG + Intergenic
1059940655 9:119356240-119356262 CCAATGTCACCATCCCAGTGAGG + Intronic
1060492104 9:124092654-124092676 CCCCTGACACCAGGCCACTGTGG + Intergenic
1061034950 9:128108210-128108232 CCACTGCCCTCATGCCACAGTGG - Exonic
1061485973 9:130920705-130920727 CCAGTAGCACCAAGCCACCGTGG + Intronic
1061995818 9:134182287-134182309 TCACTGTCACTCTGCCACCCAGG - Intergenic
1190422877 X:50303116-50303138 ACACTGCCACCATTCCACAGTGG - Intronic
1192509577 X:71713910-71713932 CCACTGGCATCAAGCCACTGGGG + Intergenic
1192517120 X:71767643-71767665 CCACTGGCATCAAGCCACTGGGG - Intergenic
1197777297 X:130126899-130126921 CAACTGGTACCATGCCACCAAGG + Intergenic