ID: 1085533039

View in Genome Browser
Species Human (GRCh38)
Location 11:77202946-77202968
Sequence CACTCTCAGCCTCTGGACAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 258
Summary {0: 1, 1: 0, 2: 0, 3: 23, 4: 234}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085533029_1085533039 20 Left 1085533029 11:77202903-77202925 CCTCGGGTCACATGCAGGGCAGG 0: 1
1: 0
2: 2
3: 41
4: 304
Right 1085533039 11:77202946-77202968 CACTCTCAGCCTCTGGACACAGG 0: 1
1: 0
2: 0
3: 23
4: 234

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085533039 Original CRISPR CACTCTCAGCCTCTGGACAC AGG Intronic
900033851 1:390849-390871 CACTCTCAGGTTGTTGACACAGG - Intergenic
900054686 1:620739-620761 CACTCTCAGGTTGTTGACACAGG - Intergenic
900285833 1:1899859-1899881 CACTCTCAGCCTGAGGATGCTGG - Intergenic
900319028 1:2073390-2073412 CATTCACAGCCTCTGGACGCAGG + Intronic
900986511 1:6076304-6076326 CACTCTCAGCCAGTGCTCACAGG + Intronic
901049049 1:6417133-6417155 CAGTCTAACCCTCTGGGCACAGG + Exonic
901120417 1:6887559-6887581 CTCTCTCTGCCTCTGGAAATGGG + Intronic
901122347 1:6906016-6906038 AACTCTGAGGCTCTGGCCACAGG + Intronic
901144537 1:7056151-7056173 CACTCCTAGCCTCTGGCCCCGGG - Intronic
901978454 1:13014165-13014187 CACTGTCAGTCCATGGACACAGG + Intronic
902003629 1:13214773-13214795 CACTGTCAGTCCATGGACACAGG - Intergenic
902393292 1:16118772-16118794 CAATCCCAGCATCTGGGCACAGG - Intergenic
902760476 1:18577495-18577517 CACTTCCAGCCTCTGGAGAAGGG + Intergenic
903543725 1:24110907-24110929 AACTCTCAGCCACTGGAGCCAGG - Intronic
903764833 1:25727515-25727537 CACCCCCAGCCTCTGGAGCCTGG - Intronic
904520306 1:31090033-31090055 CACTCACAGCCCCTGGCCCCTGG - Intergenic
906548243 1:46638088-46638110 CTCTCTCAGCCCCTGGCTACAGG + Intronic
908172232 1:61516782-61516804 CAGACTCAGCCTGTGGAGACTGG + Intergenic
909040537 1:70644383-70644405 CACTCACAGCATCTTTACACAGG + Intergenic
913219016 1:116644575-116644597 CACTTGCAGCCCATGGACACTGG - Intronic
915885007 1:159713041-159713063 CAGTCTCAGAATCAGGACACTGG - Exonic
919621750 1:199871438-199871460 CCCTCACACACTCTGGACACAGG + Intergenic
919912879 1:202122808-202122830 CCCTCCCAGCCTCCGGCCACAGG - Intergenic
920597166 1:207283703-207283725 CACTCTCACTGTATGGACACAGG + Intergenic
922256208 1:223895005-223895027 CACTCTCAGGTTGTTGACACAGG - Intergenic
924337414 1:242997871-242997893 CACTCTCAGGTTGTTGACACAGG - Intergenic
1065207317 10:23369704-23369726 CCCTCTCTCCCTCTGGACATTGG - Intergenic
1065898137 10:30182471-30182493 CACTGTAAGACTCAGGACACGGG + Intergenic
1067093596 10:43284389-43284411 GACTCTCAGCTTCAGGGCACAGG - Intergenic
1067772920 10:49140024-49140046 CACTGTCAGCCTCTGGGTCCTGG - Intergenic
1069708241 10:70472681-70472703 GAGTCCCAGGCTCTGGACACTGG - Intergenic
1069934239 10:71904468-71904490 CACTCTCACCCTCTGTGCATGGG - Intergenic
1070919080 10:80172747-80172769 CACTCCCAGCCACTGTACAGAGG + Intronic
1070956586 10:80467779-80467801 CACACTCAGCGCCTGAACACTGG - Intronic
1072785054 10:98273610-98273632 CTGTCTCAGCAGCTGGACACAGG + Intergenic
1073122675 10:101131977-101131999 CACCCCCAGCCCCTGGCCACCGG + Exonic
1073208371 10:101780430-101780452 CACTCCCAGCCTCTAGTCAAGGG - Intergenic
1075523420 10:123160414-123160436 CCCTCTCAGTGTCTGGAGACCGG + Exonic
1076364815 10:129914905-129914927 TTCTCTCAGCCTCTGGCCACTGG - Intronic
1076403146 10:130196171-130196193 CTCTCCCAACCCCTGGACACTGG - Intergenic
1076589682 10:131574590-131574612 CACTCTCTGCCTCTGGGCAGGGG - Intergenic
1076593625 10:131609415-131609437 CACGCTCAGCCTCCGGGCACAGG + Intergenic
1077928586 11:6707248-6707270 CTGTCTCAGCCTCTGGATACAGG + Intergenic
1079633208 11:22703388-22703410 CACTCTCACCCTATGGAAAATGG + Intronic
1079996281 11:27298470-27298492 CAACCTCAGGCTCTGGATACTGG + Intergenic
1080825793 11:35847896-35847918 TGCTCACAGCCTCTTGACACAGG - Intergenic
1082825745 11:57576960-57576982 CTCTCTCAACTTGTGGACACTGG + Intergenic
1083282927 11:61638514-61638536 AACTCGGAGCCCCTGGACACTGG - Intergenic
1083418226 11:62539054-62539076 GACTCTGAGCCTCTGGGCTCAGG + Intronic
1083603345 11:63962164-63962186 CACCCTCCACCTCTGGGCACTGG + Intergenic
1083631321 11:64096947-64096969 CTCTCTCAGCGTCTGGGCCCGGG + Intronic
1083721156 11:64604164-64604186 CACCATCAGGCCCTGGACACTGG + Intergenic
1084383127 11:68826091-68826113 CACTCTCAGACTCTGGTCTGGGG - Intronic
1085533039 11:77202946-77202968 CACTCTCAGCCTCTGGACACAGG + Intronic
1085778306 11:79385815-79385837 CTCTCTTAGTCTGTGGACACAGG + Intronic
1086608019 11:88720419-88720441 CACTCTCAGCCTCTGGTACAAGG + Intronic
1087775437 11:102252567-102252589 CACTGTCTGCCTCTGTATACAGG + Intergenic
1087907679 11:103718051-103718073 CACTCTGAGCCTCTTAACAGGGG - Intergenic
1088914400 11:114216499-114216521 CAAGCCCAGCCTTTGGACACTGG + Intronic
1092163438 12:6328525-6328547 CCGCCTCAGCCTCCGGACACAGG - Intergenic
1096253698 12:50050544-50050566 CCCTCTCAGCCTCGGCTCACAGG - Intergenic
1096274301 12:50192414-50192436 CTCTCTGAGCCTTTGGACATTGG - Intronic
1096493800 12:52027484-52027506 CACTGGCAGCCTCTGGATGCTGG + Intronic
1096776999 12:53970329-53970351 CCCTCTCAGCCTGTGGATTCTGG - Intergenic
1097063374 12:56302176-56302198 TGCTCTAAGCCTCTCGACACTGG + Intronic
1101161118 12:101977371-101977393 CACCCACAGCCTCTGGATTCAGG - Intronic
1102742951 12:115224157-115224179 CACTCCCAGACTCTGGACTCGGG + Intergenic
1103781808 12:123403687-123403709 CACTCTCAGCCACGGGACCAGGG - Intronic
1105209000 13:18246936-18246958 CACTCTCAGCTTCTTAAAACTGG + Intergenic
1109883912 13:68517508-68517530 CACTCTCAGCCTCTGCCTTCAGG + Intergenic
1110378419 13:74820999-74821021 CACTCTTGGCCTCTGGAGAGGGG - Intergenic
1111870863 13:93830493-93830515 CACAGTCAGCCCCTGGACAAAGG - Exonic
1112967210 13:105211592-105211614 GTTTCTCAGCATCTGGACACTGG - Intergenic
1113657369 13:112075855-112075877 CATCCTCAGCACCTGGACACAGG - Intergenic
1113960906 13:114125658-114125680 CTCACTCAGCCACTGGCCACAGG + Intronic
1117282003 14:54250679-54250701 CACTCACAAGCTGTGGACACTGG - Intergenic
1121537032 14:94697976-94697998 CACACTCTGCCTCTGTAAACAGG + Intergenic
1121906972 14:97755024-97755046 AATTCTCAGCCTCTCGACAATGG - Intronic
1128622527 15:69161845-69161867 CACGCTCAACCTGCGGACACCGG - Intronic
1128683655 15:69668472-69668494 CACACTCAGACTCTGCACTCTGG - Intergenic
1129706214 15:77796004-77796026 CCCTCTCTGCCTGTGGGCACTGG + Intronic
1130075533 15:80686025-80686047 CACTCTCAGTCTCAGGCCAAAGG + Intronic
1131722702 15:95188073-95188095 CCTTCACAGCCTTTGGACACTGG + Intergenic
1131797483 15:96034525-96034547 CACTCACAGACTGGGGACACTGG - Intergenic
1132888125 16:2191335-2191357 CAGTCCCAGCCACTGGACACAGG + Intronic
1136398160 16:30004247-30004269 CCCTCCCAGCCTCAGGACACTGG - Intronic
1138451722 16:57097288-57097310 CACACTCAGGCTCTGGGCATAGG - Intronic
1143759456 17:9090589-9090611 CACTCTCAGCCTTTATAAACCGG - Intronic
1144065146 17:11618063-11618085 CACTCTCCTCCTCTGTACAATGG + Intronic
1146412725 17:32601678-32601700 CACTTTATGTCTCTGGACACTGG - Intronic
1146457467 17:33018791-33018813 GACTCTCAGTCTCTGGAAAGAGG + Intronic
1146505440 17:33400716-33400738 AATTCTCAGCCCCTGGACAGTGG - Intronic
1148162109 17:45456158-45456180 CACTCTCTACCTCTGTAGACAGG + Intronic
1150393342 17:64802806-64802828 CACTCTCTACCTCTGTAGACAGG + Intergenic
1151390352 17:73782886-73782908 CACCCACAGCCTCTGGAAGCAGG + Intergenic
1152162452 17:78677320-78677342 GACACTCTGCCTCTGCACACAGG - Intronic
1152367233 17:79863318-79863340 GGCTCTCAGCCCCTGGACACGGG - Intergenic
1152435867 17:80275622-80275644 CTCTCTCAGTCTCTGTAGACTGG - Intronic
1152701894 17:81823509-81823531 CACTCTCTGCCTCTGCAGCCTGG - Exonic
1153042363 18:825611-825633 CTCTCTCAGCCTCTCGAAGCTGG - Intergenic
1153732647 18:8029830-8029852 CAATCTCATCCTGTGGACATTGG - Intronic
1155098685 18:22586559-22586581 GACTCTCAGCCTGTGGAGACTGG - Intergenic
1155250409 18:23948356-23948378 CAGTGTCTGCCTCTGAACACCGG + Intronic
1155498357 18:26464267-26464289 TTCTCGCAGCCTCTGGACGCTGG - Intronic
1158435237 18:57430666-57430688 CACTCTCGGCGTCTGGACTTCGG + Intergenic
1159108365 18:64028456-64028478 CACTCACAGCCTCAGGTCGCTGG + Intergenic
1160290577 18:77589621-77589643 CACACTCAGCCTCCTGACCCAGG + Intergenic
1160497214 18:79382727-79382749 CACTCACAGCCCCTGACCACCGG - Intergenic
1160988880 19:1852577-1852599 CTCTCCAAGCCCCTGGACACTGG + Exonic
1160989571 19:1855071-1855093 CCCTCGCAGCCTCTGGCCCCAGG + Intronic
1161021478 19:2013559-2013581 CACTGCCAGGCTCTGGACCCTGG - Intronic
1161459533 19:4388630-4388652 CACTCCCAGCCTCCAGAAACTGG - Intronic
1163035152 19:14565596-14565618 CACTCTCCGCCCCTGCCCACAGG + Exonic
1164833505 19:31340887-31340909 CCTTCACAGGCTCTGGACACAGG + Intronic
1165161761 19:33820603-33820625 CACTGTCAGCCTCCGGCCTCTGG - Intergenic
1168165846 19:54547088-54547110 CTCTCTGAGCCTCTGCACACAGG + Intergenic
1168292390 19:55362883-55362905 CCCTCTCAGCCCCGGGGCACTGG + Intronic
925306636 2:2851468-2851490 CACGCACAGCCTCTGGAGACAGG + Intergenic
925497541 2:4469119-4469141 CACTCTCAGCGTCTGAAGATGGG - Intergenic
926155688 2:10452661-10452683 AACTCTCAGCCTCCAGACAAGGG - Intergenic
926542300 2:14196547-14196569 CAATCCCAACCCCTGGACACTGG + Intergenic
926586809 2:14695586-14695608 CAAGCTCAGCCTCTGGGCTCTGG + Intergenic
928121632 2:28587940-28587962 CCCTCCCAGCCTCTGCAGACAGG + Intronic
934097936 2:88624794-88624816 CAGTCTCAATCTCTGGACAAGGG + Intronic
934809459 2:97267529-97267551 CACTGTCAGCCTGAGAACACCGG - Intergenic
934810002 2:97269803-97269825 CTCTGTCAGCCCCAGGACACTGG - Intergenic
934827690 2:97438136-97438158 CTCTGTCAGCCCCAGGACACTGG + Intergenic
936958202 2:118044652-118044674 GACTCTCACCCTCTGCACTCAGG - Intergenic
937927007 2:127175236-127175258 CCCTCCCAGCCTCTGGACAGGGG - Intergenic
938721426 2:134070446-134070468 CATTATCATCCTCTGGACAGAGG + Intergenic
938952550 2:136268585-136268607 CACTATCAGCCTGTAGACATGGG + Intergenic
939243827 2:139597079-139597101 CTGCCTCAGCCTCTGTACACTGG - Intergenic
941160191 2:162026648-162026670 CACTCTCAGCCCCTGCAGCCTGG - Intronic
943278040 2:185893419-185893441 CTCTCTCAGTCACTGGACTCTGG + Intergenic
944350230 2:198717856-198717878 CACTCTCAGCCACTATACACCGG - Intergenic
946108801 2:217396072-217396094 CTCTCTCTGACTCTGGAAACTGG + Intronic
946246549 2:218391137-218391159 CACGCTCAGCCTTGGGAAACTGG - Intronic
947858631 2:233342305-233342327 CACCCTCAGCCTGAGGACCCAGG + Exonic
948414134 2:237789292-237789314 CACCCTCGACCTCTGGACTCAGG - Intronic
948415093 2:237797365-237797387 CACCCTCAGCCCCTGGCCCCTGG + Intronic
948487812 2:238291796-238291818 CACCCTGAGACCCTGGACACAGG - Intergenic
1168805242 20:668932-668954 CTCTCTGGGCCTCTGGGCACAGG - Intronic
1169338308 20:4775852-4775874 AACATTCACCCTCTGGACACTGG - Intergenic
1170554799 20:17506240-17506262 CCCTAACAGCCTCTGGACAAGGG + Intronic
1172569941 20:35962150-35962172 CACCGTCACCCTCTGGCCACTGG + Intronic
1173270294 20:41527932-41527954 CTCTCTCTGCCTTTGGCCACAGG + Intronic
1173708039 20:45128061-45128083 CAACCTCAGCCTCTAGACACTGG - Intergenic
1173869164 20:46330886-46330908 CCCTTCCAGCCTCTGGCCACAGG - Intergenic
1174088827 20:48030337-48030359 CACTCTCAGCCTCTGGATTGGGG + Intergenic
1174127209 20:48315490-48315512 CACTCTCAGCCTGTGGACTGGGG - Intergenic
1174281020 20:49439335-49439357 AACTCTCAGCCTCTGGTGATTGG + Intronic
1179024374 21:37667714-37667736 CATTCTCTGCCTCTGATCACAGG + Intronic
1179360716 21:40705784-40705806 CCCTATCAGCCTCAGGACACTGG + Intronic
1179793160 21:43767259-43767281 CCCTCTCTGCGTCTGGACATGGG + Intergenic
1179809900 21:43864385-43864407 CCCTCTCAGCCCCAGGACAGCGG - Intergenic
1181206532 22:21257103-21257125 CACTTGCAGCCCATGGACACTGG - Intergenic
1181316637 22:21974920-21974942 CTTTCTCAGCTTCTGGGCACCGG + Intronic
1181984369 22:26789392-26789414 CACCCTCATCCTCCAGACACTGG + Intergenic
1182071311 22:27465675-27465697 CACTCTCCCCCTCTCCACACTGG - Intergenic
1182119088 22:27775317-27775339 CACTCCCACCCTCTGGAGTCTGG - Intronic
1183067021 22:35370330-35370352 CAAGCTCAGCCACTGGAAACGGG + Intergenic
1183342430 22:37288969-37288991 CACCCTAAGCCTCTGGATAGTGG + Intronic
1183687486 22:39369547-39369569 GACTCTCAGCCTCTGGAGGTGGG - Intronic
1184433637 22:44456728-44456750 CCCTCTGAGCCTCTGGAAAGAGG - Intergenic
1185193089 22:49451273-49451295 CAGTGTCTGCCTCTGGCCACCGG + Intronic
1203220388 22_KI270731v1_random:38320-38342 CACTTGCAGCCCATGGACACTGG + Intergenic
1203270437 22_KI270734v1_random:48506-48528 CACTTGCAGCCCATGGACACTGG - Intergenic
950040429 3:9916235-9916257 CACTCTGAGGCTCTGGCCAGAGG + Exonic
951337521 3:21442779-21442801 AACTCCCAGCCTCTGTACTCTGG - Intronic
952083388 3:29788077-29788099 CAGGAGCAGCCTCTGGACACAGG - Intronic
954025130 3:47777155-47777177 CACTTGCAGCCTCTGCCCACCGG + Intronic
954664985 3:52246797-52246819 CACTCACCTCCTCTGGGCACAGG - Exonic
954754086 3:52829622-52829644 CACACTCAGCCTTTGGGCAGGGG + Intronic
955667711 3:61368043-61368065 CATCCTCAGGCTCTGGAGACTGG + Intergenic
959027106 3:101252436-101252458 CACTCCCTGCCACTGGACCCTGG + Intronic
960156902 3:114305674-114305696 CACTCCCAGCATCTGGAAAATGG + Intronic
962058360 3:131898692-131898714 AACCATCAGCCTCTGGTCACAGG + Intronic
964772671 3:160240305-160240327 CACTCACATCCTCTGAGCACGGG + Intronic
965199821 3:165643263-165643285 CACTCTAGGCCTCTGGCCAAAGG - Intergenic
967825295 3:193872671-193872693 CAGTTTCAGCCTCTGGAAATGGG + Intergenic
967834490 3:193949603-193949625 CACACTCAGCCTCTGGTGCCAGG + Intergenic
970424459 4:15933573-15933595 CACTCCTGGCCTCTGGTCACTGG - Intergenic
973631489 4:52824788-52824810 CACTCACTGCCTCTGCACACAGG - Intergenic
974073229 4:57144911-57144933 CAATCTCCGCCTCCGGACTCAGG + Intergenic
979239718 4:118437437-118437459 CACTCTCAGGTTGTTGACACAGG + Intergenic
980009673 4:127581313-127581335 GTTTCTCAGGCTCTGGACACTGG - Intergenic
982026709 4:151258839-151258861 CACTCCCTGCCCCTGGACTCAGG - Intronic
990506346 5:56449162-56449184 CTCTCTGAGCCTCAGGCCACAGG - Intergenic
993229637 5:85217292-85217314 TTCTCTCAGACTCAGGACACTGG - Intergenic
993661667 5:90645191-90645213 CAGTCTCAGCACCGGGACACGGG + Intronic
993903584 5:93600662-93600684 CACTCAAAGCCTCTGGGTACGGG + Intergenic
997629431 5:135355672-135355694 CACTGTCAGCTTCTGCCCACTGG - Intronic
998099910 5:139424138-139424160 CACTCTCAGGCACTGTAGACTGG + Intronic
998161570 5:139815515-139815537 CACACTCAGCCCCTCCACACTGG + Intronic
999672348 5:153968958-153968980 CACTCTCAACCACTGGAGAGGGG + Intergenic
1000834267 5:166135201-166135223 CACTCTCGGCCTCTGTTCAGAGG - Intergenic
1002739969 5:181428019-181428041 CACTCTCAGGTTGTTGACACAGG + Intergenic
1005019327 6:21402430-21402452 CACTCTCACCCCCAGGACTCTGG - Intergenic
1005111768 6:22289783-22289805 CACTCTCATCCTCTGGCGAGGGG + Intronic
1006153412 6:32001397-32001419 CAGTCTCACCCTCAGCACACTGG - Exonic
1006159720 6:32034134-32034156 CAGTCTCACCCTCAGCACACTGG - Exonic
1006517988 6:34555329-34555351 CACTCTGAGCCCTTGGACACTGG - Intronic
1007485038 6:42175073-42175095 CCCTCCCAGTCTCTGTACACAGG - Intronic
1007688024 6:43678878-43678900 CCCTCTCTCCCTCTTGACACTGG - Intronic
1008039918 6:46786511-46786533 CACTCCCAACCTTTGGCCACTGG + Intergenic
1008592967 6:53011870-53011892 CCCTCTGAGCCTGTGGGCACAGG - Exonic
1010248959 6:73688647-73688669 CACCCTCATCCTCTGGAGAGGGG + Intergenic
1015250602 6:131123833-131123855 CTCTTTCAGCCTCTAGGCACAGG + Intergenic
1017719343 6:157234053-157234075 CCCTCTCAACCTCTGAAGACTGG - Intergenic
1019245081 6:170703619-170703641 CACTCTCAGGTTGTTGACACAGG + Intergenic
1019324697 7:432363-432385 GAGGCTCAGCCTCGGGACACAGG + Intergenic
1019380270 7:718033-718055 CACCCTCAGCTCCTGGCCACGGG - Intronic
1019699731 7:2468838-2468860 TCCTCTCAGCCCCTGGACTCAGG + Intergenic
1020720660 7:11740546-11740568 CCCCCTCAGCAGCTGGACACAGG + Intronic
1024081410 7:45859175-45859197 CACTCACAGCTTCTGGAGACTGG - Intergenic
1024207134 7:47173395-47173417 CAGTCTCAGAAGCTGGACACAGG - Intergenic
1025189695 7:56887276-56887298 CACTCACAGCCTCTAGACCTGGG + Intergenic
1029164385 7:98576766-98576788 CACTGTCACCCCCAGGACACAGG - Intergenic
1029419950 7:100467257-100467279 GTCCCTCATCCTCTGGACACTGG - Intronic
1030488864 7:110206191-110206213 TACTCTCTGCCTCTGGAAGCTGG + Intergenic
1031374967 7:121013187-121013209 CACATTGAGCCTTTGGACACAGG - Intronic
1032841617 7:135718617-135718639 CACTTTCAGCCTTTGGTCATTGG + Intronic
1033271464 7:139936561-139936583 CAAGCTCTGTCTCTGGACACAGG - Intronic
1034238354 7:149590340-149590362 CACTTTCACCCTCTGCACAGTGG + Intergenic
1034241446 7:149614333-149614355 CACTTTCACCCTCTGCACAGTGG + Intergenic
1035203780 7:157281875-157281897 GACTATCAGCCTCTGGCCACAGG + Intergenic
1035236086 7:157498392-157498414 CACTCTCAGCCTGGAGACATCGG + Intergenic
1038771872 8:30490101-30490123 CACGCCCAGCCTCTGTATACTGG + Intronic
1039710907 8:40055221-40055243 CACTGTCACTCTCTGGGCACTGG - Intergenic
1047500441 8:125436294-125436316 CATTCGCAGCCTCTTGAGACGGG + Exonic
1048157803 8:131977348-131977370 CACTCACAGTCTCTGGGCCCAGG - Intronic
1049320024 8:141991351-141991373 CACGCTCAGCCTCAGGCCAGAGG + Intergenic
1049659014 8:143811456-143811478 CCCTCACAGCCCCTGGAGACCGG + Intronic
1052978220 9:34427791-34427813 CACTGTAAGCCTCTGGTCAGGGG + Intronic
1054931786 9:70642641-70642663 AATTCCCAGCCTCTGGACATTGG - Intronic
1055847659 9:80586801-80586823 CACTCTCAGCAACTAGACACTGG + Intergenic
1056432986 9:86547149-86547171 CAATCTCAGTGTCTGAACACAGG + Intergenic
1056807631 9:89741056-89741078 TATTCACAGACTCTGGACACAGG - Intergenic
1057114319 9:92506212-92506234 CACCCTCAGTCTCTGAACAAGGG + Intronic
1060072930 9:120565869-120565891 GACTGTGAGCCTCTGGACAGGGG + Intronic
1060214260 9:121729151-121729173 CAGTTTCATCCTCTGTACACAGG - Intronic
1060553073 9:124494838-124494860 CCCTCTGAGCCTCTGGTCCCAGG - Intronic
1060785972 9:126451801-126451823 AACCCACAGCCTCTGGTCACAGG + Intronic
1061263871 9:129494591-129494613 GCCTCTCAGCCTCTGGCCTCCGG - Intergenic
1061302372 9:129712887-129712909 CTCTCTAAGCCTCAGGCCACTGG - Intronic
1061360062 9:130135706-130135728 CACTCTCAGCATCTGGAATAAGG - Exonic
1061367132 9:130177915-130177937 CACTTTCCGCCTCTGGAAAATGG + Intronic
1062555190 9:137110641-137110663 CAGACTCAGCCTCTGAGCACAGG - Exonic
1203605276 Un_KI270748v1:52827-52849 CACTCTCAGGTTGTTGACACAGG + Intergenic
1186826276 X:13343212-13343234 CACTCTCTCCCTCTGGATCCAGG - Intergenic
1190657035 X:52621724-52621746 CAGTCTCAACATCTGCACACTGG + Intergenic
1192220666 X:69195467-69195489 CACTCCCACCCTCTGGCCCCAGG + Intergenic
1193947291 X:87754383-87754405 CACTCACAGCCTGTGTATACTGG - Intergenic
1199740449 X:150730810-150730832 CCCACTCACCCTCTGGAAACAGG - Intronic
1200068157 X:153514808-153514830 CCCTCTCAGCCTCAGGGCTCTGG + Intergenic
1200115214 X:153766983-153767005 CACTCTCAACCACTTGGCACTGG + Exonic
1202387459 Y:24339267-24339289 CACTCTCAGGTTGTTGACACAGG + Intergenic
1202483327 Y:25330861-25330883 CACTCTCAGGTTGTTGACACAGG - Intergenic