ID: 1085533847

View in Genome Browser
Species Human (GRCh38)
Location 11:77206604-77206626
Sequence CCTCAGGTGGAGAGGGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 784
Summary {0: 1, 1: 1, 2: 5, 3: 76, 4: 701}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085533847_1085533860 17 Left 1085533847 11:77206604-77206626 CCTTCCTCCCTCTCCACCTGAGG 0: 1
1: 1
2: 5
3: 76
4: 701
Right 1085533860 11:77206644-77206666 ATCCAGGTCCTGTCTGCCAAAGG 0: 1
1: 0
2: 0
3: 7
4: 159
1085533847_1085533856 1 Left 1085533847 11:77206604-77206626 CCTTCCTCCCTCTCCACCTGAGG 0: 1
1: 1
2: 5
3: 76
4: 701
Right 1085533856 11:77206628-77206650 GGTTGAGGTTCCCTCCATCCAGG 0: 1
1: 0
2: 0
3: 8
4: 100

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085533847 Original CRISPR CCTCAGGTGGAGAGGGAGGA AGG (reversed) Intronic
900225874 1:1533437-1533459 GCTCAGGAGGACAGGGAGGTGGG + Intronic
900300378 1:1973951-1973973 CCCCTGGGGGAGAGGGCGGAGGG + Intronic
900343716 1:2200861-2200883 CTGCAGGTGGAGAGGGTGGCTGG + Intronic
900509001 1:3049361-3049383 CCTCAGGTTGGGAGCAAGGAGGG - Intergenic
900544531 1:3221048-3221070 AGTGAGGTGGAGAGGGGGGACGG + Intronic
900627222 1:3613966-3613988 CCCCAGGTGGAGAGGCAGGCAGG + Intergenic
900802711 1:4747324-4747346 GGTGAGGTGGAGAGGGGGGATGG - Intronic
901856138 1:12045311-12045333 CTTGAGGTGGAGTGGGGGGAAGG + Intergenic
902691538 1:18112937-18112959 AAGGAGGTGGAGAGGGAGGATGG - Intronic
902762284 1:18590028-18590050 CACCAGGAGGAGAAGGAGGAGGG - Intergenic
902793265 1:18783624-18783646 CAAAGGGTGGAGAGGGAGGAGGG + Intergenic
902838291 1:19060302-19060324 TCTGTGGTGGAGAGGGAGGTGGG - Intergenic
903261834 1:22135817-22135839 CCTCAGGCGGAGAGAGAGAACGG + Intronic
903765475 1:25731634-25731656 CCTGTGTTAGAGAGGGAGGAAGG - Intronic
903878546 1:26492865-26492887 CCACAGGTGGTGTGGGAGCAGGG - Intergenic
903919136 1:26787369-26787391 CCTCAGGTGGCTAATGAGGATGG - Intergenic
903972770 1:27129878-27129900 CCTCAGCTGTAGAATGAGGAGGG - Intronic
904162308 1:28530801-28530823 CATCCAGTGGAGAGGCAGGAGGG - Intronic
904211756 1:28890523-28890545 CCTCACGTGGAGTGAGAGTAGGG - Intronic
904333712 1:29784036-29784058 ACCCATGTGGTGAGGGAGGAGGG - Intergenic
904418858 1:30378750-30378772 ACTGAGGTGCAGAGGGAGAAGGG + Intergenic
904456380 1:30650620-30650642 CCCCAGGTGGGGAGAGAAGAGGG - Intergenic
904615001 1:31744806-31744828 CCTCAGGCGGAGGGCAAGGAAGG - Intronic
905082880 1:35340353-35340375 CGTCAGAGGGAGAGGCAGGATGG + Intronic
905105586 1:35561778-35561800 TCTCAGGCGGGGAGGCAGGAGGG - Intronic
905276144 1:36819451-36819473 CCTCAGCTGGAGCAGGAGGTGGG + Intronic
905340302 1:37273474-37273496 CCTCAGGTGGCTTGGGAGGTTGG - Intergenic
906015981 1:42580014-42580036 TCTCTGGTGGAGAGGGATGAGGG + Intronic
906078671 1:43069501-43069523 GCTCAGGGGAGGAGGGAGGATGG + Intergenic
906191793 1:43903655-43903677 CCCTGGGAGGAGAGGGAGGAGGG + Intronic
906383029 1:45344877-45344899 CCTGAGGTGGAGAAGGTGGCTGG + Exonic
906403393 1:45521955-45521977 CCGGAGGAGGAGAGAGAGGAGGG + Intronic
906607203 1:47180891-47180913 GCTCAGGTGGAGGAGGAGAAAGG + Intergenic
906735817 1:48126041-48126063 ACTGAAGTGGAGAGGGAGGGAGG + Intergenic
908118116 1:60961002-60961024 CATGAGGTTGACAGGGAGGAGGG + Intronic
908774521 1:67627308-67627330 TCTCAGCAGGAGAAGGAGGATGG + Intergenic
909009458 1:70318330-70318352 CTTCAGTCGGAGAAGGAGGAAGG - Intronic
909228080 1:73051227-73051249 ACTCAGGAGGGGAGGGTGGATGG + Intergenic
909513593 1:76482873-76482895 CCTCTGGTGGGGTGGGGGGAGGG - Intronic
910449595 1:87331845-87331867 GCTGAGGGGGAGAGGGAAGAAGG - Intronic
911260588 1:95680645-95680667 CCGAAAGGGGAGAGGGAGGAAGG - Intergenic
911458857 1:98162977-98162999 CTCCAGGTGCAGAGGGAGTAAGG + Intergenic
911519456 1:98911036-98911058 CATCAGGCAGAAAGGGAGGAAGG - Intronic
912382673 1:109255749-109255771 CCTCAGGTGCAAAGGCAGGATGG - Intronic
912696721 1:111847744-111847766 CAGCAGCTGGAGAGGGAGGATGG + Intronic
913500833 1:119471269-119471291 CCTGAGGAGGAGATGGAGCAAGG + Intergenic
915172995 1:153991129-153991151 CCTCTTCTGGAGAGGGATGAAGG - Exonic
915322427 1:155063109-155063131 CCTCAGGTGGCGGCGGCGGAGGG - Intergenic
915358052 1:155268445-155268467 CCTGGGGTGGAGATGAAGGAAGG + Intronic
915595681 1:156895143-156895165 CCTCCAGTGGAGAGAGAGGAAGG - Intronic
915650524 1:157307299-157307321 CCTCAGCTCTTGAGGGAGGAAGG - Intergenic
915825654 1:159073237-159073259 CTTCAGGAGGAGAAGGAGAAAGG - Exonic
916314116 1:163428436-163428458 TCTCAACTGGAGAAGGAGGAGGG + Intergenic
916488251 1:165278574-165278596 CTGCAGGTGAAGAGGGAGGATGG - Intronic
917118655 1:171626562-171626584 CCTCAGCTGGAGAAGGAGGTGGG - Intergenic
917317595 1:173741695-173741717 CCTCTTCTGGAGAGGGATGAAGG - Intronic
917840428 1:178973122-178973144 CTTCAGGTAGAGAGGGAGTGGGG + Intergenic
917906645 1:179592002-179592024 CCTGAGGTGGAAAGGAAGGCAGG - Exonic
917965355 1:180175409-180175431 ACCCAGGTGAAGAGGGAGGTTGG - Intronic
918012592 1:180602014-180602036 GCTCAGATGGAAAGGGAGTAGGG - Intergenic
918688787 1:187453717-187453739 ACTCAGGAGGATAGGGATGATGG - Intergenic
919055572 1:192565762-192565784 GAGGAGGTGGAGAGGGAGGAAGG + Intergenic
919793315 1:201306165-201306187 TCTCAGGTGTAGAGGGGGAAAGG + Intronic
919822848 1:201483833-201483855 CCTCAGATGTGGAGGGAGGTAGG - Exonic
919961287 1:202472075-202472097 CCTCTTCTGGAGAGGGATGAAGG + Intronic
920200523 1:204257313-204257335 CCTCAGGGGATGAGGAAGGAAGG + Intronic
920507389 1:206526157-206526179 CCTCATGTGGACAGGCAAGATGG - Intronic
920508302 1:206532517-206532539 CCTCAGGGAGAGAGGGAAGGGGG + Intronic
920646715 1:207809121-207809143 CCTATGGTGGGGAGGGAGGAGGG - Intergenic
921284832 1:213599972-213599994 CCCCATGTGTAGAGGGAGGGAGG + Intergenic
921765791 1:218971541-218971563 CCTCAGGTAGGGAGGTAGCAGGG + Intergenic
922082250 1:222308609-222308631 CCTAAGGGGGAGAAGCAGGAGGG + Intergenic
922765809 1:228156040-228156062 GGTCAGGTGGGGAGGGAGGTGGG + Intronic
922801899 1:228368279-228368301 CTTAAAGTGGAGAGGGAGGCTGG + Intronic
924135681 1:240964047-240964069 ACTGAGGTGGTGAGAGAGGATGG + Intronic
924143535 1:241050353-241050375 CCTCAGGTGGAAAGGGAAACAGG + Intronic
924370770 1:243347989-243348011 CCTGGGTTGGTGAGGGAGGAGGG - Intronic
924536995 1:244943990-244944012 CTTCGGGAGGCGAGGGAGGAAGG - Intergenic
1062945543 10:1458576-1458598 CCCCAAGTGGAGAAGGAAGAAGG - Intronic
1063080847 10:2765887-2765909 TCTCAGGAGCACAGGGAGGAGGG - Intergenic
1063117026 10:3079002-3079024 TCACAGGTGGAGAGGGAGCCTGG - Intronic
1063136839 10:3224636-3224658 CCCCACGTGTTGAGGGAGGAAGG + Intergenic
1063331601 10:5165171-5165193 ACCCAAATGGAGAGGGAGGAGGG - Intergenic
1063661517 10:8037559-8037581 CCGGAGGGGGAGAGGGAGAAAGG - Intergenic
1064724814 10:18268066-18268088 ACTCAGATGCAGAGGGAGGTGGG - Intronic
1064737687 10:18399512-18399534 TGCCAGGTGGGGAGGGAGGAAGG + Intronic
1065298883 10:24302873-24302895 CCTTAGGTGGGGTGGCAGGATGG + Intronic
1065607427 10:27432640-27432662 ACTCACATGGAGAGGGAGGGAGG - Intergenic
1065972808 10:30818538-30818560 CCAGAGGTGGCGGGGGAGGAGGG + Intergenic
1066048855 10:31617623-31617645 CCTGAGGTGGGCAGGGTGGATGG + Intergenic
1066658169 10:37713477-37713499 CCACAGGTGGATGAGGAGGAAGG + Intergenic
1067426507 10:46215359-46215381 ACTGATGTGGAGTGGGAGGAAGG - Intergenic
1067552938 10:47247848-47247870 CCTGAGGGGCAGAGGGAGGCAGG + Intergenic
1067629563 10:47952199-47952221 CCTCAGGTTGGGAGTGAGGCAGG + Intergenic
1069593363 10:69655364-69655386 CACCAGGAGGTGAGGGAGGAAGG + Intergenic
1070681355 10:78451544-78451566 GATCAGGTGGGGAGGCAGGAGGG - Intergenic
1071470389 10:85980111-85980133 TCCCAGGTGGGGAAGGAGGAAGG - Intronic
1071486455 10:86105700-86105722 CCTTTGCTGGAGAGGGGGGATGG - Intronic
1071718617 10:88120859-88120881 CTTCAGGTGAAGGAGGAGGAAGG - Intergenic
1072015554 10:91342876-91342898 CCCCATGTGTGGAGGGAGGAGGG - Intergenic
1072716471 10:97755863-97755885 CGTCACGTGGTGAGTGAGGATGG + Intronic
1073255202 10:102146650-102146672 CCTGTGGTGGGGAGGGAGGATGG - Exonic
1073522267 10:104144055-104144077 CTTCAGCTGGAAAGGGAAGAAGG + Intronic
1073681914 10:105714122-105714144 CCTTTGGTGGAGACTGAGGAAGG - Intergenic
1074111685 10:110427168-110427190 CCTCGGGGGTAGAGGCAGGAAGG + Intergenic
1074885396 10:117689159-117689181 CCCCAGTTGTGGAGGGAGGAAGG - Intergenic
1075097641 10:119483052-119483074 CCTCACGTGTGGAGGGAGGGAGG + Intergenic
1075556307 10:123435003-123435025 CCTCACGTGGGGAGGTAGGTTGG - Intergenic
1075576106 10:123578697-123578719 CCTCAGAAGGGTAGGGAGGAGGG - Intergenic
1075717816 10:124567030-124567052 CTCCCGGTGGAGAGGGAGGGCGG + Intronic
1076108138 10:127840793-127840815 CCACAGGATGAGCGGGAGGAAGG + Intergenic
1076280464 10:129242259-129242281 GCTGGGGTGGAGAGGGAGAATGG + Intergenic
1076437978 10:130459547-130459569 CCTAAGGTGAAGAGGGAGGGGGG + Intergenic
1076438039 10:130459806-130459828 CCTAAGGTGAAGAGGGAGGGGGG + Intergenic
1076642759 10:131929880-131929902 CCTCAGGTGGCAAGAGAGGAGGG - Intronic
1076768860 10:132652015-132652037 ACCAAGGGGGAGAGGGAGGAAGG - Intronic
1076768869 10:132652038-132652060 ACCAAGGGGGAGAGGGAGGAGGG - Intronic
1076823723 10:132956644-132956666 CCTGTTGTGGGGAGGGAGGAGGG + Intergenic
1076842024 10:133050397-133050419 CCTCAGGTGGACAGGAAGAGGGG + Intergenic
1077240639 11:1508722-1508744 CCACAGCAGGACAGGGAGGATGG - Intergenic
1077285027 11:1761799-1761821 GCGCAGGTGCAGAGGGAGGACGG - Intronic
1077329613 11:1978277-1978299 CTTGAGGTGCAGAGAGAGGATGG + Intronic
1077493051 11:2870947-2870969 CCAAAGGTGCAGAGGGAAGAGGG - Intergenic
1077550720 11:3199073-3199095 GCTCAGGGGGAGATGGAGGCTGG - Intergenic
1078510287 11:11979736-11979758 AGTCTGGTGGAGAGGGAGGCAGG - Intronic
1078725977 11:13931388-13931410 CCTCAGGAGTAGAGGGATGAGGG + Intergenic
1078800335 11:14637276-14637298 TCCCAGGTGGACAAGGAGGAGGG - Intronic
1079202822 11:18389963-18389985 GCTCAGGTGGGTAGGGATGATGG + Intergenic
1079802118 11:24882606-24882628 CCGAAGGTTAAGAGGGAGGAAGG - Intronic
1080760775 11:35246795-35246817 GATCAGGTGGAGAAGGAAGATGG + Intergenic
1081484370 11:43516350-43516372 CCTCAGGAGGCCAGGGAGGAGGG + Intergenic
1081712863 11:45228724-45228746 AGTCAGGTGGGGAGGGAGAAAGG - Intronic
1081794077 11:45807836-45807858 TCTGAGGAGGACAGGGAGGAGGG - Intronic
1081912254 11:46707204-46707226 GGAAAGGTGGAGAGGGAGGAGGG + Intergenic
1081998445 11:47378747-47378769 GCTAAGCTGGGGAGGGAGGATGG + Intergenic
1082866190 11:57902051-57902073 CGACAGCTGCAGAGGGAGGAGGG - Intergenic
1083163070 11:60867520-60867542 GCTCTGGTGGCGAGGGAGTAGGG + Intergenic
1083674804 11:64319302-64319324 CCTCAGGAGGAGGAAGAGGAAGG - Intronic
1084337689 11:68470434-68470456 CCTGAGGGAGAGTGGGAGGAGGG + Intronic
1084583525 11:70039663-70039685 CTTGAGGTGGAGGGGGAGGTGGG - Intergenic
1084769063 11:71330998-71331020 CCTCAGATGGAGAGAATGGAGGG + Intergenic
1085203165 11:74713911-74713933 CCTCATGTGGAGAAGACGGATGG + Intronic
1085217993 11:74849062-74849084 GCTGAGGAGGAGAGGGAGAATGG - Intronic
1085287076 11:75370039-75370061 TCTCAGGAGAAGAGGAAGGAGGG - Intergenic
1085533847 11:77206604-77206626 CCTCAGGTGGAGAGGGAGGAAGG - Intronic
1085625116 11:78065908-78065930 CCTCAACGGGAGAGGGAAGAAGG - Intronic
1085638899 11:78178916-78178938 TCTCAGGTGGAAAGGGAGGGGGG + Intronic
1086166273 11:83782589-83782611 CTGCAGGTGGAAAGGGAGAAAGG + Intronic
1086807104 11:91257368-91257390 CCTGATGTGGGGTGGGAGGAGGG + Intergenic
1088432466 11:109773915-109773937 CCTCAGAGGGAGAAGGAGGAAGG - Intergenic
1089256882 11:117198918-117198940 CCCCAGGAGGAGAGGGTGGCTGG + Intergenic
1089612957 11:119679820-119679842 CCACAGGTGGAGAAGGGGAAGGG - Intronic
1089650766 11:119911228-119911250 CTTCAGCAGCAGAGGGAGGAGGG + Intergenic
1089861883 11:121597180-121597202 GCTCAGGGGGAAAGGGAAGAGGG + Intronic
1090704976 11:129328017-129328039 CCCCAGGTGTTGAGGGAGGGAGG - Intergenic
1202812592 11_KI270721v1_random:33456-33478 CTTGAGGTGCAGAGAGAGGATGG + Intergenic
1091419955 12:328224-328246 TATCAGGCAGAGAGGGAGGAGGG + Intronic
1091780547 12:3211875-3211897 CCTCTTCTGGAGAGGGATGAAGG + Intronic
1092189849 12:6511247-6511269 TGTCAGGTGGGTAGGGAGGATGG + Exonic
1092253847 12:6915796-6915818 CCTCGGGTGGAAGGGAAGGAAGG - Exonic
1093275744 12:17123137-17123159 ACTAAAGTGGAGAGGGAGGCAGG - Intergenic
1093492710 12:19723775-19723797 TCACAGGTGGAGAAGTAGGAAGG + Intergenic
1094474878 12:30833334-30833356 CTTCAGCTGGAGGTGGAGGATGG - Intergenic
1095090441 12:38099481-38099503 ACGCAGTTGGAGAGGAAGGAAGG + Intergenic
1095732646 12:45522220-45522242 TTTCAGGTGGAGAGGGAGTTGGG - Intergenic
1096596700 12:52700440-52700462 CCACAGAAGGTGAGGGAGGAAGG + Intronic
1096799041 12:54097239-54097261 CCACAGGTGTAGAGGGAAGGAGG - Intergenic
1097022311 12:56029015-56029037 CCTCTGGTGGTGTGGGAGGAAGG - Intronic
1097108003 12:56636377-56636399 ACTGGGGTGGGGAGGGAGGAGGG + Exonic
1097643479 12:62208851-62208873 CCTCAGGTGGAGACTGAAGGAGG - Intronic
1098065264 12:66608012-66608034 CAGCAGGTGGGGAGGGAGGCAGG + Intronic
1098299874 12:69043192-69043214 CAGCAGGTGGAGAGGGTGGGAGG + Intergenic
1098536266 12:71597006-71597028 CCCCATGGGGGGAGGGAGGAGGG - Intergenic
1099278704 12:80613665-80613687 CATTAGGTTGAGAAGGAGGAAGG - Exonic
1099434474 12:82627191-82627213 CCTGAAGTGGAAAGGAAGGAAGG + Intergenic
1099832120 12:87857470-87857492 CCACTGTGGGAGAGGGAGGAAGG - Intergenic
1100616136 12:96233155-96233177 CATGAGGTGGAGAGGGAAAAAGG + Intronic
1100685969 12:96986071-96986093 CCTTTGGGGAAGAGGGAGGAAGG + Intergenic
1101206969 12:102498329-102498351 CCTTAAGTAGACAGGGAGGAAGG - Intergenic
1101407061 12:104438037-104438059 CCTCTGGTAGAGAGGGAGGTAGG + Intergenic
1101422669 12:104562395-104562417 ACTCAGGTGCAGGGGGAAGATGG - Intronic
1101436674 12:104670143-104670165 CCTCACAGGGAGAGGGAGGAAGG + Intronic
1101702795 12:107191034-107191056 CCTGTTGTGGAGTGGGAGGAGGG + Intergenic
1101803326 12:108041883-108041905 CATCATGTGGCAAGGGAGGAAGG + Intergenic
1102581569 12:113891537-113891559 GTCCAGGTGGACAGGGAGGAAGG + Intronic
1103555511 12:121763951-121763973 CCTCAGGAGGCCAGGCAGGAGGG - Intronic
1103555786 12:121765777-121765799 CCTGAGGAGGAGCTGGAGGAGGG - Intronic
1103962554 12:124618001-124618023 CCTGCGGTGGAGAAGGAAGAGGG + Intergenic
1103991514 12:124802550-124802572 CCCCAGGTGGAGACCGAGGTGGG + Intronic
1103993052 12:124812045-124812067 CTTCTGGTGGAGGGGGAGGAGGG - Intronic
1104320633 12:127747639-127747661 CCTCAGGGAGGGAGGGAGGGAGG - Intergenic
1104766563 12:131333754-131333776 CCACAGGTGCAGAGTGAGGAGGG + Intergenic
1104812850 12:131628889-131628911 CAGCAGGTGCAGAGTGAGGAGGG - Intergenic
1104936156 12:132365448-132365470 CCACTCCTGGAGAGGGAGGAAGG + Intergenic
1104979816 12:132568841-132568863 CCCCAGGTGAAGAGTGAAGATGG + Intronic
1108005410 13:45941425-45941447 CCCCAGCTGCAGAGGGAGGCTGG - Intergenic
1108213547 13:48161530-48161552 CCTCAGGTGGGGAGGGCACATGG + Intergenic
1108215225 13:48177183-48177205 CCTCATGTCCAGAGGGAAGACGG + Intergenic
1109177727 13:59176708-59176730 CCCCAGCTGGGGAGGGAGTAGGG - Intergenic
1110122905 13:71905362-71905384 CCTTAGGAGGAGAGGAAGAAAGG - Intergenic
1110889564 13:80681514-80681536 GTTCAGGTGGAGTGGGAAGAGGG - Intergenic
1113146060 13:107208886-107208908 TCTCTGCTGGAGGGGGAGGAGGG - Intronic
1113373345 13:109742020-109742042 CCTGAGGTGGAACAGGAGGATGG - Intergenic
1113723008 13:112574933-112574955 GCCCAGGTGGGGAGGGAGGGAGG + Intronic
1115465069 14:33706262-33706284 CAAGTGGTGGAGAGGGAGGATGG + Intronic
1115994444 14:39181197-39181219 CCTCAGGCTGAGAGGGAGGCTGG - Exonic
1116240076 14:42329394-42329416 GCTGGGGTGGAGAGGCAGGAAGG - Intergenic
1117680296 14:58197025-58197047 CCTCAGAAGAAGAGGGAGGCCGG + Intronic
1117705049 14:58457042-58457064 CTTCTGTTGGAAAGGGAGGAAGG + Intronic
1117951660 14:61089331-61089353 CCACAGGAGGAGGAGGAGGAGGG - Intergenic
1118485295 14:66208930-66208952 TCTCTGGTAGAGAGGGAGGGAGG + Intergenic
1118890804 14:69907081-69907103 CCTCTGGTGTAGAGGGAAGGAGG + Intronic
1120190568 14:81436244-81436266 CCGCAGGTGGAGCGGGCGGGGGG - Intronic
1120894611 14:89518534-89518556 GCAAAGGTGGGGAGGGAGGAGGG - Intronic
1121078816 14:91090956-91090978 CCTCTGCAAGAGAGGGAGGAAGG + Intronic
1122859440 14:104575983-104576005 CCACGGGTGGGGAGGGAGGTGGG - Intronic
1123736786 15:23192502-23192524 CCTCAGTTGGGGAAGGAGCAAGG + Intergenic
1123904828 15:24911083-24911105 CCTCTTCTGGAGAGGGATGAAGG + Intronic
1124252473 15:28115919-28115941 CCTCAGTGGGACAGGAAGGAGGG + Intronic
1124287485 15:28415480-28415502 CCTCAGTTGGGGAAGGAGCAAGG + Intergenic
1124288007 15:28421182-28421204 CCTCAGTTGGGGAAGGAGCAAGG + Intergenic
1124641431 15:31398777-31398799 GCCCTGGGGGAGAGGGAGGAGGG - Intronic
1125979112 15:43983778-43983800 CCAGAGGTGGAGACGGTGGATGG - Intronic
1128053574 15:64683643-64683665 ACTCAGGTGGGGTGGGATGACGG - Exonic
1128090472 15:64915635-64915657 CCTGACCTTGAGAGGGAGGAGGG + Intronic
1128116556 15:65110942-65110964 CATCATGTGGAGAGGTAGGGTGG + Intronic
1128865955 15:71115417-71115439 CCGCAAGAGGGGAGGGAGGAAGG + Exonic
1129312904 15:74725039-74725061 CCTTGGGTGGACAGGGTGGATGG - Intronic
1129785413 15:78306854-78306876 CCGCAGGAGGGGAGGGAAGAGGG - Intergenic
1130584189 15:85167565-85167587 CCTCAAGTAAAGAGGAAGGAAGG + Intergenic
1131697367 15:94892500-94892522 CCCCATGTGTAGAGGGAGGGAGG - Intergenic
1132145199 15:99425406-99425428 CCTCGGGTGGAGGGTGAGGCTGG + Intergenic
1132204656 15:99978053-99978075 CCACACGTGGTGAGGGAGGCAGG + Intronic
1132406319 15:101543561-101543583 CCTCAGCTGTAGAAGGACGAGGG - Intergenic
1132746006 16:1436588-1436610 CCACACAGGGAGAGGGAGGAGGG + Intronic
1132853068 16:2033432-2033454 GGTCAGGTGGGGTGGGAGGAAGG + Intronic
1132878997 16:2153007-2153029 CGTGTGGTGAAGAGGGAGGACGG + Exonic
1133469258 16:6058341-6058363 TCTGAGAAGGAGAGGGAGGAAGG - Intronic
1134122798 16:11596693-11596715 GAGCAGGGGGAGAGGGAGGAGGG + Intronic
1135081526 16:19440338-19440360 GCTCTGGTAGAGAGGTAGGATGG - Exonic
1135376761 16:21953766-21953788 ACCCAGGGGGAGCGGGAGGACGG + Intronic
1135400627 16:22164045-22164067 CCTCAGGTGGAGAGGGAGGTCGG + Intergenic
1135671857 16:24382267-24382289 CTCCTGGTGGAGAAGGAGGAGGG - Intergenic
1136375592 16:29863314-29863336 GCAGAGGAGGAGAGGGAGGAAGG + Exonic
1136450941 16:30353980-30354002 CTGCAGGAGGAGATGGAGGAAGG - Exonic
1136598520 16:31268171-31268193 CCCTAGGTGGAGAGGGAAGCTGG - Intronic
1136922799 16:34345888-34345910 CCAGAGCTGGGGAGGGAGGATGG - Intergenic
1136981774 16:35065918-35065940 CCAGAGCTGGGGAGGGAGGATGG + Intergenic
1137876165 16:51998585-51998607 CCTCAGGAGGGCAGGCAGGAAGG - Intergenic
1138006547 16:53342844-53342866 CCTCAGATGGCGGGAGAGGAAGG + Intergenic
1138343954 16:56308689-56308711 CCACAGTTGGAGACAGAGGAGGG + Intronic
1138455747 16:57119692-57119714 CCTCAGGTAGACTGGGAGGCTGG - Intronic
1138778199 16:59750838-59750860 CCCCACGTGTAGAGGGAGGGAGG - Intronic
1139021540 16:62755997-62756019 CCCCATGTGCAGAGGGAGGGAGG + Intergenic
1139268564 16:65661621-65661643 CCTCATGAGTCGAGGGAGGAGGG - Intergenic
1140710233 16:77670743-77670765 CCTCACGTGGCTAGGGAGGTGGG - Intergenic
1140734208 16:77883765-77883787 CATCGGATGAAGAGGGAGGAGGG - Intronic
1140906728 16:79415524-79415546 GCTCAGGTTGTGAGGGAGGCTGG + Intergenic
1142015116 16:87741550-87741572 CCGCTGGTGGGGAGGGATGACGG - Intronic
1142273950 16:89105875-89105897 CCTCAGGGCGAGAGGCAGGTGGG + Intronic
1142378368 16:89718286-89718308 CCTCAGGTGAGGACTGAGGATGG - Intronic
1142399885 16:89852993-89853015 CTTGAGGGTGAGAGGGAGGATGG - Intronic
1142560891 17:808189-808211 CCCCAGGAGCAGAGGGAGGTGGG - Intronic
1142592365 17:1011985-1012007 CCTGGGGTGGAGCGTGAGGATGG + Exonic
1143284917 17:5781766-5781788 GCTCAGGTGCAGGTGGAGGATGG + Intronic
1143284940 17:5781890-5781912 GCTCAGGTGCAGGTGGAGGATGG + Intronic
1143284957 17:5781980-5782002 GCTCAGGTGCAGGTGGAGGATGG + Intronic
1143645248 17:8225713-8225735 CCGCTGGTGGAGAGGGATGGAGG + Intergenic
1144504844 17:15821269-15821291 GGGCAGGTGGAGAGGAAGGAGGG - Intergenic
1144523351 17:15969066-15969088 CCTCAGCTGCAGTGGAAGGAAGG - Intronic
1144636144 17:16910496-16910518 GAGCAGGTGGAGAGGAAGGAGGG - Intergenic
1144690438 17:17258966-17258988 CCTAAGGAGAAGAGGAAGGAAGG - Intronic
1144702937 17:17350652-17350674 CCCCAGGTGGAGAGGGCGCTGGG + Intergenic
1144755449 17:17677761-17677783 CCTCATGAGCAGAGGCAGGAAGG + Intergenic
1145169017 17:20639152-20639174 GGGCAGGTGGAGAGGAAGGAGGG - Intergenic
1145203580 17:20968591-20968613 GGGCAGGTGGAGAGGAAGGAGGG - Intergenic
1145757687 17:27404675-27404697 CCTGGTCTGGAGAGGGAGGAGGG - Intergenic
1145774516 17:27518763-27518785 CCTTTGGTGGAGAGGGAGGAGGG - Intronic
1146015921 17:29233494-29233516 ACTCAGGAGGGGAGGGTGGAAGG - Intergenic
1147141785 17:38464567-38464589 CTTCCTGGGGAGAGGGAGGAAGG + Intronic
1147145867 17:38484184-38484206 TCTCAGGGGAAGGGGGAGGATGG + Intronic
1147179136 17:38673934-38673956 CCGCAGGTGGCGACGGAGGCCGG + Exonic
1147343618 17:39771669-39771691 CCTGGAGTGCAGAGGGAGGATGG + Intronic
1147571136 17:41571861-41571883 CCTCAGGGGGCGGTGGAGGAGGG - Exonic
1147615111 17:41822924-41822946 CCACTGGAGGCGAGGGAGGAGGG - Exonic
1148071240 17:44910053-44910075 ACTCAGGGGGATTGGGAGGATGG + Intronic
1148079123 17:44957822-44957844 GCTCAGCTGGAGAGACAGGAAGG - Intergenic
1148136952 17:45299509-45299531 CCTCAGGCGGAGAAGGAGAATGG + Intronic
1148152063 17:45402816-45402838 CCTCTGTGGGAGAGGGAGGAAGG + Exonic
1148866564 17:50631787-50631809 AGTCAGTTGGGGAGGGAGGATGG + Intergenic
1148996485 17:51714702-51714724 GCTCAGATGGAGAGAGAAGAAGG + Intronic
1149553079 17:57554447-57554469 GCTGAGGAGGAGAGGGGGGATGG - Intronic
1149595267 17:57861534-57861556 CCCCAGGCCGGGAGGGAGGAGGG + Exonic
1149962647 17:61128927-61128949 CCTAAGGTGGAGAGGGGGACAGG + Intronic
1150265267 17:63828132-63828154 CTTCAGATGGAGCTGGAGGAGGG + Exonic
1150410442 17:64937124-64937146 CCTCTGTGGGAGAGGGAGGAAGG - Intergenic
1150473110 17:65454178-65454200 CCTCATGTGGGGAAGGTGGAGGG - Intergenic
1151675582 17:75595756-75595778 CGTCAGGAGGAAAGGGAAGAGGG + Intergenic
1151736812 17:75947560-75947582 CCCCAGGAGGAGGGGGATGAAGG + Intronic
1151890821 17:76949501-76949523 CCTCAAGTGTAGAGGGAGGGTGG - Exonic
1151933533 17:77247784-77247806 CCTCACATGGAGGGGGAGGGAGG - Intergenic
1151960039 17:77400938-77400960 ACCCTGGTGGAGAGGCAGGATGG + Intronic
1152037279 17:77881152-77881174 CCCCAGGTGGAAGGGGAGGGGGG - Intergenic
1152072191 17:78139363-78139385 CCTCAGGCTGAGAGTGAAGACGG + Intronic
1152103111 17:78314268-78314290 CCCCAGGGTGAGCGGGAGGAGGG + Intergenic
1152730291 17:81966739-81966761 GCGCAGTCGGAGAGGGAGGAAGG + Intergenic
1152802813 17:82339789-82339811 CCTCATGGGGAGAGGAGGGAGGG + Intergenic
1153498144 18:5721315-5721337 AATGAGGTAGAGAGGGAGGAAGG + Intergenic
1153540919 18:6153664-6153686 CCCCATGTGTTGAGGGAGGAAGG + Intronic
1153678489 18:7477374-7477396 CCTCATGGGGGCAGGGAGGAGGG + Intergenic
1154072068 18:11161707-11161729 GCTCAGGAGGAGAGGGATGAGGG + Intergenic
1154243883 18:12678189-12678211 ACAGAGGTGGAAAGGGAGGAAGG + Exonic
1155000997 18:21686773-21686795 CCCCAGCTGGAGTGGGAGAAAGG - Intronic
1155073527 18:22336277-22336299 CTTCAGGTGCAAAGGGAGGAGGG + Intergenic
1156001435 18:32389053-32389075 CATTTGGTGGGGAGGGAGGAGGG + Intronic
1158747520 18:60218454-60218476 CCCCATGTGTAGAGGGAGGGAGG + Intergenic
1158783731 18:60683423-60683445 CCTCAGGTGTCAAGGGAGGGAGG - Intergenic
1159575550 18:70171711-70171733 CCTCATGTGCATTGGGAGGAGGG + Intronic
1160124918 18:76163089-76163111 CCGCAAGTGGAGAGGATGGAAGG - Intergenic
1160318200 18:77867316-77867338 CTGCAGGTGGAGAGGAAGGTGGG - Intergenic
1160321434 18:77900004-77900026 GCTCAGCTGGAGAGGGTAGAGGG - Intergenic
1160432286 18:78819923-78819945 CCTCTGCAGGAGGGGGAGGAGGG + Intergenic
1160507330 18:79434430-79434452 CCTGGGGTGCAGAGGGAGCATGG - Intronic
1160948499 19:1654540-1654562 AGTGAGGTGGAGAGGGATGAGGG - Intergenic
1161139973 19:2641434-2641456 CCTCAGGAGAAGAGGCAGGAGGG + Intronic
1161169195 19:2804634-2804656 CCTCATGTGTGAAGGGAGGAGGG - Intronic
1161250782 19:3279151-3279173 GGCCAGGTGGACAGGGAGGAGGG + Intronic
1161251730 19:3284503-3284525 ACTCATGTGGAGAGGGAGACGGG + Intronic
1161353084 19:3804424-3804446 CATCAGGGAGAGAGGGAGGAAGG + Exonic
1161636487 19:5392568-5392590 CCTCCGCTGGAGAGGCAGGAAGG - Intergenic
1162541682 19:11300343-11300365 ACTCAAGTGGAGAGGGAGCTGGG + Intronic
1162825616 19:13249745-13249767 GCTGAGGTGGAGGGGGAGGATGG + Intronic
1163247520 19:16106260-16106282 ACCCAAGTGGGGAGGGAGGAGGG - Intergenic
1163514768 19:17756142-17756164 CCCCAGCTGGGGAGGGAGCAAGG - Intronic
1163553683 19:17980792-17980814 CCTCAGGAGGAGACTGAGGCAGG + Intronic
1163738681 19:18997326-18997348 CCTCAGGTCAGGAGGGAGGGAGG + Intronic
1164245269 19:23422653-23422675 CCTAACGTGGAGAAGGAGGCAGG + Intergenic
1164323929 19:24176130-24176152 ACTGTGGTGGAGAGGGGGGAAGG - Intergenic
1164426545 19:28146827-28146849 ACTCTGGTGGAGGGGGATGATGG - Intergenic
1164709204 19:30343447-30343469 CCTCAACTGGAGATGGAGCAGGG - Intronic
1164784064 19:30915544-30915566 TCTAAGGTGGAGAGCGAGGCTGG - Intergenic
1164827766 19:31297012-31297034 CCTCAGTGGGAGCGGGAGGTGGG + Intronic
1165038983 19:33055442-33055464 TCCCAGGTGGAGAGGGAGGGAGG - Intronic
1165995458 19:39840561-39840583 CCTGAGGTGGGGAGTGGGGAGGG - Intronic
1166146852 19:40843977-40843999 CCTGAGGAGGAGAGGCGGGAGGG + Exonic
1166151013 19:40875874-40875896 CCTGAGGAGGAGAGGCGGGAGGG + Exonic
1166155508 19:40908653-40908675 CCTGAGGAGGAGAGGCGGGAGGG + Intergenic
1166179308 19:41095738-41095760 CCTGAGGAGGAGAGGCAGGAGGG - Exonic
1166361417 19:42254284-42254306 CCACCGGTGGCGCGGGAGGAGGG + Intronic
1166816672 19:45550512-45550534 CCCCAGCTGCAGAGTGAGGAGGG - Intronic
1167349007 19:48963467-48963489 CCATAGGTGGAGGGAGAGGAGGG - Intergenic
1167368017 19:49064876-49064898 CCTCGGGTGGGGAGGGACGGGGG - Intronic
1167424677 19:49423882-49423904 AGTCAGATGGAGATGGAGGAGGG + Exonic
1167517698 19:49932801-49932823 GTTGAGGTGGAGAAGGAGGAGGG - Exonic
1167695976 19:51015832-51015854 CCTCAGGAGGAGGGGGCTGAGGG - Intronic
1167740276 19:51320439-51320461 CACCAGGCGGAGAGGGAGGAAGG - Intronic
1168276851 19:55283715-55283737 GCTGAGGCAGAGAGGGAGGAAGG - Intronic
1168290236 19:55354063-55354085 CCTCCAGGGGAGAGGGAGGCGGG - Exonic
1168317560 19:55490694-55490716 CCCCAGGTGGAAATCGAGGAAGG + Intronic
925284059 2:2704587-2704609 GCTCAGGTGGAACGTGAGGACGG - Intergenic
925661409 2:6207227-6207249 CCACAGGAGGAGAGGGAGCATGG - Intergenic
925895420 2:8468022-8468044 CCGGAGGTGGAGAGTGGGGATGG - Intergenic
926849361 2:17178087-17178109 CCTAGGGTGGAGAGGGTAGAAGG - Intergenic
927520469 2:23695324-23695346 CCCCAGGTGGAGTGAGAGAATGG + Intronic
927754516 2:25698053-25698075 ACGCAGGAGGAGAGGGAGGCTGG + Intergenic
928314704 2:30236276-30236298 GGGCAGGTGGTGAGGGAGGAAGG + Intronic
929107108 2:38376684-38376706 CCTTACGCGGACAGGGAGGAAGG - Intronic
929565059 2:42978860-42978882 CCTCAGAAGGACAGGGAGGAGGG + Intergenic
930037616 2:47097039-47097061 ACACAGGTGGACAGGGAGGGAGG + Intronic
930622143 2:53654575-53654597 CCAAAGGTGGAGAGTGAGAAGGG + Intronic
931391673 2:61849962-61849984 CACCAGGTGGGGAGGGAGGGAGG + Intronic
931442977 2:62304408-62304430 CTTCAGGTGTGGAGGGAGGAGGG - Intergenic
932199445 2:69812647-69812669 CCTCAGGGTGGGAGGGATGAAGG + Exonic
932266385 2:70370753-70370775 CCTCATCTGTAGAGTGAGGATGG + Intergenic
932503986 2:72211076-72211098 TTTCAGGTTGAGAGGGAAGAGGG - Intronic
932615606 2:73229455-73229477 GCTCTGGTGGAGAGGGGGTAAGG - Exonic
932749438 2:74362036-74362058 CCTCAGGGTGAGGGGGAGCATGG - Exonic
933837826 2:86260100-86260122 TCTCAGGGTGAGAGGAAGGAAGG + Intronic
934067078 2:88350498-88350520 CTGCAGGTGGAGAGGGAGTGGGG + Intergenic
934912822 2:98274959-98274981 CCTGAGGAGCAGAGGAAGGATGG - Intronic
935196595 2:100820059-100820081 GGGGAGGTGGAGAGGGAGGAGGG + Intergenic
935534984 2:104283569-104283591 GCTCAGGAGCAGAGGGAGGGGGG + Intergenic
937122707 2:119451927-119451949 CCACAGGGGCAGAGGGTGGAAGG - Intronic
937278820 2:120703591-120703613 ACTCAGCTGCAGAGTGAGGAAGG - Intergenic
937896360 2:126979378-126979400 CCCCATGTTGAGAGTGAGGAAGG - Intergenic
938232746 2:129675619-129675641 CCTCAGGGAGAGAGAGAGGCTGG - Intergenic
938595695 2:132785120-132785142 CCTCAGGTACAGAGGGAGAGGGG - Exonic
939010300 2:136838626-136838648 CCTCATTTTGAAAGGGAGGATGG - Intronic
939099485 2:137879949-137879971 CTTGAGGTGGTGGGGGAGGAGGG - Intergenic
939251308 2:139684619-139684641 CCTGAGGAGGGGAGGGATGAAGG + Intergenic
939314109 2:140524790-140524812 CCAAAAGGGGAGAGGGAGGAAGG + Intronic
940027242 2:149221147-149221169 CCCCAGGTGTCGAGGGAGGGAGG + Intergenic
940598772 2:155829631-155829653 CCCCATGTGTAGAGGGAGGGAGG - Intergenic
940688366 2:156882978-156883000 CCTCACGTGGATATGGAGGATGG + Intergenic
940770388 2:157833407-157833429 TCTCTGGTGGAAATGGAGGATGG + Intronic
941092207 2:161190783-161190805 CCAGAGGTTGAGAGGGAGGAAGG + Intronic
941110841 2:161417426-161417448 GCCCAGGTGGAGAGCGAGGTTGG - Intronic
941263695 2:163331900-163331922 CCTAAGGAGGAGAGTGTGGACGG + Intergenic
941714908 2:168753949-168753971 ACACAGGTGGAGAGGGAGGATGG - Intronic
942069198 2:172300112-172300134 GTTCAGATGGAGAGGGAGGGAGG + Intergenic
942398302 2:175575370-175575392 CTTCACATGGAGAGGGAGGGAGG - Intergenic
943592761 2:189819043-189819065 ACAAAGGTAGAGAGGGAGGAGGG - Intronic
943648835 2:190435062-190435084 CCTCAGATGGAGAGGGGGGTTGG - Intronic
943872892 2:193024622-193024644 CCACAGGTGGGGAGGGTGCAAGG - Intergenic
944070134 2:195658058-195658080 CCTTAGGTGGAGAGCGATGTGGG + Intronic
944780707 2:203014610-203014632 CCTCAGCTGGACATGGAGGAGGG - Intronic
945826365 2:214724855-214724877 CCTCAAGTGGAGGTGGCGGAAGG + Intergenic
946028793 2:216689232-216689254 CCTGATGTGGAGAGGCAGGCAGG - Intronic
946178128 2:217934341-217934363 CCTAAGGAGGACAGGGAGGGAGG + Intronic
946182954 2:217959959-217959981 CCTCACGTGTGAAGGGAGGAGGG + Intronic
946416498 2:219542806-219542828 CCTCAGGGTGAGATGGGGGAGGG - Intronic
946688593 2:222294680-222294702 ATTCAGGTGGGGAGGAAGGAGGG - Intronic
947141949 2:227027470-227027492 CCTGTTGTGGAGTGGGAGGAGGG + Intronic
947531296 2:230910228-230910250 CCCCAGGTGGACTGGGAGGAAGG + Exonic
947746439 2:232510029-232510051 ACTCAGGTAGTGATGGAGGAAGG - Intergenic
947837368 2:233185274-233185296 CCTCAGTTGGAGAAGGAGGCAGG - Intronic
948041151 2:234902593-234902615 TCTGACCTGGAGAGGGAGGAGGG + Intergenic
948136348 2:235639175-235639197 CCACAGGTTGAGAGAGGGGATGG + Intronic
948861784 2:240756113-240756135 CCTTGGGTGGAGATGGTGGAAGG - Intronic
948882533 2:240867505-240867527 CCCCAGGTGGGGTGGGTGGAGGG + Intergenic
948947208 2:241226875-241226897 CCTCGGCTGGAGGAGGAGGAGGG - Intergenic
948995467 2:241576129-241576151 CGGGAGGAGGAGAGGGAGGAAGG - Intergenic
1168868252 20:1107485-1107507 TCTTAGGTGGAGAGCTAGGAAGG - Intergenic
1168889623 20:1286402-1286424 CTGCAGCTGGAGAGGGAGAAGGG + Intronic
1168943921 20:1735883-1735905 CCGCAGCAGGAGAGGGAGGGAGG - Intergenic
1170354489 20:15477550-15477572 TCTCAGTTGGACAGGGAGAAAGG + Intronic
1171406096 20:24913306-24913328 CCTCAGTTGAAGAAGGATGAGGG + Intergenic
1172038570 20:32028036-32028058 ACTCAGCTGGAGAGTCAGGAGGG + Intronic
1172105936 20:32517354-32517376 CAGCAGCTGGAGAGGGAGAAGGG + Intronic
1172123086 20:32609860-32609882 CCTCAGATGGAGAGTGAGGGGGG - Intergenic
1172149383 20:32779694-32779716 CCCCAGCTGGTGAGGGAGGAGGG + Intronic
1172230500 20:33332860-33332882 TCGCTGATGGAGAGGGAGGAAGG + Intergenic
1172317434 20:33967134-33967156 CCACTGGTGGAGAGGGCGAAGGG - Intergenic
1172448174 20:35003825-35003847 CCTCAGGTGGGGTGGGAGGTGGG - Intronic
1172820462 20:37728720-37728742 TCTCTGTTGGAGAGGGAGGTGGG + Intronic
1172852303 20:37975371-37975393 CATGGAGTGGAGAGGGAGGAAGG + Intergenic
1173122188 20:40304134-40304156 TCTCAGGTGGAGATAGAGAAAGG + Intergenic
1173126205 20:40338420-40338442 CCACAGGTGGAGATGGAGAGAGG + Intergenic
1173222028 20:41138409-41138431 CCTCTGGGGGAGAGGGAGGAAGG + Intronic
1173437624 20:43047076-43047098 TCTGAGGGGAAGAGGGAGGAGGG - Intronic
1173614062 20:44391218-44391240 CCTCAGGTGGTGCGGGTGGCAGG - Intronic
1173766117 20:45611199-45611221 CCTAGGGAGTAGAGGGAGGACGG - Intronic
1174062292 20:47841288-47841310 CCTGAGGCGGAGTGAGAGGAAGG + Intergenic
1174361574 20:50032070-50032092 CATCAGGTGGAGAATGAGGGTGG + Intergenic
1174362054 20:50035054-50035076 CATCAGGTGGAGAATGAGGGTGG + Intergenic
1174869230 20:54168074-54168096 CACCAGGTGAAAAGGGAGGAAGG - Intronic
1175056275 20:56201496-56201518 CATCATGGGGAGAGGGAGGAAGG + Intergenic
1175065435 20:56282425-56282447 CCCCAGAAGGAGAGGGAGGCTGG - Intergenic
1175495766 20:59413198-59413220 CCTCAGGGAGGGTGGGAGGAGGG - Intergenic
1175900407 20:62357788-62357810 CCCCAGCTGGAGGGAGAGGATGG + Intronic
1176168129 20:63685216-63685238 CCTCAGGGGCACAGAGAGGAGGG + Intronic
1176261701 20:64185306-64185328 CCTGTGCTGGAGACGGAGGAGGG + Intronic
1176285318 21:5016245-5016267 CCTGAGGAGGAGGAGGAGGAGGG + Intergenic
1176305627 21:5121669-5121691 CCTCGGGGAGGGAGGGAGGAGGG - Intronic
1176905618 21:14497030-14497052 GCCCAGATGGAGAGTGAGGAGGG - Intronic
1177084274 21:16682459-16682481 CCCCACGTGTAGAGGGAGGGAGG - Intergenic
1177842883 21:26254264-26254286 TCTCAGGGGGAGAGAGAGCAAGG - Intergenic
1178415861 21:32404630-32404652 CCAGAGGTGGGGAGGGAAGAGGG + Intergenic
1178974271 21:37208427-37208449 CCCCAGTGGGGGAGGGAGGAGGG - Intergenic
1179170594 21:38970081-38970103 CCTCAGGTGGAGAGACTGCATGG - Intergenic
1179364225 21:40740734-40740756 ACTCAGAAGGACAGGGAGGATGG + Intronic
1179521120 21:41945649-41945671 CCTCACCTGCAGAGGGAGGGAGG + Intronic
1179632852 21:42689232-42689254 CCTCAAGGTGACAGGGAGGACGG - Intronic
1179802146 21:43816186-43816208 CCTCAGCAGGAGAGGGAGGCAGG - Intergenic
1179851430 21:44140362-44140384 CCTCGGGGAGGGAGGGAGGAGGG + Intronic
1179871863 21:44247230-44247252 CCTGAGGAGGAGGAGGAGGAGGG - Intronic
1180084085 21:45499755-45499777 ACACTGGTGGAGAGGCAGGAGGG + Intronic
1180151222 21:45949052-45949074 CCTCCGGAGGACAGGGAGGGAGG + Intergenic
1180205057 21:46254682-46254704 CCTCAGTTGGAGATGCATGAAGG + Intronic
1180205230 21:46255683-46255705 CCTCAGTTGGAGATGCATGATGG + Intronic
1180717859 22:17884209-17884231 GCTCAGGAGGAGGGGTAGGAAGG + Intronic
1181064130 22:20297710-20297732 CCTGATGAGGAGAGGAAGGAGGG + Intergenic
1181516212 22:23415133-23415155 CGTGAGGTGGTCAGGGAGGATGG + Intergenic
1181552037 22:23645365-23645387 CCACAGGTGGGGAGGGAAGGAGG - Intergenic
1181744512 22:24946527-24946549 CCTGAGGTGAGGAGTGAGGAGGG - Intronic
1181841913 22:25670626-25670648 ATTCAGGGAGAGAGGGAGGAAGG - Intronic
1181872343 22:25909974-25909996 CATGAGGTGGAAATGGAGGATGG + Intronic
1181993212 22:26854089-26854111 CCTCTGGTGGTGAGGAAGAAAGG - Intergenic
1182055003 22:27345644-27345666 CCTCAACTGGAGAAGGAAGAGGG - Intergenic
1182150849 22:28026167-28026189 CCTCAGGTGTTGAGGGCAGAGGG + Intronic
1182413003 22:30202931-30202953 CCTGAGGTGGAGAAGGAGCTTGG + Intergenic
1182477320 22:30583220-30583242 CCCCAGGGGGAGAGGGAACAGGG + Intronic
1182527340 22:30928731-30928753 CTCCAGGGGGAGAGGTAGGAAGG + Intronic
1182679432 22:32067197-32067219 ACTCTGGTGGAAAGGGAGCAGGG - Intronic
1183197121 22:36361166-36361188 CCTGAGGTGGAAAGGGAAGGGGG - Intronic
1183246687 22:36699329-36699351 GCACAGGGGGAGAGGGAGAAGGG - Intronic
1183276477 22:36901213-36901235 CCCCAGGTGCAAAGGTAGGAGGG - Intergenic
1183319098 22:37154261-37154283 CCTCAGATGGAGAGGCAGGGAGG + Intronic
1183453885 22:37911072-37911094 CCTGGAGTGGGGAGGGAGGAGGG + Intronic
1183463339 22:37966410-37966432 CCTCAGGTGAAGGGTGGGGAGGG + Intronic
1183689201 22:39378788-39378810 CCTGGGCTGCAGAGGGAGGATGG - Intronic
1183827647 22:40401031-40401053 CCTCAGGTGGAGAAAGAGGCCGG + Intronic
1183988727 22:41584056-41584078 CCACTGGTGGTGAGGGAGGGCGG + Exonic
1184150642 22:42636360-42636382 ACTCTGGGGGAGGGGGAGGAGGG + Intronic
1184164564 22:42720122-42720144 CCCCAGCTGGAGAGGAGGGAGGG + Intronic
1184197325 22:42938712-42938734 CTCCAGGTGGAGTGGGAGAAAGG - Intronic
1184343950 22:43901593-43901615 ACTCATGTTGAGAGGGAGGGTGG - Intergenic
1184426792 22:44413731-44413753 CCTCAGGAGGAGGAGGAGGAGGG + Intergenic
1184457324 22:44618569-44618591 CTCCAGGTGCAGAGGGAGAAGGG + Intergenic
1184732331 22:46377792-46377814 CCTCAGGCGGGGCTGGAGGAGGG - Intronic
1184746268 22:46458037-46458059 CATCTAGTGCAGAGGGAGGAAGG + Intronic
1184747671 22:46465469-46465491 CCCCAGAATGAGAGGGAGGAGGG - Intronic
1184795368 22:46729001-46729023 TCTCATGTGGCGAGGGAGGTGGG - Intronic
1184916821 22:47575036-47575058 CCTCAGCTCCAGAGGAAGGAGGG - Intergenic
1185011823 22:48318844-48318866 GCTCTGGTGCAGTGGGAGGAGGG - Intergenic
1185028792 22:48430871-48430893 CCTGAGCAAGAGAGGGAGGAGGG - Intergenic
1185102607 22:48849753-48849775 AAGCAGGTGGAGAGGGAGAAAGG + Intronic
1185276996 22:49954081-49954103 CCGCAGGAGGAGAGTGTGGAAGG + Intergenic
1185312558 22:50164438-50164460 CCTGTGGTGGTGAGGGAGGTGGG - Intergenic
1185333165 22:50260685-50260707 CCGGTGGTGGAGGGGGAGGAGGG - Intronic
950023694 3:9806651-9806673 CCCCAGGTGGGGAGGGAGGGAGG + Intronic
950753846 3:15155769-15155791 CCTCAGTTCCAGTGGGAGGAGGG + Intergenic
951350328 3:21599758-21599780 CCATAGGTAGGGAGGGAGGAAGG - Intronic
952740342 3:36728545-36728567 TCCCAGGAGGAGGGGGAGGAGGG - Intronic
952855776 3:37769700-37769722 TCTCAGGAGTAAAGGGAGGAGGG - Intronic
953018748 3:39100653-39100675 TCTATGGTGGAGATGGAGGAGGG - Intronic
953131582 3:40144417-40144439 ACTAAGTTGGAGAGGGAGGGAGG + Intronic
953199068 3:40761565-40761587 CCTCTTCTGGAGAGGGATGAAGG - Intergenic
953613505 3:44468669-44468691 CCTCGGGGGGAGGGGGTGGAGGG - Intronic
953661712 3:44895536-44895558 CTGCAGTTGGAGAGGGAGGTGGG + Intronic
953877324 3:46673742-46673764 ACTGAGGTGGTGAGGGAGGCGGG + Intronic
954409273 3:50363334-50363356 GCTCAGATGGACTGGGAGGAGGG - Intronic
954655413 3:52191346-52191368 GCTCAGGAGGACAGGGAGGGAGG + Intergenic
955050152 3:55402585-55402607 CCTCAGGTGAAGTAGGAAGAGGG - Intergenic
955191865 3:56769292-56769314 CCTCTGGTGTGGAGTGAGGAAGG - Intronic
955659161 3:61278068-61278090 TCTCAGGTGAGGAGAGAGGAAGG + Intergenic
956053801 3:65277464-65277486 ACCCAGGTAGAGAGGTAGGAAGG - Intergenic
956614946 3:71161384-71161406 GGTCACGTGGAGAGAGAGGAGGG - Intronic
957230581 3:77509225-77509247 CTTCAGGTGGGAAGGTAGGAAGG + Intronic
957425587 3:80035100-80035122 CCTCACGTGTCAAGGGAGGAAGG - Intergenic
959521753 3:107329214-107329236 GATCTGGTGGAGAGGGAAGAAGG + Intergenic
959574632 3:107921311-107921333 CCCCGGGTGCAGAGGCAGGATGG - Intergenic
959677690 3:109055139-109055161 CCTTACGTGGAGAGTGAGGGTGG + Intronic
960179253 3:114555539-114555561 ACTCATGTGGACAGTGAGGATGG - Intronic
960452935 3:117832435-117832457 CAGCTGGTGGAGAGGAAGGATGG - Intergenic
961173779 3:124817564-124817586 CCTCAGTGGGAGAGGGTGGAAGG + Intronic
961368810 3:126417517-126417539 CCACAGTTGGAGAGGCAGGCAGG + Intronic
961481683 3:127184506-127184528 CCACAGGTGGAGGGGGTGGCAGG + Intergenic
961483543 3:127199891-127199913 CCTCAGCTGGGGAGGGGAGAGGG + Intergenic
961584600 3:127911539-127911561 CCTCAGGGGGAGAGTCAGGCCGG - Intergenic
961987756 3:131155861-131155883 CCTCAGTTTGAAAGTGAGGATGG - Intronic
962313106 3:134339715-134339737 ACTCAGGTGGAGAAGGAGACAGG - Intergenic
962456000 3:135566327-135566349 GCTTTGGTGGAGATGGAGGAAGG + Intergenic
962752516 3:138444266-138444288 CCTCAGATGGGGAGGGTGGAGGG + Intronic
963312259 3:143721753-143721775 GCAGTGGTGGAGAGGGAGGAAGG + Intronic
963552292 3:146739542-146739564 CCTCAGCTGTATAGAGAGGAAGG - Intergenic
964628709 3:158784934-158784956 CCTCACCTGGAGAGGGATGAGGG + Intronic
964970463 3:162553687-162553709 CCTCATGTGTTGAGGGAGGGAGG - Intergenic
966073656 3:175909008-175909030 CCTGTGGTGGAGTGGGGGGAGGG + Intergenic
966159724 3:176955290-176955312 CCTGTGGTGGAGTGGGGGGAGGG - Intergenic
966412174 3:179655072-179655094 CTAAAGGTGGAGAGGGATGATGG + Intronic
966848008 3:184145386-184145408 CACCTGGGGGAGAGGGAGGACGG + Intronic
967106864 3:186261216-186261238 GCACAGGTGGACAGGGAGAATGG - Intronic
967875534 3:194265973-194265995 TCTCAGGTGGTGAGAGAGGCGGG - Intergenic
967932805 3:194702682-194702704 GCGGAGGTGGAGAGGGAGGTTGG + Intergenic
968319073 3:197749837-197749859 CCGCGGGTGGAGACCGAGGACGG + Exonic
968505416 4:968967-968989 GCGCAGGTGAAGAGCGAGGAGGG - Intronic
968657825 4:1786193-1786215 CCACAGGTGGTCAGGGAGGGTGG + Intergenic
968699689 4:2048680-2048702 CCCCAGGTGGTCAGGGAAGAGGG - Intergenic
968889247 4:3359087-3359109 GGTGAGGAGGAGAGGGAGGAGGG - Intronic
969038792 4:4277457-4277479 CCACAGGGAGAGAGGGAGGGAGG + Intronic
969575228 4:8032718-8032740 CGCCAGGCAGAGAGGGAGGAGGG + Intronic
969595975 4:8149491-8149513 CCACAGGTTCAGAGGAAGGAGGG + Intronic
969837765 4:9857474-9857496 CCTGAGATGGTGAGGGAAGATGG - Intronic
969935612 4:10677524-10677546 CCCCAGGTGCTGAGGGAGGGAGG + Intronic
970313235 4:14804640-14804662 ACTCAGGAGGAGAGGGAGCAGGG - Intergenic
970410291 4:15799868-15799890 GCTCAGGCACAGAGGGAGGAGGG + Intronic
970510602 4:16777979-16778001 CCTGAGGTGGAGAGGGATGGGGG - Intronic
971140881 4:23923725-23923747 CCTCAGATGGAAAAGGAAGAGGG + Intergenic
971201581 4:24514029-24514051 CAGCAGGGGGAGAGGGAGCACGG + Intergenic
971307519 4:25496603-25496625 CCTGAGGTGAAGATGGAGAATGG + Intergenic
971864841 4:32156298-32156320 CCTGTTGTGGGGAGGGAGGAGGG - Intergenic
973847911 4:54932032-54932054 CATCAGGAGGAGAGGGAGGAGGG - Intergenic
973906867 4:55540727-55540749 CGTGGAGTGGAGAGGGAGGAAGG + Intronic
974746308 4:66082459-66082481 CCCAAGCTGGAGAAGGAGGAAGG + Intergenic
976538985 4:86251323-86251345 ACTGTGGTGGGGAGGGAGGAGGG - Intronic
976726919 4:88223794-88223816 CCTCATCTGGAGAGGGATGAAGG + Intronic
977248389 4:94660767-94660789 CCTCAGCTGGAGAGGAAGGCAGG - Intronic
978260109 4:106745848-106745870 CCCCAGGTGTAGAGGGATGGGGG + Intergenic
978724621 4:111955854-111955876 CCTGTGGTGGAGAGGGATAAAGG - Intergenic
978919186 4:114161992-114162014 CCCCAGGCAGAGAGGGAAGAAGG + Intergenic
979482046 4:121230686-121230708 TCTGTGGTGGAGAGGGAGGGAGG - Intergenic
980107412 4:128601051-128601073 GCTCAGGTGGTGAGGGAGGGAGG + Intergenic
980292972 4:130869526-130869548 CCCCACGTGCTGAGGGAGGAAGG + Intergenic
981236214 4:142418854-142418876 CATCAGGTGGAGACTGAGCAGGG + Intronic
982452604 4:155570796-155570818 CTGGAGGTGGGGAGGGAGGATGG + Intergenic
982636707 4:157905813-157905835 GCTCAGCTGGGAAGGGAGGAAGG + Intergenic
982767035 4:159360828-159360850 CCTGAAGAGGAGCGGGAGGAAGG + Intergenic
983578917 4:169288268-169288290 CCCCATGTGTAGAGGGAGGGAGG - Intergenic
985151789 4:186954751-186954773 CCACAGATGGAGAGGGAAGTGGG + Intergenic
985485467 5:146121-146143 CCACAGGTTGGGAGAGAGGAGGG - Intronic
985528571 5:420633-420655 CCCCATGTGGAGAGGATGGAAGG + Intronic
985997884 5:3606756-3606778 TCTCGGGTGGGGCGGGAGGAGGG - Intergenic
986883307 5:12202931-12202953 CCTCAAGAGTAGAGGGATGAAGG - Intergenic
987131988 5:14868952-14868974 CCTAAGATGGAGAGGTAGCACGG - Intronic
987204457 5:15610593-15610615 GTTCAAGTGGAGAGGGAGGCAGG - Intronic
987891151 5:23880425-23880447 CCTAAGGGGGAAAGGTAGGAGGG + Intergenic
988018847 5:25597333-25597355 CCCCATGTGTAGAGGGAGGGAGG - Intergenic
989307761 5:39977284-39977306 CCTAAGGAGGACAGGGAGGATGG + Intergenic
989415898 5:41175164-41175186 CATAAAGTGGTGAGGGAGGAAGG + Intronic
990537659 5:56738789-56738811 CCAAAAGGGGAGAGGGAGGAAGG - Intergenic
991425129 5:66482920-66482942 GAACAGGTGGAGAGGGAGGTGGG - Intergenic
991544235 5:67763529-67763551 CCTGATGTGGAGTGGGGGGAGGG + Intergenic
992197830 5:74357259-74357281 CCTCAGAAGCAGAGTGAGGAGGG - Intergenic
992950429 5:81852345-81852367 CCCCGGGTGGGGAGTGAGGAAGG + Intergenic
993531521 5:89030448-89030470 CCTCAGAAGTAGAGGGTGGAGGG - Intergenic
994816270 5:104591779-104591801 TAGCAGGTGGAGAAGGAGGAGGG - Intergenic
997415669 5:133726479-133726501 CTTCTGGAGGAGAGTGAGGATGG - Intergenic
997425191 5:133798340-133798362 ACTCAGGGTGAGAGGGATGAAGG + Intergenic
997511795 5:134459384-134459406 CCTCCGCGGGAGAGGGAGGCAGG + Intergenic
997663576 5:135608740-135608762 CCTTGGGAGAAGAGGGAGGATGG - Intergenic
998113315 5:139518331-139518353 CGTCTGGTTGAGGGGGAGGATGG - Intergenic
998215923 5:140238737-140238759 GCTCAGATGCAGAGGTAGGAAGG - Intronic
998956344 5:147442323-147442345 CCTCAGCAAGACAGGGAGGAAGG + Intronic
999242232 5:150134565-150134587 ACTCAGGCGCAGAGAGAGGATGG - Intronic
999253251 5:150195107-150195129 CCTGGGGATGAGAGGGAGGAAGG - Intronic
999253289 5:150195273-150195295 GCTCAGGAGGAGGTGGAGGAAGG - Intronic
999366125 5:151024613-151024635 CAGCAGCTGGGGAGGGAGGAAGG + Intronic
999699016 5:154211154-154211176 CCTCAGGTATAAAGGCAGGAGGG + Intronic
1000357930 5:160418894-160418916 CCTCAGGTGTTGAGGGAGCGAGG - Intronic
1000410332 5:160930677-160930699 CCTCAGGTGGAGAAAGGGCAGGG - Intergenic
1001642149 5:173252137-173252159 CCTCAGGGGGAGATGGAGTCAGG + Intergenic
1001741743 5:174058578-174058600 CCTGGAGTGGAGACGGAGGAGGG + Intronic
1001893975 5:175362952-175362974 TCTCAGGTGGAAAGGAAGGGAGG + Intergenic
1002205894 5:177562322-177562344 GCTCGCGTGGAGAGGAAGGAAGG + Intergenic
1002318982 5:178364005-178364027 CCTCAGGTGGAGGGGTCTGATGG - Intronic
1003415594 6:5905109-5905131 CCTCAGGTGGTGTGGGCAGAGGG + Intergenic
1003848235 6:10196194-10196216 CCGCAGGCAGAGAGTGAGGAAGG - Intronic
1004125143 6:12865949-12865971 CTTAGGGTGGGGAGGGAGGAGGG - Intronic
1004291753 6:14373932-14373954 CATAAGGGGGAAAGGGAGGAAGG - Intergenic
1004674719 6:17830566-17830588 CTTCAGGTGTAGAGGTGGGATGG - Intronic
1005400053 6:25422863-25422885 CCTCAGGGGCAGAGCAAGGAGGG - Intronic
1005452940 6:25991921-25991943 CCACATCTGGAGAGGGAGGTGGG - Intergenic
1005969539 6:30750461-30750483 CCTGATATGGAGAGGGAGGGAGG - Intergenic
1005981713 6:30841756-30841778 ACTGAGGTGGAAAGGGAGAAAGG - Intergenic
1006300760 6:33192566-33192588 CCCCAGGTGGAGACTGAGGGTGG - Intergenic
1006502173 6:34466078-34466100 GCTGAGGCGGAGAGGGGGGAAGG - Exonic
1006627306 6:35406438-35406460 CCTCAGCTGTAGATGGAGCAAGG + Intronic
1006811307 6:36822192-36822214 CCTCAGGCCAAGAGGAAGGAGGG + Intronic
1006916755 6:37599712-37599734 CGGCAGGTGGTGGGGGAGGAGGG - Intergenic
1006920249 6:37623185-37623207 CCTGGGGTGTAGAGGCAGGAAGG + Intergenic
1007095090 6:39208062-39208084 GCACAGGGGGAGAGGGAGGAGGG - Intronic
1007529084 6:42524741-42524763 CCCCACGTGTTGAGGGAGGAAGG - Intergenic
1009690997 6:67031673-67031695 CCACAGGGGGAGGGGGTGGACGG + Intergenic
1010241321 6:73618363-73618385 CCTCTTCTGGAGAGGGATGAAGG - Intronic
1013819299 6:114135594-114135616 CCCTGGGTGGAGAGGGAGGATGG - Intronic
1014255425 6:119156335-119156357 CCTGACGTGGGGTGGGAGGAGGG + Intergenic
1014363190 6:120506780-120506802 TCTTAGTTCGAGAGGGAGGAAGG - Intergenic
1014533352 6:122587174-122587196 CCTATTGTGGAGTGGGAGGACGG - Intronic
1015250700 6:131124644-131124666 CCTCAGTTAGAGAGCCAGGAAGG - Intergenic
1015556390 6:134465918-134465940 GCTCAGGAGGAAAAGGAGGAGGG - Intergenic
1016071459 6:139744107-139744129 GCACAGGTGGAGAGGGAGTTAGG - Intergenic
1017071164 6:150576539-150576561 CCTCAGGTGGTGAGGGGGGTTGG + Intergenic
1017085023 6:150705720-150705742 CCTCAGGAGCATAAGGAGGAGGG - Intronic
1017142754 6:151206710-151206732 CCTCACGTGGAGAGGAAGAGAGG - Intergenic
1017173030 6:151475758-151475780 CCTCACGTGGAGAAGGCGGACGG + Intergenic
1017770049 6:157638068-157638090 GCCCAGGGGGAGAGGGAGGGAGG + Intronic
1018195867 6:161355930-161355952 ACTGAGATGGAAAGGGAGGAGGG + Intronic
1018683199 6:166281859-166281881 CCCCAGGTGCAGAGGCAGGAGGG - Intergenic
1018846442 6:167560114-167560136 CCACAGGAGAAGAGGGAGGGAGG - Intergenic
1018892293 6:167990623-167990645 CCTCAGGAGCAGAGGGACGGGGG - Intergenic
1019280043 7:194999-195021 CCTTGGGTGGGGAGAGAGGAAGG - Intronic
1019606165 7:1911304-1911326 CCTGAGGAGGAGGGAGAGGAGGG - Intronic
1019943342 7:4308280-4308302 CCGCAGGTGGAGAGAGGGAAAGG - Intergenic
1019981055 7:4622535-4622557 CCCCAGGTGTTGAGGGAGGGAGG + Intergenic
1020007738 7:4791347-4791369 CGGCTGGTGGAGAGGGAGGCCGG + Exonic
1020045362 7:5036502-5036524 CCTCAGGTGCTCAGGGAGCACGG + Intronic
1020727382 7:11832289-11832311 CGCCAGCTGGAGGGGGAGGAGGG + Intergenic
1021108799 7:16670693-16670715 CATTAGGTGGAGTGGGAGGAGGG - Intronic
1022248803 7:28586478-28586500 CTTCAGCTGGAGAGGGAAGGGGG - Intronic
1022644937 7:32221046-32221068 CCTCAGGAGGAAAGGGAGCCAGG - Intronic
1023821895 7:43985310-43985332 CCTGAGGTGTGGAGGGTGGAGGG - Intergenic
1024039074 7:45535517-45535539 TCTCAGGTGGAGAGTGGGGTGGG + Intergenic
1024242247 7:47444640-47444662 CCTCAGCTGCAGAGTGAGAAGGG + Intronic
1025818630 7:64943103-64943125 CTTCTGGTGGAGAGGGAGGCTGG - Intergenic
1026740387 7:72975409-72975431 CCACAGATGGAGAGGGATGATGG + Intergenic
1026797689 7:73376895-73376917 CCACAGATGGAGAGGGATGATGG + Intergenic
1026977033 7:74505337-74505359 CCTCAGATGGAGGGAGAGGCAGG - Intronic
1026982533 7:74535239-74535261 CCTCAGGCAGGGAGGGAGGCTGG + Intronic
1027103344 7:75389661-75389683 CCACAGATGGAGAGGGATGATGG - Intergenic
1027198434 7:76047616-76047638 CCTTAGGCGGGGTGGGAGGAAGG - Intronic
1028472441 7:91219936-91219958 CTTCAGGTGGAGAGGACAGAGGG - Intergenic
1029416171 7:100444628-100444650 TCAAAGGTGGGGAGGGAGGAAGG - Intergenic
1029421557 7:100474518-100474540 GGGGAGGTGGAGAGGGAGGAAGG - Intronic
1029750160 7:102538732-102538754 CCTGAGGTGTGGAGGGTGGAGGG - Intronic
1029768111 7:102637840-102637862 CCTGAGGTGTGGAGGGTGGAGGG - Intronic
1030075715 7:105734563-105734585 CCTCAGCTGGAGGGCAAGGAGGG - Intronic
1031020842 7:116625974-116625996 GCTCAGGTTGAGAGGGTGTATGG - Intergenic
1031985029 7:128158637-128158659 CCAGAGGAGGAGATGGAGGATGG - Intergenic
1032345175 7:131110069-131110091 CCGGAGCTGGAGGGGGAGGAGGG + Intergenic
1032713609 7:134485016-134485038 TCTCAGTAGAAGAGGGAGGAAGG - Intergenic
1033255613 7:139798985-139799007 CGGCAGGTGGAGAAGGAGGCTGG - Intronic
1033643815 7:143286245-143286267 CTACAGGGAGAGAGGGAGGATGG - Intronic
1033974964 7:147089850-147089872 CCTTTGGTGCAGAGTGAGGACGG - Intronic
1034086620 7:148328214-148328236 TTTCAGGTGGAGAGAGGGGAAGG + Intronic
1034401170 7:150862587-150862609 CCTCAGCTCCAGAGGGAGGGAGG - Intergenic
1034422322 7:150996294-150996316 GAACAGGGGGAGAGGGAGGAGGG - Intronic
1034463663 7:151212905-151212927 GCTCAGGTGGCTAGGGTGGATGG - Intronic
1035130668 7:156650313-156650335 TCTCAGGTGAAGCGGAAGGAAGG - Intronic
1035162413 7:156960921-156960943 CCTCATGTGGATTGGGATGAAGG + Intronic
1035782044 8:2235332-2235354 AGCCAGGGGGAGAGGGAGGAAGG - Intergenic
1035874472 8:3172686-3172708 CCTCAGGGGAGGTGGGAGGAAGG + Intronic
1035874701 8:3175593-3175615 CCTCAGGAAGGGAGGGAGGGAGG - Intronic
1036111821 8:5911135-5911157 CATGGAGTGGAGAGGGAGGAAGG + Intergenic
1036656390 8:10679915-10679937 CCTCAGCTGGAGAGTGAGGAAGG + Intronic
1036960226 8:13237610-13237632 ACTCAGGTGGGGAGGTAGGGAGG - Intronic
1037128924 8:15384461-15384483 CCACCAGTGGAGAGAGAGGATGG - Intergenic
1037577975 8:20225772-20225794 CTTCTGGTGGAGGTGGAGGAGGG - Intronic
1037818779 8:22125611-22125633 AGGCAGCTGGAGAGGGAGGAGGG - Exonic
1037826219 8:22162199-22162221 CGCCCGGTGGAGAAGGAGGAAGG + Intronic
1038281341 8:26168045-26168067 CCTCAGAAGGAGAAGGAGGTGGG - Intergenic
1038492995 8:27983238-27983260 TCTCAGGTGGATGGGCAGGAGGG + Intronic
1039031469 8:33314234-33314256 CCTCAGTTGGAGAGGCTGCAGGG - Intergenic
1040287681 8:46108872-46108894 ACTCAGGTGGATATGGAGGCAGG - Intergenic
1041143132 8:54843798-54843820 GCTCAGGTGCAGAGGGAAGCAGG + Intergenic
1041260880 8:56019602-56019624 CCTCAGGTGGGGCCGGTGGATGG + Intergenic
1041719981 8:60966852-60966874 CATTGGGTGGAGAGAGAGGAAGG + Intergenic
1042387210 8:68190592-68190614 CCACTTGTGGAGAGGTAGGAAGG + Intronic
1042920539 8:73915043-73915065 CCGCAGGTTGGGAGGGAGCAAGG + Intergenic
1042971213 8:74410961-74410983 CCCCAGGTGTTGAGGGAGGGAGG + Intronic
1045010847 8:97957201-97957223 CACCAGGTGGAGAAGGTGGAAGG + Intronic
1045506270 8:102780964-102780986 CCTCAGGGAGGGTGGGAGGATGG + Intergenic
1045860500 8:106811032-106811054 CCTCACCTGGAGAGGGAGGTTGG - Intergenic
1045957455 8:107925552-107925574 CCTGATGTGGGGTGGGAGGAGGG - Intronic
1048838960 8:138547841-138547863 GCTTGGCTGGAGAGGGAGGAAGG + Intergenic
1048955401 8:139531924-139531946 ACTAAGGTGGAGAAGGAGAAAGG + Intergenic
1048970839 8:139644152-139644174 CATCAGTTGGACAGGGATGATGG - Intronic
1049285588 8:141773378-141773400 CCACAGGTGCAGAGGGAGAAGGG + Intergenic
1049351653 8:142167847-142167869 GGGCAGGTGCAGAGGGAGGAAGG - Intergenic
1049603123 8:143517286-143517308 CCTCAGGTGCAGGGGAAGGGAGG + Intronic
1050063931 9:1738850-1738872 CCTAATTTGGAGAAGGAGGAGGG - Intergenic
1050951162 9:11596209-11596231 ACTCATGTAGAGATGGAGGAGGG + Intergenic
1052158103 9:25220212-25220234 CTTCAGGTGGAATGAGAGGATGG + Intergenic
1052817434 9:33112312-33112334 CCCCAGGTGGGCAGGGCGGAGGG - Exonic
1052834790 9:33242248-33242270 GCTCAGGTGCATAGGGAGGCGGG + Intronic
1052947408 9:34179255-34179277 CCTCTGGGGGAGGGGGAAGAGGG + Intronic
1052978428 9:34429407-34429429 CCTGAGCTGGTGAGTGAGGAGGG - Intronic
1053546883 9:39032542-39032564 TCTCAGGTGGAATTGGAGGAGGG + Intergenic
1053811202 9:41854195-41854217 TCTCAGGTGGAATTGGAGGAGGG + Intergenic
1054176933 9:61881682-61881704 CCACAGGTGTAAAGGGAGGGAGG - Intergenic
1054619392 9:67333244-67333266 TCTCAGGTGGAATTGGAGGAGGG - Intergenic
1054660601 9:67699124-67699146 CCACAGGTGTAAAGGGAGGGAGG + Intergenic
1054872780 9:70064308-70064330 ACTCAGGTGGAAAGGGGGTAAGG - Intronic
1055961249 9:81822329-81822351 CCAAAGGTGGAGGGGGAGAAGGG - Intergenic
1056461169 9:86810933-86810955 CCTCACATGGAAAAGGAGGAAGG - Intergenic
1056511803 9:87313615-87313637 ATTCAGGGGGAGAGGGAGGTTGG + Intergenic
1058529697 9:105893521-105893543 CCTCTGGAGGTGAGGGAGGGAGG - Intergenic
1058931664 9:109726168-109726190 GCTCAAGTGGAAAGGGAGGCTGG - Intronic
1059309355 9:113377415-113377437 ACCCAGGTTGAGTGGGAGGAGGG + Intergenic
1059563468 9:115358426-115358448 CCTCATGTGTTGAGGGAGGGAGG + Intronic
1060515993 9:124266123-124266145 CCCAAGGTGGAGAGGCAGGTGGG + Intronic
1060907773 9:127323406-127323428 ACTCAGCTGTAGAGGCAGGAGGG - Intronic
1060947598 9:127579285-127579307 CCTAAAGGGGAGAGGAAGGAGGG - Intergenic
1061003722 9:127916817-127916839 CCCCGGGTAGAGAGGTAGGATGG - Exonic
1061232145 9:129321265-129321287 CCTCAGCTGGGCGGGGAGGAGGG - Intergenic
1061368242 9:130183553-130183575 CCACAGCTGGAGAGAGAGAAAGG - Intronic
1061994765 9:134177840-134177862 CCTCGGGTGGCAAAGGAGGAGGG - Intergenic
1062170301 9:135131168-135131190 CCTCTGGGGGACAGGGAGGCCGG + Intergenic
1062459315 9:136656323-136656345 TCCCTGGTGGGGAGGGAGGAGGG - Intergenic
1062581317 9:137230420-137230442 CACCAGGTGGTGGGGGAGGACGG - Intergenic
1185453446 X:295298-295320 CCTGAGGGAGGGAGGGAGGAAGG + Intronic
1185957915 X:4512460-4512482 ACTCAGGGATAGAGGGAGGAAGG + Intergenic
1186250419 X:7660162-7660184 AAGCAGGGGGAGAGGGAGGAAGG + Intergenic
1186670678 X:11764562-11764584 TCTCAGGAAGAGAGGGAAGAGGG - Intronic
1186979119 X:14939939-14939961 CCACAGTGGGAGGGGGAGGAGGG - Intergenic
1187099356 X:16176945-16176967 TCTCTGAGGGAGAGGGAGGATGG + Intergenic
1187871828 X:23771087-23771109 TCTCAGGAGGGGAGAGAGGAAGG + Intergenic
1187872429 X:23775677-23775699 TCTCAGGAGGGGAGAGAGGAAGG + Intergenic
1188137224 X:26504941-26504963 CTTCAGGTAGAGGGGGTGGAAGG - Intergenic
1188137266 X:26505082-26505104 CTTCAGGTAGAGGGGGTGGAGGG - Intergenic
1188869025 X:35351274-35351296 CCAGAGTTGGAGAGGCAGGAAGG + Intergenic
1189627140 X:42910611-42910633 CCTGTCGTGGAGTGGGAGGAGGG + Intergenic
1190072738 X:47292456-47292478 TTACAGGTGGAGAAGGAGGAGGG + Intergenic
1190706906 X:53036581-53036603 CCTCTGGAGGAGAGAGAGGGAGG + Intergenic
1191594164 X:62923640-62923662 AGTCAGGTGGAGAGGGATCAGGG - Intergenic
1192534767 X:71917836-71917858 ATTCAGGAGGAGAGGGAGCAAGG + Intergenic
1194793760 X:98184205-98184227 CCTCAGGTGGGGTGGGGGGTGGG - Intergenic
1195285016 X:103376034-103376056 GCTAAGGTGGGGAGGCAGGAGGG - Intergenic
1195636159 X:107118374-107118396 TCTCAGGTGGAGGTGGAGGTAGG + Intronic
1195681050 X:107546974-107546996 CCTCATGCAGAGATGGAGGAGGG - Intronic
1195811476 X:108836342-108836364 CATAGGGTGGAGAGAGAGGAGGG + Intergenic
1197138791 X:123093451-123093473 CCTCAGTTGGACAGACAGGATGG - Intergenic
1197760420 X:130024216-130024238 CCTGGGGTGGTGGGGGAGGAGGG + Intronic
1197767346 X:130067570-130067592 CCTCAGCTGGTTAGGAAGGAGGG + Intronic