ID: 1085552892

View in Genome Browser
Species Human (GRCh38)
Location 11:77391465-77391487
Sequence CTTCTGGTTTAGATGGAGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 171
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 155}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085552892 Original CRISPR CTTCTGGTTTAGATGGAGCT GGG (reversed) Intronic
900805391 1:4764006-4764028 CCTGTGGTGTAGATGGAGCTGGG + Intronic
904488426 1:30843202-30843224 CTCCTGGTATATAGGGAGCTTGG + Intergenic
905709211 1:40086525-40086547 CTACTGGTTTACAGGGAGGTGGG + Intronic
906177400 1:43786410-43786432 CTTCTTCTTTAGATGTAGCAGGG + Intronic
909512096 1:76464864-76464886 CTTCTGAGTTTGATGGAGCTGGG - Intronic
909960649 1:81836907-81836929 CTGATGGTTTTGATGAAGCTGGG + Exonic
918092506 1:181309668-181309690 CTTCTGGTGTAGAAGGAGGTAGG + Intergenic
1062960307 10:1568247-1568269 ATATTGGTCTAGATGGAGCTTGG + Intronic
1065283132 10:24161133-24161155 CTTGTGGTTTAAATTTAGCTGGG + Intronic
1068727531 10:60320083-60320105 TTCCTGGATTAGAAGGAGCTGGG + Intronic
1068892792 10:62165137-62165159 ATCCTGGTGGAGATGGAGCTTGG - Intergenic
1069742175 10:70691755-70691777 CTTGTGGTCTAGATGGCCCTTGG + Intronic
1070579689 10:77710306-77710328 CTTCTGGTTTTGATGGCGTGAGG - Intergenic
1071919450 10:90332712-90332734 CTTCTGGTGAAGATGAAGTTTGG - Intergenic
1073492255 10:103860608-103860630 CTTCTGCTTTAGATAGGGCAGGG - Intergenic
1073924742 10:108502526-108502548 ATTCCAGTTTAGCTGGAGCTGGG + Intergenic
1074311631 10:112327728-112327750 CTAGTGGTTTAGAAGAAGCTGGG - Intergenic
1075897601 10:126010748-126010770 CTTCTGGTTGACATCAAGCTTGG + Intergenic
1079477268 11:20844263-20844285 CTCATAGTTTAGATGGAGATGGG + Intronic
1081706042 11:45182342-45182364 CTTCTGGTGTAAGTGGAGCTTGG + Exonic
1083246463 11:61431804-61431826 CTCCTGGTTTAGGAGTAGCTGGG + Intronic
1084708372 11:70829234-70829256 TCTCTGGTTTAGATGGGGCAGGG - Intronic
1085552892 11:77391465-77391487 CTTCTGGTTTAGATGGAGCTGGG - Intronic
1085750145 11:79154584-79154606 TGCCTGGTTTGGATGGAGCTGGG - Intronic
1086377330 11:86214733-86214755 CTTCTGATTGAGATGGAGAAAGG - Intergenic
1089353552 11:117835321-117835343 CTTGTGGTTTCGATGGGCCTGGG - Intronic
1090481606 11:127073846-127073868 CTTCTGGCTTAGAGGAACCTGGG + Intergenic
1092448170 12:8577122-8577144 GTTCTGATTTAGTTGGTGCTTGG - Intergenic
1094335208 12:29342476-29342498 ATTCAGTATTAGATGGAGCTGGG - Intronic
1095784865 12:46098962-46098984 CTTCTAGTTTAGTTTGAGATTGG - Intergenic
1096019363 12:48309588-48309610 CTTCTGGTGGTGATGGAGGTGGG + Intergenic
1096106622 12:48999784-48999806 CTGCTGGTTTCCATGGGGCTGGG + Intergenic
1098007785 12:66017470-66017492 CTTCTGTTTTAAATGGAACTTGG + Intergenic
1100098906 12:91078118-91078140 CTTTTGGATGAGATAGAGCTGGG + Intergenic
1100451496 12:94711187-94711209 CTTCAGGTGTAGCTGGATCTAGG - Intergenic
1100475109 12:94928263-94928285 TTCCTGGTTTTGATGGATCTAGG - Intronic
1100693201 12:97061800-97061822 CTTCTGATTTAAATAGAGCCGGG - Intergenic
1101427250 12:104598404-104598426 CTTCTGAGGTAGATGGAGCCAGG + Intronic
1103017936 12:117510168-117510190 CTTTTGGTATTGATGGAACTAGG - Intronic
1103556821 12:121771402-121771424 CTTCTGGTTGGAATGGAGTTGGG + Intronic
1104469659 12:129019271-129019293 CTATTGGTTCAGATGGGGCTTGG - Intergenic
1106055147 13:26230426-26230448 AATCTGTTTTAGATGGACCTGGG + Intergenic
1109391972 13:61705505-61705527 CTGATGGTGCAGATGGAGCTGGG - Intergenic
1112464331 13:99630166-99630188 CTTCTGTTTCAGAAGCAGCTTGG + Intronic
1112811543 13:103224468-103224490 CTTCTTGTTGTGATGGAGATAGG + Intergenic
1117599725 14:57362829-57362851 CTTATTGTTGAGATGGAGCAGGG - Intergenic
1120681852 14:87489570-87489592 TTTCTGGTTAAGATTAAGCTGGG - Intergenic
1122021932 14:98845112-98845134 CTTCTTGGTTAGAAGGAGCCCGG + Intergenic
1125020546 15:34981511-34981533 TTTCCAGTTTAGATGGAGATCGG + Exonic
1127963594 15:63907916-63907938 CTTCTGGTTTACCTGATGCTTGG - Exonic
1129373543 15:75113137-75113159 CTTCTGGCTCAGATGGAGGCAGG - Intronic
1130562471 15:84969421-84969443 CTTCTGGATCAGCTGCAGCTGGG + Intergenic
1130605921 15:85316650-85316672 CTTCTGGTTGAGATGAAGCTTGG - Intergenic
1130880795 15:88054087-88054109 CCTCTGGTTTATATTGAACTGGG - Intronic
1131211363 15:90499750-90499772 CTTCTGGTTGATTTGGAGTTAGG - Intronic
1134384856 16:13762178-13762200 TTTCTGATTTAGATGGCACTTGG - Intergenic
1134849308 16:17468088-17468110 AGTCTGGTATAGCTGGAGCTTGG - Intronic
1140379366 16:74472437-74472459 CTTCTGCTTTAGAAAGAGCCAGG + Intronic
1140518413 16:75561414-75561436 CTTCTGGAATAGATGGATCTAGG + Intergenic
1141590527 16:85065816-85065838 CTGCTGGTTTAGAAGGTACTGGG - Intronic
1141880504 16:86855867-86855889 CTCCTGATCTAGATGGAGTTGGG - Intergenic
1142188277 16:88705216-88705238 CTCCTGGTACAGAGGGAGCTGGG - Intronic
1143486416 17:7257550-7257572 CCTCTGGTGTAGCTGGAGGTGGG + Intronic
1147640300 17:41993675-41993697 TTTCTTCTTTAGATGGTGCTTGG - Intronic
1147901875 17:43792094-43792116 CTGCTAGTTGAGATGGGGCTTGG + Intergenic
1148076823 17:44941938-44941960 CTTCTTGCTGAGATGGTGCTGGG + Intronic
1149723186 17:58866028-58866050 CTTGTGGTTTAGATGCAGAGAGG + Intronic
1150622050 17:66814880-66814902 CTCCTGGGGTAGGTGGAGCTGGG - Intergenic
1152014565 17:77741928-77741950 CTGCTGCTTTAGAGGGAGCCAGG - Intergenic
1152448047 17:80357495-80357517 CTTCTTGTTTAGTTTGATCTGGG + Intronic
1155164369 18:23220647-23220669 ATTTTGGTGAAGATGGAGCTCGG + Intronic
1156478070 18:37419028-37419050 CCTCTGGTATGGCTGGAGCTGGG + Intronic
1158000196 18:52609505-52609527 CTTCTTCGTTGGATGGAGCTGGG + Intronic
1159861391 18:73653392-73653414 CTTCTGGTTTATAAGAAGCTAGG + Intergenic
1160053649 18:75459637-75459659 CATCAGCTTCAGATGGAGCTGGG + Intergenic
1161773396 19:6243413-6243435 CTTCTGGGAGAGATGGAGCCAGG + Intronic
927862863 2:26570983-26571005 TTTCTGGCTTAGGTGGAGGTTGG + Intronic
928088343 2:28359367-28359389 CTTCTGGTTTATCTGGAGGAAGG + Intergenic
933351365 2:81156271-81156293 CTTATGGTTTAGAGAGAACTTGG - Intergenic
934120798 2:88837557-88837579 CATCTGGTTTTGATAGAGCAAGG + Intergenic
934147413 2:89108979-89109001 TTACTGGTTTACATGCAGCTGGG - Intergenic
934221858 2:90091613-90091635 TTACTGGTTTACATGCAGCTGGG + Intergenic
935598162 2:104896152-104896174 CTTCTGGCTTCCTTGGAGCTGGG - Intergenic
935811792 2:106805734-106805756 CTTCTAGTTTGGAAGGAGCAAGG + Exonic
939769549 2:146298716-146298738 CCTTTGGTTTGCATGGAGCTGGG + Intergenic
939888047 2:147702781-147702803 ATTATGTTTTAAATGGAGCTAGG + Intergenic
939958472 2:148546179-148546201 CTTCTGGATCCGAGGGAGCTTGG + Intergenic
940824386 2:158394314-158394336 ATTTTGGTTCAGATGCAGCTTGG - Intronic
946388707 2:219402264-219402286 ATTCTGATATAGATGCAGCTGGG + Intergenic
946806871 2:223479666-223479688 CTTCTGGGTTATATGGATCCTGG - Intergenic
948719387 2:239889154-239889176 CCTTTGGGTGAGATGGAGCTGGG - Intergenic
1172692875 20:36802757-36802779 CTTCAGGTATAGCTGGATCTAGG - Intronic
1173205641 20:40991150-40991172 CTTTTGGGTTGGAGGGAGCTGGG - Intergenic
1175784526 20:61704257-61704279 CTTCTGCTTGGGAAGGAGCTGGG - Intronic
1177505067 21:22008943-22008965 CTTCTGGTTTTGAAGCAGATGGG + Intergenic
1180706204 22:17811531-17811553 CTTCTGTTCTCGATGGCGCTAGG - Intronic
1183109272 22:35637123-35637145 CTTCAACTTGAGATGGAGCTGGG - Intronic
1183471044 22:38006871-38006893 GGTCTGGATTAGAAGGAGCTTGG + Intronic
949901730 3:8820744-8820766 CCTCTGGCTGAGATGCAGCTTGG + Intronic
950048250 3:9964618-9964640 CATCTGGTTTAAATGGTGCATGG + Intronic
951814389 3:26737194-26737216 CTTCTGGATAATATGGAACTTGG - Intergenic
951975792 3:28506774-28506796 ATTCTGGTATAGTAGGAGCTTGG - Intronic
952909676 3:38172279-38172301 ATTCAGGTTTAGATGGATTTAGG + Intronic
954578934 3:51692594-51692616 CTGCTCGTACAGATGGAGCTGGG - Intronic
956656795 3:71560095-71560117 CTTCAGGTACAGATGGAGCCAGG - Intronic
957553948 3:81741982-81742004 CTACTGGTTTACATTGAGGTAGG - Intronic
965361337 3:167742675-167742697 CTTCTGTGGTAGATGGAGCAGGG + Intronic
967457089 3:189700984-189701006 TTTCTGGTTTGGATGGGCCTTGG - Intronic
970383988 4:15537783-15537805 CTTCTGGTTGAAATGGGGCTGGG + Intronic
973725750 4:53773997-53774019 CTGCTTGTTTAAAAGGAGCTTGG - Intronic
974809951 4:66933462-66933484 TTTCTAGTTTTGATGGAACTGGG + Intergenic
975860236 4:78669370-78669392 CTGCAGTTTTTGATGGAGCTAGG - Intergenic
979491197 4:121329976-121329998 CTTCCAGTTTACATGAAGCTTGG - Intronic
984214930 4:176899341-176899363 CTTGTGAAATAGATGGAGCTAGG + Intergenic
984684714 4:182653970-182653992 CATCTAGTTTAGATGGAACAGGG + Intronic
986232885 5:5883308-5883330 CTTCTTTTTCAGATGGAGCTTGG - Intergenic
987566611 5:19596445-19596467 ATTCTGGTTTAGTTGGACCTTGG - Intronic
987883044 5:23774684-23774706 CTTCTGGCTTTGAAGGAGCCTGG - Intergenic
991461067 5:66859651-66859673 GTTCTGGTTTTGAGGAAGCTGGG + Intronic
995490831 5:112690219-112690241 CTTCTGGCTCAAATGAAGCTTGG + Intergenic
996062804 5:119050585-119050607 CTTCTGTTTTAAATGGAACTTGG - Intronic
1001391524 5:171383295-171383317 TTCCTGGTTCAGACGGAGCTTGG - Intergenic
1002183876 5:177444974-177444996 CATGTGGTTTAGACGGGGCTGGG + Intergenic
1003398066 6:5770188-5770210 CTTCTGATTGAGCTGGACCTAGG - Intronic
1004907894 6:20253627-20253649 TTTCTGGTTTACACGGTGCTTGG - Intergenic
1005488306 6:26322320-26322342 CTTCTCCTTTGGCTGGAGCTCGG + Intergenic
1005519339 6:26584939-26584961 CTGCTGGATTAGAAGGAGTTAGG + Intergenic
1005793305 6:29330057-29330079 CATCTGGTTTAGCTGAAGCCTGG + Intergenic
1006460647 6:34155673-34155695 CTTCTGGGATAGCTGGAGCCTGG - Intergenic
1007245584 6:40459767-40459789 CTTGTGGTTTGGATGGAGGGAGG + Intronic
1007360159 6:41349664-41349686 CTTCTGGTCTCTGTGGAGCTGGG - Intronic
1007418367 6:41705281-41705303 CTCATTGTTCAGATGGAGCTGGG - Intronic
1008753875 6:54770457-54770479 ATACTGGTTTAGATGAAGCTGGG + Intergenic
1012317908 6:97802795-97802817 CTTCTGCTTTAGCTGAAGCTGGG + Intergenic
1012903932 6:105042127-105042149 CTTGTGGTTTAGATGGGGGTGGG - Intronic
1012967961 6:105695871-105695893 CTGCTGGTTTGGCTGGAGGTAGG + Intergenic
1013738753 6:113259099-113259121 CTTCTCTTTAAGATGGAGTTAGG + Intergenic
1014835660 6:126157403-126157425 CTTTTGGTTTAGCAGGAGCCAGG - Intergenic
1015919753 6:138254947-138254969 ATTCGTGTTGAGATGGAGCTAGG - Intronic
1016112861 6:140247573-140247595 TTTCTGACCTAGATGGAGCTTGG + Intergenic
1017494729 6:154973593-154973615 CTTCTCTTTTAGATGGAGTCTGG - Intronic
1018068581 6:160141338-160141360 CTTTAGGTTTAAATGTAGCTTGG - Intronic
1019142797 6:169958865-169958887 GTTCTGGACTAGATGGAGGTGGG + Intergenic
1020167939 7:5823002-5823024 CTTCTGGTTGACACAGAGCTGGG - Intergenic
1024570382 7:50718174-50718196 CTTCTTGATTTGAGGGAGCTTGG - Intronic
1028679079 7:93504846-93504868 CGTCTGCTTTAGATAGAACTTGG - Intronic
1028781815 7:94745882-94745904 CTTCTGGTTTCAAGGGATCTTGG - Intergenic
1028982275 7:96980039-96980061 CTTCTGGTTTAACTGGAAGTTGG - Intergenic
1032263007 7:130351616-130351638 ATTTTGGCTTAGAGGGAGCTGGG + Intronic
1033111350 7:138580586-138580608 CTTCTGGTTTAGATAAGTCTCGG - Exonic
1037093631 8:14954583-14954605 CTACTGGCTTTGATGGAGCAAGG + Intronic
1039251394 8:35668808-35668830 CTTCTTGTTGAAATGGAGCCTGG + Intronic
1039584611 8:38695654-38695676 CTTTTTGGTTAGATGGGGCTTGG - Intergenic
1041567712 8:59299109-59299131 CTTTTGGCTTAGCTGTAGCTGGG + Intergenic
1044248640 8:89980842-89980864 CTTCTTGTTTAGATGTCTCTGGG - Exonic
1044363790 8:91319604-91319626 CTTTTGTTTGAGCTGGAGCTTGG - Intronic
1044737962 8:95298238-95298260 TTTGTGGTTAAGATGAAGCTGGG + Intergenic
1047189199 8:122662454-122662476 CTTTTGTTTTTGATGGAGCAAGG - Intergenic
1047788849 8:128181756-128181778 CTTCTGGTCTGGATTGGGCTTGG - Intergenic
1055886791 9:81072686-81072708 TTTATGGTTTAGATGGAAATGGG - Intergenic
1058598110 9:106637865-106637887 CTACTGCTTTAAATGAAGCTGGG - Intergenic
1059297757 9:113287242-113287264 TTTCTGGAATAAATGGAGCTAGG - Intronic
1060003331 9:119978266-119978288 CTACTGGTTTGGCTGGAGGTGGG - Intergenic
1061452393 9:130675351-130675373 CTTCTGGGGGAGATGGGGCTGGG + Intronic
1061636519 9:131913725-131913747 TATCTGGTTCAGATGGAGTTGGG - Intronic
1189406357 X:40728703-40728725 ATTTTGGTTCAGTTGGAGCTTGG - Intronic
1193583966 X:83297977-83297999 CTTCTGGTTTTGATGTATTTTGG - Intergenic
1194436546 X:93874279-93874301 CTTCTGGGCTAGGTGGATCTAGG - Intergenic
1199771063 X:150975704-150975726 CTTCTGGATGGGATGGGGCTTGG + Intergenic
1200135154 X:153871209-153871231 CTCCTGGTCCAGATGGTGCTAGG + Intronic
1201245964 Y:12004025-12004047 GTTCTTGTTTAAATGAAGCTGGG + Intergenic