ID: 1085553269

View in Genome Browser
Species Human (GRCh38)
Location 11:77395207-77395229
Sequence TGCTTTGGGAATATGGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 473
Summary {0: 1, 1: 0, 2: 7, 3: 51, 4: 414}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085553269_1085553277 -6 Left 1085553269 11:77395207-77395229 CCCTCCTCCATATTCCCAAAGCA 0: 1
1: 0
2: 7
3: 51
4: 414
Right 1085553277 11:77395224-77395246 AAAGCAATGGGTAACTTTCCAGG 0: 1
1: 0
2: 2
3: 19
4: 161

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085553269 Original CRISPR TGCTTTGGGAATATGGAGGA GGG (reversed) Intronic
901810655 1:11765355-11765377 TGCTCTGGGAACATGGAGAGGGG - Intronic
902948757 1:19864122-19864144 TGTTTTGGGAATAAAGAGGAGGG - Intergenic
903764493 1:25725397-25725419 TGCTACGGGAATACAGAGGAAGG + Intronic
903788162 1:25875111-25875133 TGCTTGGAGAAAATGAAGGATGG - Intergenic
903963295 1:27070778-27070800 GGCTTTGGGAAGCTGGAGAAGGG - Intergenic
904571075 1:31465650-31465672 TGCTCTTGGAAGATGGAGGCTGG - Intergenic
904860236 1:33532485-33532507 TGCTGTAGGAATGAGGAGGAAGG - Intronic
905130985 1:35757164-35757186 TGCATTGGGAACCTAGAGGAAGG - Intronic
906024767 1:42664328-42664350 TTCTCTGGGAATCTGGAGGTGGG - Intronic
906669972 1:47647343-47647365 TGTATTGGGAATTAGGAGGAAGG + Intergenic
906741183 1:48187015-48187037 TTCTTTGGGAAAATGGACAAAGG + Intergenic
906964698 1:50444897-50444919 TGCCTTGGGGAAATGGAGGTAGG + Intronic
907513596 1:54979965-54979987 TGATTTGGGAGCCTGGAGGAAGG - Intergenic
909037723 1:70613283-70613305 AGCTTTGGGGAGATGAAGGAAGG + Intergenic
909328530 1:74383523-74383545 TGCTGTGGGAACGTGTAGGAGGG - Intronic
909467926 1:75994624-75994646 TGTTTTGGGGACATGGAGGCAGG + Intergenic
909786347 1:79618655-79618677 AGTATTGGGAATAAGGAGGATGG + Intergenic
910104451 1:83616404-83616426 GGCTTTGTGAGTATAGAGGAGGG - Intergenic
910208677 1:84772945-84772967 TGCTTCAGGTATCTGGAGGAGGG - Intergenic
910894435 1:92053276-92053298 CCCTGTGGGAAGATGGAGGAGGG + Intronic
911654485 1:100427857-100427879 TGTTATGGGAATACTGAGGAAGG + Intronic
911899863 1:103489019-103489041 TGCTTAGGGGATTTGGAGGAGGG + Intergenic
912372528 1:109185029-109185051 TGCTTTGGCAATTTAGAGAAAGG + Exonic
912651169 1:111440937-111440959 TGCTTAGGGAAGATGTAGGATGG + Exonic
913573049 1:120140742-120140764 TGCTTTGAGCTTTTGGAGGATGG - Intergenic
914294310 1:146305539-146305561 TGCTTTGAGCTTTTGGAGGATGG - Intergenic
914555354 1:148756322-148756344 TGCTTTGAGCTTTTGGAGGATGG - Intergenic
914753797 1:150552119-150552141 AGCTCAGAGAATATGGAGGAGGG - Intronic
916667152 1:166976500-166976522 TGCCTTGGGAACATAGAGGAAGG + Intronic
916934943 1:169618015-169618037 TGCTGTGGGAGCCTGGAGGAAGG - Intronic
917957978 1:180119695-180119717 TACTTTGGGAAGACAGAGGAAGG + Intergenic
920832208 1:209475667-209475689 TGCTATGGGAGCATGGAGGAGGG - Intergenic
920883457 1:209901246-209901268 TGCTTTGGGTTTATGGAGATGGG - Intergenic
922607920 1:226902421-226902443 TGTTCTGGGAATGGGGAGGATGG + Intronic
923850823 1:237792511-237792533 TGCATGGGGCAAATGGAGGAAGG + Intronic
924324298 1:242880055-242880077 TTCTTTGGGAGTATGCAGTAGGG + Intergenic
924668943 1:246103539-246103561 GGCTCTGGGAATTTAGAGGAGGG - Intronic
924683789 1:246266367-246266389 TACTTTAGGAATACAGAGGAAGG - Intronic
1062781716 10:217083-217105 TGCTTTTGGATTATTGATGAGGG + Intronic
1063503229 10:6573487-6573509 TGCTTTGAGAACATGTAGAAGGG - Intronic
1064300717 10:14120373-14120395 TGCTCTGGGAGTATGGGAGAGGG - Intronic
1064502742 10:15992262-15992284 TGCTTTGGGAACACAGGGGAAGG - Intergenic
1064818866 10:19300684-19300706 TGGTTTTTGAATATGGAGTAAGG - Intronic
1065830567 10:29610320-29610342 TGCTGTGGCCCTATGGAGGATGG - Intronic
1067076170 10:43184587-43184609 TGATTTGAGAAAAGGGAGGAGGG + Exonic
1068066987 10:52144001-52144023 TACTTGGGGAACATTGAGGATGG + Intronic
1068583729 10:58773063-58773085 GCCTTTGGGGAAATGGAGGAGGG + Intronic
1068650455 10:59516904-59516926 TGCTCTGGGAGAATGAAGGAGGG - Intergenic
1069070993 10:63990539-63990561 TTCTTTGGGAAAATGGACAAAGG - Intergenic
1069482688 10:68798005-68798027 TTCTTTAGGAATATGCAGGATGG + Intergenic
1070371842 10:75789939-75789961 TGCTTTGGGAAAATGGCAGCAGG + Intronic
1070538278 10:77395611-77395633 TGCATTGGCAATCTCGAGGAGGG + Intronic
1071155800 10:82687580-82687602 TGGTTTGGGAAGATAGAAGAGGG + Intronic
1072543348 10:96414897-96414919 TGGTCTGGGAACAAGGAGGAGGG - Intronic
1073261314 10:102192651-102192673 TGCTTAGGGGTCATGGAGGAGGG - Intergenic
1073437103 10:103524905-103524927 TGCTTTGGCTATATGGGGGGTGG + Intronic
1074186901 10:111105614-111105636 TGCTGTGGGAATACAGATGATGG - Intergenic
1074366350 10:112860570-112860592 AGCTTTGGGAAAATAGAGAAGGG - Intergenic
1074727004 10:116321409-116321431 TGCTATGGGAATATAGGAGAGGG - Intergenic
1076048312 10:127312687-127312709 TGCTTTTGGTAAATAGAGGAGGG - Intronic
1077346172 11:2056368-2056390 TGATTATGGAGTATGGAGGATGG - Intergenic
1078539889 11:12204871-12204893 TGCTAAAGGAATTTGGAGGAAGG + Intronic
1078645466 11:13137948-13137970 TGCTATAGGAACATGGAGGAGGG + Intergenic
1079149163 11:17882510-17882532 TGCTGTGGGAATAGCCAGGACGG - Intronic
1079187807 11:18253239-18253261 TGCTTTGGGCAGGTGGAAGAAGG - Intergenic
1080730263 11:34943880-34943902 TGCTTTGGGAATGTTCAGGAGGG - Intronic
1080819380 11:35790763-35790785 AGCTTTTGGAATATTGAGGTTGG + Intronic
1080890985 11:36409093-36409115 TGCTGGGGGCATGTGGAGGATGG + Intronic
1081205034 11:40265121-40265143 TGCTATGGGAAAATGGAAGGAGG - Intronic
1082934032 11:58638230-58638252 TTCTATGGGAAAATGAAGGAGGG - Intergenic
1082959159 11:58902472-58902494 TGTTCTGGGAATACAGAGGAAGG - Intronic
1082965809 11:58965141-58965163 TGTTCTGGGAATACAGAGGAAGG - Intronic
1082974699 11:59060053-59060075 TGTTCTGGGAATACAGAGGAAGG - Intergenic
1083103871 11:60338044-60338066 TGGTTTGGGCATCTGGAGGAAGG + Intronic
1083181621 11:60989472-60989494 TGCTTGAGGAACCTGGAGGAGGG - Intronic
1084111154 11:67014893-67014915 TGCCTTGGGTATATGCAGGGTGG + Intronic
1084811287 11:71613259-71613281 TGGTTTGGGAATAGGTAGGAGGG - Intergenic
1085262540 11:75215810-75215832 TGCATTGGAGATTTGGAGGAGGG - Intergenic
1085553269 11:77395207-77395229 TGCTTTGGGAATATGGAGGAGGG - Intronic
1085724127 11:78939614-78939636 TGCTATGGGAACATAGAGAATGG - Intronic
1085782158 11:79419385-79419407 GCCATTGGGAACATGGAGGAAGG - Intronic
1086010129 11:82092555-82092577 TGCTTTAGGAATATAGGGTAAGG - Intergenic
1086224994 11:84497185-84497207 TCCTATGGGAAGAGGGAGGAAGG - Intronic
1087402846 11:97689455-97689477 GGCATTGGGATTAGGGAGGAAGG - Intergenic
1088564382 11:111152469-111152491 TGCTATGGGACTCTAGAGGAGGG + Intergenic
1089010009 11:115124446-115124468 GGGTTTGGGAAGATTGAGGAGGG + Intergenic
1089777180 11:120846432-120846454 TTCTTTGGGAGTTTGGATGAGGG + Intronic
1089892466 11:121895095-121895117 TGCTGTGGGAATTTAGAGAAGGG + Intergenic
1091039346 11:132262189-132262211 TTCTCTGGGACTATGGTGGAAGG - Intronic
1091488209 12:909932-909954 TGTTTCGGGAATAGTGAGGAGGG + Exonic
1091863179 12:3805468-3805490 GGCTTTGGGGATATGGGGAAGGG - Intronic
1092026306 12:5243623-5243645 TGCTTTGGGAGCATGAAGGCTGG - Intergenic
1092047575 12:5442999-5443021 GGTTTTGGGAGTTTGGAGGAAGG + Intronic
1093522001 12:20061798-20061820 TTGTTTGGGAAAATGGAGGCTGG + Intergenic
1093609734 12:21138860-21138882 TGCTATGGGTATATTGAGAATGG + Intronic
1094133231 12:27097457-27097479 TGCTTCGGGAACAGGGAGTAGGG - Intergenic
1094599302 12:31894470-31894492 TGCTTTGGGAGGCTGGAGGCAGG - Intergenic
1094784563 12:33831667-33831689 TACTATGGGAATAAGTAGGAAGG - Intergenic
1095449272 12:42312457-42312479 CACATTGGGAATATTGAGGAAGG + Exonic
1095818743 12:46453516-46453538 TCCTTTGGGAAGGGGGAGGATGG + Intergenic
1095854238 12:46842803-46842825 TGCCCTGGGAAAAAGGAGGATGG + Intergenic
1096628164 12:52907741-52907763 TGCTTGGGGCATCTGGGGGAAGG - Intronic
1097168549 12:57099110-57099132 TGCTCTGGGGTTAGGGAGGAAGG + Intronic
1097202856 12:57294345-57294367 GGGTTTGGGAAAATGGAGAAGGG + Intronic
1101026319 12:100609909-100609931 TGCTGCTGGAAGATGGAGGAAGG + Intronic
1101833190 12:108275177-108275199 GGCTTTGGGCATATGGAAGGTGG - Intergenic
1102195702 12:111023781-111023803 TGGTTTGGGAGGAAGGAGGAGGG + Intergenic
1102771291 12:115479343-115479365 TGCTTTGAGAATGTGATGGAAGG - Intergenic
1103174090 12:118846756-118846778 TGCTTAGGGAATTCAGAGGAGGG + Intergenic
1105397821 13:20056740-20056762 GGCTTTGGCAACATGAAGGAAGG + Intronic
1106436198 13:29724924-29724946 TGCTTTTGGAGTGTTGAGGAAGG - Intergenic
1107827450 13:44341472-44341494 AGCTTTGAGAATAAAGAGGAGGG + Intergenic
1108103395 13:46982686-46982708 GGGTTTGGGGATAGGGAGGAAGG - Intergenic
1110538695 13:76682673-76682695 TGCTATGAGAACATGGAGAAGGG - Intergenic
1110721438 13:78766665-78766687 GGCTTTGGTTATATGGATGAAGG - Intergenic
1110798625 13:79669703-79669725 TGGCTGGGGGATATGGAGGAGGG - Intergenic
1111019384 13:82427313-82427335 TGCTTTGGGAACATAGAAGGAGG + Intergenic
1112103341 13:96214267-96214289 TCATTTGGGGATATGGTGGATGG + Intronic
1112452414 13:99524526-99524548 TGCTTTTGGAGTTTGGAGAAGGG + Intronic
1112783813 13:102929951-102929973 TGCTTTGGGAAGAATGAGGTAGG - Intergenic
1112837435 13:103533324-103533346 TGCTTTGGGCATACTGAGGCAGG + Intergenic
1114136617 14:19859103-19859125 TAGTTTTGGAATATAGAGGAGGG + Intergenic
1114543377 14:23480495-23480517 TGCTTGGGGAACACTGAGGATGG + Intronic
1115053962 14:29099629-29099651 TGCCTGGAGAATAGGGAGGAAGG - Intergenic
1115343054 14:32312625-32312647 CCCTTAGGGAAAATGGAGGAGGG - Intergenic
1115649716 14:35394358-35394380 TGTTCTGGGAAGATGGTGGAAGG - Intergenic
1117885210 14:60354194-60354216 TGCTTTGGGAAAAGGGAGCAAGG + Intergenic
1119703887 14:76772393-76772415 AGCTTTGGGGATAGGGAGGGTGG - Intronic
1120835593 14:89035988-89036010 TGCTGTGGGGACATGGAGTAGGG + Intergenic
1121145820 14:91581416-91581438 AGCTCTGGGAATGTGGAGGAGGG + Intronic
1121348943 14:93157346-93157368 TGCTAAGGGAATCTGGAGGCCGG + Intergenic
1121812205 14:96901104-96901126 TGCTATGGGGATTTAGAGGAAGG - Intronic
1122096240 14:99374940-99374962 GCCTTTGGGAATCTGGAGGAAGG + Intergenic
1122415882 14:101549248-101549270 TCCTTTCGGAACATGGAGGCCGG - Intergenic
1123217921 14:106829957-106829979 TACTTAGGGAAGATAGAGGATGG + Intergenic
1124160589 15:27265145-27265167 TTTTTTGGTAAAATGGAGGAGGG - Intronic
1126834455 15:52645503-52645525 TGCTATGGGAATATTTAGGAGGG + Intronic
1126891217 15:53206405-53206427 TGCCGTGGGAAGATGGAGGCAGG - Intergenic
1127658176 15:61075261-61075283 AGCTTTAGGAATCTGGAGGGAGG + Intronic
1129303626 15:74642060-74642082 GGCTTTAGGAATATGCAGGTAGG - Intronic
1130037737 15:80377017-80377039 TGCTATGGGCATCTTGAGGAAGG + Exonic
1130293908 15:82629528-82629550 TGCTTTGGGCATCTGGTGGATGG - Intronic
1131678551 15:94697610-94697632 TGCAATGGCAATATGGAAGAAGG + Intergenic
1131984387 15:98026869-98026891 TGATTTGGGTATATGGTGTAAGG - Intergenic
1133479202 16:6153505-6153527 GACTTTGGGAACTTGGAGGAAGG - Intronic
1133594610 16:7279603-7279625 TGTTCTGGGAATAGAGAGGAGGG + Intronic
1133969306 16:10555930-10555952 TTGTTTGGAAATATGGAGAAGGG - Intronic
1134035258 16:11025135-11025157 TACTCAGGCAATATGGAGGAAGG + Intronic
1134059476 16:11190530-11190552 GGCTGTGGGAATGTCGAGGATGG - Intergenic
1134236301 16:12468776-12468798 GGGTTTGGGAAAATTGAGGAGGG + Intronic
1134323365 16:13184158-13184180 TGGTTTGGGAAGAGGCAGGATGG + Intronic
1134781867 16:16905531-16905553 AGCTATGGGAATATCAAGGAGGG - Intergenic
1135849794 16:25952961-25952983 TGCATTGGAAAGATGTAGGATGG - Intronic
1137846757 16:51697561-51697583 TGCTGTGGGCACATGGGGGATGG - Intergenic
1138117597 16:54372831-54372853 TTCCTTGGGAATCTGGAGAAGGG - Intergenic
1138395175 16:56698485-56698507 TGCTCTGTGACCATGGAGGAGGG - Intronic
1142677126 17:1520745-1520767 TGCTTTGGGAACATGGGGCAGGG + Intronic
1142933329 17:3307137-3307159 TGCTATGGGAAGACAGAGGAAGG + Intergenic
1143690403 17:8558342-8558364 TGCTATGGGAACATAGAGAAAGG + Intronic
1144793197 17:17873374-17873396 TGCTTTGGGAGTCTTGAGGAGGG - Intronic
1146106300 17:30040249-30040271 TGGTTTTGGAAGATGGAGGCTGG - Intronic
1146834009 17:36095212-36095234 TGCATAGAGAATATGGAAGAAGG - Intergenic
1147542553 17:41372837-41372859 GGCTTTGGGAAGAAGGAGGGAGG - Intronic
1148627581 17:49081537-49081559 GACTTTGTGAATATCGAGGAAGG - Intergenic
1149299082 17:55287739-55287761 TACTTTGGGAGTTTGGAAGATGG - Intronic
1150016263 17:61560454-61560476 TGCTTGGGAAGAATGGAGGATGG + Intergenic
1150697592 17:67419147-67419169 TGCTTGGGGGAGAAGGAGGAAGG + Intronic
1150709170 17:67515271-67515293 TCCTCTGGGAATGGGGAGGAAGG + Intronic
1151358633 17:73575080-73575102 GGGTTTGGGAATCTGGAAGATGG + Intronic
1151428171 17:74044760-74044782 TGCTCTGTGAATATTAAGGAAGG + Intergenic
1151984352 17:77532484-77532506 TGCTCTGGCAATCTGAAGGAAGG - Intergenic
1153129120 18:1834497-1834519 TGCTATGGGAAGATGGGGGGAGG - Intergenic
1154460888 18:14584115-14584137 TAGTTTTGGAATATAGAGGAGGG + Intergenic
1154975860 18:21456902-21456924 TCCTTTCGTAACATGGAGGAAGG + Intronic
1155192206 18:23439990-23440012 TGATATGTGAATACGGAGGAAGG - Intergenic
1155313166 18:24544876-24544898 TGTTGTGGGAGTTTGGAGGAAGG + Intergenic
1155777688 18:29788836-29788858 TACTTTGGTAATATGAAAGAGGG + Intergenic
1155807249 18:30187262-30187284 TGCTTTGGGATGATGTTGGAAGG - Intergenic
1156004320 18:32421707-32421729 AGCTTGGGTAATATGGGGGAAGG - Intronic
1156803286 18:41145010-41145032 TGCTTAGTGAAGATGGAAGAGGG + Intergenic
1158795152 18:60837260-60837282 TGCTTTGGGTATCTGGACAAAGG - Intergenic
1158927576 18:62284667-62284689 GGCTTTGGGAGTTTGGAGGATGG + Intronic
1159793305 18:72811365-72811387 TTCTTTTGGAATATGGAAGCTGG - Intronic
1160411921 18:78680988-78681010 TGCTTTCTGAATATGGAGGCAGG - Intergenic
1160754816 19:751624-751646 TGGTTTGGGGACACGGAGGAGGG + Intronic
1162158592 19:8696301-8696323 TGTTTTGGGAAGATGGATGGGGG + Intergenic
1163064907 19:14785604-14785626 TGTTTGGGGAATAGTGAGGAAGG - Intergenic
1163167100 19:15506074-15506096 TGCCTTGGGAAGACGGTGGATGG - Intergenic
1163658059 19:18559311-18559333 TTCTTTGGGAATGTGGAGACTGG + Exonic
1163929365 19:20374269-20374291 TGGTTTTGGAAGATGGAGGCTGG - Intergenic
1164723210 19:30446901-30446923 GGCTTTGGAAATATGGATGAAGG - Intronic
1165303252 19:34986193-34986215 AGCATGGGGAATATGGAGAAGGG + Intergenic
1166035498 19:40165267-40165289 TGCTATGGGAGTAAGGAAGAGGG - Intergenic
1167857950 19:52257830-52257852 TGCTTAAAGAACATGGAGGATGG - Intergenic
926575640 2:14577405-14577427 TGCTTTGGTGATTTTGAGGATGG + Intergenic
926635219 2:15171226-15171248 TGCCTTGGGAGTATGGAGGAAGG - Intronic
926651265 2:15348911-15348933 TGCTTAGGGAATATAGAGAACGG + Intronic
926731841 2:16041541-16041563 GACTTTGGGAAAATGGAGAAGGG + Intergenic
928667218 2:33561526-33561548 TGTTTAGGGAATAAGGAAGAAGG + Intronic
928693937 2:33829682-33829704 TGCTTTAGGATCAGGGAGGAGGG + Intergenic
928936249 2:36681533-36681555 TGTCTTGGTAATATGGATGATGG + Intergenic
929215733 2:39410148-39410170 TAGTTTGGGATTGTGGAGGAGGG + Intronic
929527709 2:42721283-42721305 TGCGTTGGGCACTTGGAGGAAGG + Intronic
929571908 2:43028009-43028031 TGCTCTTTGAAGATGGAGGAAGG - Intergenic
929572822 2:43033370-43033392 TGCTCTTTGAAGATGGAGGAAGG + Intergenic
931129894 2:59323485-59323507 TGCTTTTGGGATATGGGGCATGG + Intergenic
931638725 2:64362976-64362998 AGCTTTGGGAATGAGGAAGAAGG - Intergenic
931642908 2:64397041-64397063 TGCTATGGGAATTTGCATGAGGG - Intergenic
931658485 2:64532799-64532821 TGTTTTGGGAAAATTGAGTAAGG + Intronic
934126116 2:88892509-88892531 TGCATAGGGGATAGGGAGGAAGG - Intergenic
934690198 2:96352656-96352678 TGCATTGGAAATGTGCAGGAGGG - Intronic
934960942 2:98672220-98672242 TGCTTTGAGAATGTGTAAGAGGG - Intronic
935627032 2:105180085-105180107 TGCTTTAGGAGTGTGGGGGAGGG + Intergenic
935670185 2:105548743-105548765 TGGTTTTGGAAGATGGAGGCTGG + Intergenic
936849221 2:116874835-116874857 TGCTATGGGAAGATGGATAAGGG + Intergenic
936934633 2:117827278-117827300 TGCTGTGGGAACAAGGAGGCAGG - Intronic
937057204 2:118949075-118949097 TGGTTTTGGAAGATGGAGGCTGG + Intronic
939221960 2:139313795-139313817 TGCATTTGGAATTTGGAGGGAGG - Intergenic
939531368 2:143366055-143366077 TGCTTAGGGAATTTGGAAAATGG - Intronic
939678656 2:145103874-145103896 AGCTTTGGGAAGAAGGATGAGGG + Intergenic
940328402 2:152449854-152449876 TACTCTGGGAAAATGTAGGAAGG - Intronic
942079759 2:172389006-172389028 TGCTTTGACAAAGTGGAGGAGGG - Intergenic
942151614 2:173081606-173081628 TGCTTTGGGAATTGGGGGGAAGG + Intronic
942224946 2:173806881-173806903 TGCTTTGGGAACATAGATGTTGG - Intergenic
942912980 2:181268541-181268563 TTCCTTGGGGATATGTAGGAGGG + Intergenic
943199593 2:184803376-184803398 TGCTATGTGAATATAAAGGAAGG - Intronic
943533727 2:189121098-189121120 TGTTGTGGGAACATGTAGGAAGG + Intronic
944005288 2:194897166-194897188 TGCTGCTGGAATATTGAGGAGGG + Intergenic
944010423 2:194967926-194967948 GGCTTTGAGAACAGGGAGGAGGG - Intergenic
944590160 2:201209489-201209511 TCCTTTCGGCATGTGGAGGAAGG + Exonic
944673831 2:202018509-202018531 TGCATTGGAAATATTCAGGATGG + Intergenic
944911745 2:204317406-204317428 TGCTATGGGAACACAGAGGAGGG + Intergenic
945818009 2:214629415-214629437 TCCTTAGGGAGTATGGAGGTGGG + Intergenic
946868096 2:224060250-224060272 TGCCTAGGGGATCTGGAGGAAGG - Intergenic
948214714 2:236220219-236220241 TGCTTTGGGAAGGTGCTGGAGGG - Intronic
948480973 2:238250249-238250271 TGCTTTGTGAAAATTGAGCATGG + Intronic
1169062995 20:2675091-2675113 GGCTTTGGGATTATGGAGGGAGG - Intergenic
1170491554 20:16880922-16880944 TGCTAGGGGAGTAGGGAGGATGG + Intergenic
1172763725 20:37339687-37339709 TGCTTAGGAAATGTGGAGGATGG + Intergenic
1173050915 20:39560900-39560922 TTCTGGTGGAATATGGAGGATGG + Intergenic
1173106736 20:40144138-40144160 AGATTTGGGAATTTGGATGATGG - Intergenic
1173803276 20:45908273-45908295 TGCTTTGGGGATTCAGAGGAGGG - Intronic
1174049689 20:47759025-47759047 TGCCCTGGGAAAATGGAGGATGG - Intronic
1174349406 20:49956283-49956305 TGATTTGGTAATATGGGGCATGG - Intergenic
1175088755 20:56484521-56484543 TGCTTGGGGAATGTGGAAGGAGG - Intronic
1177444571 21:21175611-21175633 TGCTTTGGAATTAGTGAGGAGGG + Intronic
1177608139 21:23408573-23408595 TGCTGTGGAAACTTGGAGGATGG + Intergenic
1177803573 21:25852073-25852095 AGCTTTGGGCATATGTAGAAAGG - Intergenic
1178400691 21:32282457-32282479 CACTTTGGGAATATAAAGGAAGG + Intergenic
1178470155 21:32885343-32885365 TGCTTTAGGAAGAGGGAGTAGGG - Intergenic
1178480407 21:32975284-32975306 TGCTTTGGGGTGATGCAGGAAGG - Intergenic
1178662177 21:34516729-34516751 TGCTTTGGAAATTTGGAAGATGG - Exonic
1179341470 21:40514191-40514213 TTCTTTGGGAATAAGGAGTAGGG - Intronic
1180720286 22:17902843-17902865 GGCTTTGGGAATCTGAATGAAGG - Intronic
1181392778 22:22595574-22595596 AGCTTTGGGTGTATGGCGGATGG - Intergenic
1181509606 22:23383184-23383206 GGCTTTGGGAATGAAGAGGAGGG - Intergenic
1183414219 22:37673389-37673411 GGCTTTGGGCATCTGGAGGAAGG + Intergenic
1184580003 22:45410385-45410407 TGCTTTGTGGATATAGGGGAAGG - Intronic
949432161 3:3989413-3989435 TGCTATGGGAACATAGAAGAGGG + Intronic
949446876 3:4144375-4144397 TACTTTGGGAAGGTGGAGGAAGG + Intronic
949615155 3:5745605-5745627 TGCTTTGGAAATTTGGGAGATGG - Intergenic
954536148 3:51360830-51360852 TACTGTGGGAACATGGAGGAGGG + Intronic
955445488 3:59005980-59006002 TAATTTGGGCATATAGAGGAAGG + Intronic
955626019 3:60920240-60920262 TGCTTTGGGAAAATGGGGGAGGG + Intronic
955851383 3:63223735-63223757 TGCTATGGGAATATAGAAGAGGG - Intergenic
955877197 3:63504466-63504488 TGGTTTGTAAATTTGGAGGAGGG - Intronic
955888855 3:63629281-63629303 TGATTTGGGAAAATAAAGGAGGG + Intergenic
956161779 3:66362499-66362521 TGCTTGGGGGATAGTGAGGAAGG + Intronic
956610903 3:71121854-71121876 TACTTTGGGAACCTGGAGGATGG - Intronic
956883537 3:73535512-73535534 AGCTTTGGGAATATGGATAGGGG - Intronic
959989416 3:112614645-112614667 TGCATTGAGAATTTGGATGAAGG + Intronic
960219734 3:115091946-115091968 TGCTGTGGGAATGTGAAAGAAGG + Intronic
961139526 3:124544122-124544144 TGTGTTGGGAACATGAAGGAAGG + Intronic
961958175 3:130825843-130825865 TCCTCTGGGAATTGGGAGGAGGG + Intergenic
962278845 3:134035433-134035455 TGCTATGGGAGCATGGAAGAGGG + Intronic
963043491 3:141085869-141085891 TGCTTTGGGGCTTTGGGGGATGG - Intronic
963743347 3:149101206-149101228 TCTTTAGGGAAAATGGAGGAGGG + Intergenic
963803253 3:149698124-149698146 TCATTCTGGAATATGGAGGATGG + Intronic
964858083 3:161169295-161169317 TGCTACTGGAGTATGGAGGAGGG + Intronic
965586516 3:170323500-170323522 TCCTTTCGGGAGATGGAGGAGGG + Intergenic
966007980 3:175039780-175039802 TGCTTTGGAAAAATGGAATATGG - Intronic
966601341 3:181778278-181778300 TGCTATGGGAACATAGAGGAAGG - Intergenic
968113238 3:196067395-196067417 ACATTTGGGAATTTGGAGGATGG - Intronic
969139325 4:5054841-5054863 TGCCTTAGGAATGTGGATGACGG - Intronic
969399967 4:6948026-6948048 TGCTTTGGGAGCACAGAGGAGGG + Intronic
969538928 4:7773819-7773841 TGCTTTTGGAGTTTAGAGGAGGG - Intronic
970179119 4:13370545-13370567 TGCTGTGGGAACACAGAGGAAGG + Intronic
971354645 4:25884322-25884344 TGCTATGAGAACATGGAAGAAGG - Intronic
972650029 4:41007938-41007960 TTCTTTGGGAATACAGAGAAAGG + Intronic
972706857 4:41553326-41553348 TGCTGTGGGAACATAGAGGAGGG + Intronic
973888000 4:55342163-55342185 TGGTTTTGGAAGATGGAGGCTGG - Intergenic
973934399 4:55828409-55828431 TGCTATGGGAATCAAGAGGATGG - Intergenic
974362978 4:60907007-60907029 TCATTTGGAAAGATGGAGGAAGG + Intergenic
975472825 4:74790587-74790609 TCCTTTGGGCAGATGGAGAAGGG - Intronic
975810112 4:78159252-78159274 TGTACTGGGAATATGAAGGATGG + Intronic
975877620 4:78862316-78862338 TACTTTGAGAGTGTGGAGGAGGG + Intronic
975904774 4:79196322-79196344 TGTTATGGAAACATGGAGGAGGG - Intergenic
979531030 4:121769374-121769396 TGTTGTGGGAAACTGGAGGATGG + Intergenic
979905796 4:126289987-126290009 TTCTTTCAGAATATAGAGGAGGG - Intergenic
981011347 4:139928463-139928485 TGCTCTGGGAGTGTAGAGGAAGG + Intronic
981019006 4:140005639-140005661 TCTTTTGGGAGGATGGAGGATGG - Intronic
981070836 4:140536373-140536395 TTCTATGTGAATATAGAGGAAGG + Intronic
981448583 4:144869225-144869247 TCATTTGGGAATATGGGGGAGGG + Intergenic
983159929 4:164399871-164399893 TGCTATAGGAATCTAGAGGAGGG - Intergenic
983903579 4:173162421-173162443 TGCTTTGAGAGCATGAAGGAGGG + Intergenic
983925381 4:173395653-173395675 TGCTTTGGGAACATAGAGCAAGG - Intronic
985925608 5:3014201-3014223 TGATTTTGGAATCTGGAGGATGG - Intergenic
986516827 5:8573186-8573208 TGTTTCGGAAATGTGGAGGATGG - Intergenic
987181332 5:15371740-15371762 TGCTATGGGAATTTAAAGGAGGG - Intergenic
988025289 5:25678636-25678658 TGTTTTGGGATTATGGAAGTAGG + Intergenic
988289632 5:29269388-29269410 TGCTGTTGGAAAATGGAAGAAGG + Intergenic
988403432 5:30793115-30793137 TGCCTGGGGCAGATGGAGGAAGG + Intergenic
988456601 5:31392512-31392534 GGCATTGGGAATATGGATGCTGG - Intergenic
989220587 5:38957577-38957599 TGATTTGTGAATTTAGAGGATGG - Intronic
989270437 5:39526736-39526758 AGCTTTGGGAAAAGGTAGGATGG + Intergenic
990376710 5:55177642-55177664 GGATTTGGGCATATGGGGGAAGG - Intergenic
990433474 5:55762396-55762418 TGCTGTGGGAATGTGGAAGAAGG + Intronic
990995183 5:61726147-61726169 TGATTTATGAATGTGGAGGAAGG + Intronic
992036281 5:72781340-72781362 TGCTTGTGGAATGTGGAGAAAGG + Intergenic
992426359 5:76662095-76662117 TGCTTTGGGAAGCTTGAAGATGG - Intronic
993114879 5:83708404-83708426 TTCTGTGGGAATATGGATGGAGG + Intronic
996628986 5:125605435-125605457 TGCTTTGGAGAAGTGGAGGAAGG + Intergenic
996666451 5:126065871-126065893 TGCTTTGGGGGGATGGGGGAAGG - Intergenic
997089225 5:130837246-130837268 TGCTTGGGGAAGAGGGAGCAGGG + Intergenic
997785196 5:136704311-136704333 TGCAGTGGGAATATGGATCATGG - Intergenic
997868802 5:137488910-137488932 TTCTTTGGGGAAAGGGAGGAAGG - Intronic
999915579 5:156255544-156255566 TGTTTTGGGATTTTGGGGGAAGG + Intronic
1000206494 5:159065242-159065264 TGCTTCAGGAAGGTGGAGGAGGG + Intronic
1000323636 5:160155337-160155359 TGTTTTGGGAATATCTAAGAGGG - Intergenic
1001084912 5:168693491-168693513 TGTTTTAGGAATGTGGGGGAGGG + Intronic
1001215829 5:169854898-169854920 TGCTCTGGGTACTTGGAGGATGG + Intronic
1001335904 5:170796337-170796359 TGCTGTGGGAACATGGGGAAGGG - Intronic
1002047904 5:176552350-176552372 TGGTTTAGGCAAATGGAGGAAGG + Intronic
1002141397 5:177142432-177142454 TACTTTGGGAGTGTGGAGGAAGG + Intronic
1003459735 6:6318986-6319008 TGCTGTAGGATTATGGAGGGTGG - Intronic
1005336827 6:24805340-24805362 TGATTTGGGAATTTTCAGGATGG + Exonic
1006084268 6:31585412-31585434 AGCATGGGGAACATGGAGGATGG + Intergenic
1007131016 6:39473641-39473663 TGCTTTGGGGTTTTGGAGGCAGG + Intronic
1007463966 6:42038897-42038919 TGCTGTGGGAATCTGGAGGAAGG - Intronic
1007626877 6:43251683-43251705 TGCTTTGGGAGGCTGGAGGGGGG + Intronic
1007737338 6:43989981-43990003 TCCTTGGGGAATATGGGGGTGGG - Intergenic
1008397928 6:51030906-51030928 TGCTTTTGGAGAATAGAGGAAGG - Intergenic
1008517966 6:52335987-52336009 TGCTGTGGGAAGATGGAGGAAGG - Intergenic
1008543649 6:52566818-52566840 TGCTTTGGGAACATGGAGGGGGG - Intronic
1010074226 6:71782381-71782403 TGCTGTGAGGATATGGAGAAGGG - Intergenic
1010615132 6:78003417-78003439 TGGTATGGGAAAATGGTGGAGGG - Intergenic
1011221266 6:85056854-85056876 TGCTTTGGCTATAGGGAGGTTGG + Intergenic
1011449744 6:87480198-87480220 TGGTTTTGGAAGATGGAGGCTGG + Intronic
1013083470 6:106833395-106833417 AGTTTTGGGAATTTGGAGCATGG + Intergenic
1013890753 6:115023709-115023731 TCCCTTGGTAATATGGAGGATGG + Intergenic
1014774509 6:125493253-125493275 TGCTATGGGAGAATGGAAGAGGG + Intergenic
1015015948 6:128413140-128413162 TGCTTTAGGGATATGTAGGCGGG - Intronic
1015120789 6:129699225-129699247 TGATTTGGGAGTATTTAGGAAGG - Intronic
1017064460 6:150516765-150516787 TGCTTTGGGTAAATCAAGGAGGG + Intergenic
1017111704 6:150938833-150938855 GACTTTGGGATTATGGATGAGGG - Intronic
1017175281 6:151497053-151497075 TGTTTTGAGAATCTGTAGGAGGG + Intronic
1018059390 6:160078797-160078819 AGCTTTGGGAAGAGGGAGGTAGG + Intronic
1020813674 7:12877193-12877215 TCCTTTGAGAAAATGGAGAATGG + Intergenic
1021861175 7:24907250-24907272 GGCATTGGGAATTTGGAGCAGGG - Intronic
1022987446 7:35671342-35671364 TGCTTTAGGAGTTTGGAGGAAGG + Intronic
1023436236 7:40143352-40143374 TGATTTTGGAAAATGGAGGCTGG + Intronic
1023690694 7:42783381-42783403 TGATTTGAGAAGATGGAGGTGGG + Intergenic
1023771486 7:43560595-43560617 TATTTTGGGAATAAGGAAGATGG - Intronic
1023879130 7:44308630-44308652 TACTTTGGGAAGATGAAGGCAGG + Intronic
1026618195 7:71926288-71926310 TGCAGTGGGAATCTGGATGATGG - Intronic
1027387354 7:77671778-77671800 TGCTTTGGGAGGCTGGAGGTGGG - Intergenic
1027820580 7:83038387-83038409 TGCTTAGGGATGAAGGAGGATGG - Intronic
1028833781 7:95351960-95351982 TTCTTTGGGAAAATGGACAAAGG - Intergenic
1029472057 7:100760770-100760792 TGCTTTGGGAATGTGCTAGAAGG + Intronic
1029664955 7:101989151-101989173 TGCTGGGGGAATAGGAAGGAAGG - Intronic
1029815154 7:103086044-103086066 TGCATTGGGAATCTTGAAGAGGG - Intronic
1031115071 7:117658650-117658672 GGCCTTGGGAAACTGGAGGATGG - Intronic
1031614408 7:123864317-123864339 TGTTCTGGGAATATATAGGAAGG - Intronic
1031657886 7:124380519-124380541 TGCTTGTGGAAAGTGGAGGAAGG + Intergenic
1032414257 7:131724273-131724295 TGCTTCAGGAATTTGGAGCAGGG - Intergenic
1032531698 7:132626195-132626217 GGCAGTGGGAATGTGGAGGAGGG - Intronic
1032610708 7:133409395-133409417 TGCTTTGAGAAGATGGAGGGTGG - Intronic
1032838016 7:135691547-135691569 TGCTTTGGGAAAAAGAATGATGG - Exonic
1034002089 7:147425692-147425714 TTCCTTGGGTATATGGACGAAGG - Intronic
1034236260 7:149572337-149572359 TGGTCTTGGAATATGGAGGCTGG - Intergenic
1034934048 7:155187232-155187254 TGCTTAGGGGACAAGGAGGAAGG - Intergenic
1035286450 7:157810263-157810285 TGCTTTGGGATCACGGGGGATGG - Intronic
1036160346 8:6381761-6381783 TGCCTTGAGATTGTGGAGGAAGG - Intergenic
1036427873 8:8663005-8663027 TATATTGGGAATACGGAGGAAGG - Intergenic
1036833581 8:12040334-12040356 TGGTTTGGGAACAGGCAGGAGGG + Intergenic
1036855428 8:12286899-12286921 TGGTTTGGGAACAGGCAGGAGGG + Intergenic
1036991661 8:13605018-13605040 TGCCTTGGAAATTTGGATGATGG + Intergenic
1037492363 8:19408403-19408425 TGCTTTGGGAGGTTAGAGGAGGG - Intronic
1038040172 8:23717456-23717478 TGCTTGGGGTAGGTGGAGGATGG + Intergenic
1038307716 8:26419885-26419907 TCCTTTGGGCAGAAGGAGGAGGG - Intronic
1038752391 8:30307541-30307563 TGGTTTGGGAATGTTGATGATGG - Intergenic
1038962947 8:32541806-32541828 TGCTGTATGAATATGGATGATGG + Intronic
1039272650 8:35899741-35899763 TGTTTTGGGAATAGAGAGGAAGG + Intergenic
1039749701 8:40466074-40466096 GGCTTTGGAAATAAGGAGGCTGG - Intergenic
1039759295 8:40557613-40557635 TGCTATGGGAATATAAAAGAGGG - Intronic
1040049740 8:43001609-43001631 TGGTATGGGAATGTGAAGGATGG - Intronic
1040484926 8:47861149-47861171 TTCTGTGGGAATCTGCAGGAAGG - Intronic
1042086173 8:65111798-65111820 TGATTTGAGAGTATGCAGGAAGG + Intergenic
1042330942 8:67580059-67580081 TGCTCTGGGTAAGTGGAGGAAGG - Intronic
1042867343 8:73367426-73367448 TCCTTTGGGACTTTAGAGGAGGG + Intergenic
1043385949 8:79748021-79748043 TGCTTTAGGAAAATGAAAGAAGG - Intergenic
1043953923 8:86340244-86340266 TGATTTGGGCACATGGAAGAAGG + Intergenic
1044078059 8:87847546-87847568 TGCTATTGGAAACTGGAGGAAGG - Intergenic
1044217287 8:89627070-89627092 CTCTTCGGGAAAATGGAGGAAGG - Intergenic
1044361480 8:91289857-91289879 TTCTTTGGTAATATAGAGGTAGG - Intronic
1044739459 8:95311204-95311226 TATTTTGGGAATTTGGATGAAGG - Intergenic
1044826656 8:96204751-96204773 TGCTTTGGAAATGCAGAGGAGGG - Intergenic
1044935608 8:97290830-97290852 TACTTTGGGCATCTGGATGAAGG - Intergenic
1045015134 8:97994869-97994891 TGCTATGGGAATAAGGGGGAGGG - Intronic
1045663440 8:104461758-104461780 TGCTTAAGGAATATGCAGGCTGG + Intronic
1046241531 8:111501895-111501917 TGCTTTGGGGATAAGGAGAAAGG - Intergenic
1046316277 8:112506752-112506774 TGCTATGCGGATATGGATGAGGG + Exonic
1046359633 8:113132776-113132798 TGCATTGGGAATAGGGAAGGGGG + Intronic
1046695655 8:117336393-117336415 TACTTTGGGGATACTGAGGATGG - Intergenic
1047451295 8:124967233-124967255 TGTTATTGGAAGATGGAGGAAGG - Intergenic
1047766977 8:127998001-127998023 TAGATTGGGATTATGGAGGAAGG + Intergenic
1048180340 8:132188806-132188828 TGCTTTGGGAGCATCCAGGAGGG + Intronic
1048431324 8:134374215-134374237 TGCCATGGGAACATGGAGCAGGG + Intergenic
1048445507 8:134489912-134489934 TGCTTTGAGAAGAGGGTGGATGG - Intronic
1049544951 8:143226197-143226219 TGCTTTGGGAATATGTATGAAGG + Intergenic
1050352945 9:4757911-4757933 TGCTTTGGGCACAGGGAGGTTGG + Intergenic
1050705609 9:8393277-8393299 TCCTTTGGGGTTATGAAGGATGG + Intronic
1051671230 9:19512640-19512662 TGCCTTGGAAGTATGGGGGAGGG + Exonic
1051889950 9:21931270-21931292 TTCTTTGGGAAACTGGATGAAGG - Intronic
1052187426 9:25616228-25616250 TGCTTTGGGAACACAGAGTAAGG + Intergenic
1052463502 9:28798561-28798583 TGGTTTGAGAAGAGGGAGGAAGG + Intergenic
1052749169 9:32471575-32471597 TGCTATGCGAATGTGGAAGAAGG + Intronic
1053062378 9:35042459-35042481 TGCTCTGGGAATATGGTGCAAGG + Exonic
1054825172 9:69566175-69566197 TGCTATGGGGATATGCAGCACGG - Intronic
1055033647 9:71795089-71795111 GGCCTTGGGAATCTGGAGCAAGG - Intronic
1055946506 9:81695960-81695982 TGTTATGTGAATATGTAGGAAGG - Intergenic
1056155187 9:83827463-83827485 TACTGTGGGAGTATGGAGGAAGG - Intronic
1056355298 9:85795646-85795668 TACTGTGGGAGTATGGAGGAAGG + Intergenic
1059654118 9:116341690-116341712 TACATTGGGAATATAGTGGACGG - Intronic
1060034527 9:120243600-120243622 TGCTTTGGGGGCATAGAGGAAGG + Intergenic
1060448836 9:123717966-123717988 TTCTGTGGGCTTATGGAGGAAGG - Intronic
1060790801 9:126484324-126484346 AGCTTTGGGAAGGTGGAGGTTGG + Intronic
1060952123 9:127610999-127611021 TACTTTTGAAATATGGGGGAGGG - Intergenic
1061287741 9:129633726-129633748 TGAGGTGGGAAGATGGAGGATGG + Intronic
1062188954 9:135237064-135237086 AGCTTTGGGAGTGTGGAGGCAGG + Intergenic
1062296175 9:135828328-135828350 TGTGTTGTGAACATGGAGGAGGG + Intronic
1202630930 M:15660-15682 TTGTTTGGATATATGGAGGATGG - Intergenic
1186319963 X:8413570-8413592 GGTTTTGGGAAGCTGGAGGAGGG - Intergenic
1186841638 X:13490137-13490159 TTCTTTTGGAAGATGGAGGTGGG - Intergenic
1186909554 X:14147633-14147655 TGTTATGAGAATATAGAGGATGG - Intergenic
1186959639 X:14721937-14721959 TGCTGTGGAAAGCTGGAGGATGG - Intronic
1187107630 X:16260616-16260638 TGCTATGGGAATGTGGAGAAGGG + Intergenic
1187536770 X:20148064-20148086 TGCTGTAGGAATATGTAGCAGGG - Intergenic
1187720959 X:22150365-22150387 TACTTTGAGAATATAGAGCAGGG + Intronic
1188152497 X:26695290-26695312 TGCTCCTTGAATATGGAGGAAGG + Intergenic
1188269414 X:28120183-28120205 TGCTTTTGCAATATGGGGAAGGG + Intergenic
1188454084 X:30342493-30342515 TTCTTGGGGAATGTGTAGGATGG - Intergenic
1188671212 X:32884082-32884104 GACATTGGGAATATTGAGGATGG - Intronic
1189653860 X:43220544-43220566 TGCTTTGGGGAGGTGGAGGTGGG - Intergenic
1189924108 X:45934727-45934749 TGCTTTGGGAATATGAATGCTGG + Intergenic
1190126633 X:47711409-47711431 TGCTGTGGGAAAACTGAGGAAGG + Intergenic
1190534498 X:51412178-51412200 GGCTCTGGGAACACGGAGGAAGG - Intergenic
1190868197 X:54402369-54402391 TGGTTTGGTGATTTGGAGGAGGG + Intergenic
1192887602 X:75352156-75352178 TGATGTGGTAATTTGGAGGAAGG + Intergenic
1193628069 X:83844120-83844142 TGATGTGGGTATATGGAGGAAGG - Intergenic
1193880026 X:86910508-86910530 TGATTTGGGAAAAGAGAGGAAGG - Intergenic
1194039112 X:88917855-88917877 TACTTTTGGAAACTGGAGGAAGG + Intergenic
1194600553 X:95915625-95915647 TGCTATGTGAATTTGGGGGAAGG - Intergenic
1194663715 X:96654820-96654842 TGACATGGGAATATGGGGGAAGG - Intergenic
1194773281 X:97930933-97930955 TGCTTTAGGAGAATGGAGAAAGG - Intergenic
1195026692 X:100884625-100884647 TGCATTGGGCATTTGGAGGTGGG + Intergenic
1195564877 X:106328869-106328891 TGATTTGAGAAAAGGGAGGAGGG + Intergenic
1195939512 X:110156456-110156478 TGCTATGGGAATAAGGATGCGGG + Intronic
1197853970 X:130895003-130895025 TGTTCTGGGAATATGGAGGAGGG - Intronic
1198487696 X:137104878-137104900 GGCTTAGGGAGTATGGAGTAGGG - Intergenic
1199046744 X:143183066-143183088 TGATCTGGGAAGATGGAGCAGGG - Intergenic
1199076166 X:143529555-143529577 TGCCTTTGGAAAAGGGAGGAGGG - Intergenic
1201221842 Y:11779076-11779098 TTCTTTGGGAGTATGCAGTAGGG + Intergenic