ID: 1085555762

View in Genome Browser
Species Human (GRCh38)
Location 11:77420140-77420162
Sequence ATTTGGGTTGGTATTGAAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 214
Summary {0: 1, 1: 0, 2: 2, 3: 14, 4: 197}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085555756_1085555762 14 Left 1085555756 11:77420103-77420125 CCTGCAGAACTAGGAAAAGGTTC 0: 1
1: 0
2: 2
3: 12
4: 139
Right 1085555762 11:77420140-77420162 ATTTGGGTTGGTATTGAAGAAGG 0: 1
1: 0
2: 2
3: 14
4: 197

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085555762 Original CRISPR ATTTGGGTTGGTATTGAAGA AGG Intronic
900483670 1:2911274-2911296 ATCTGTGTTGGCCTTGAAGATGG - Intergenic
902800305 1:18825457-18825479 ATTGGTGTTGGTAGTGATGATGG - Intergenic
902800346 1:18825723-18825745 ATTGGTGTTGGTAGTGATGATGG - Intergenic
908146342 1:61248667-61248689 ATTTAAGTTGGTATTTAAGTTGG - Intronic
908310760 1:62880495-62880517 ATTTGGGATGGTGGTAAAGATGG - Intergenic
909048625 1:70741082-70741104 ATTTGGGTTGATGTTGAGAAGGG + Intergenic
909815005 1:79981748-79981770 ATTTGGGTTAGTAATGTAGTTGG - Intergenic
911270298 1:95793331-95793353 ATTTATTTTGGTATTAAAGAAGG + Intergenic
911282738 1:95951686-95951708 ATTTGGTTTGGTATTGAGACTGG - Intergenic
913063002 1:115225080-115225102 CTTTGGGTGGGTATTGATGGAGG + Intergenic
915234131 1:154468076-154468098 TTTTGTTTTTGTATTGAAGAGGG + Exonic
917652322 1:177090051-177090073 ATTTTGTATGGTATTGATGACGG - Intronic
918652286 1:186980118-186980140 TTTTGTGTTTGTAGTGAAGACGG + Intronic
919986047 1:202676030-202676052 AGTTGGGTTGGGATTGAACCTGG - Intronic
920567688 1:206988466-206988488 GTTTGGGGTGGGATTGAAAATGG - Intergenic
920830057 1:209456425-209456447 ATGTGGTTTGGTATGGAACATGG - Intergenic
921170335 1:212541637-212541659 ATTTATATTGGTATTGCAGAGGG + Intergenic
921304453 1:213781820-213781842 ATATGGGTGGGCATAGAAGAAGG + Intergenic
1064188045 10:13180562-13180584 ATTTGGGGTTATATTGAAGAAGG + Exonic
1065162481 10:22937466-22937488 ATGTGGGTTGGTGGAGAAGATGG + Intronic
1071182380 10:83002039-83002061 ATTTGGGTAGGAATGGAAGTTGG + Intergenic
1073026855 10:100494045-100494067 ATTAGGGTGGGGATTGAAGGTGG + Intronic
1073790903 10:106939319-106939341 ATTTGGTTTAGGATTGGAGATGG + Intronic
1073886513 10:108045610-108045632 ATTTGGATTCATATTTAAGAGGG - Intergenic
1074453648 10:113579305-113579327 ATGTGGGTTGGTGGTGATGATGG + Intronic
1075046196 10:119148369-119148391 ATTTGGGGTGGTTTGGCAGACGG - Intronic
1075950618 10:126474546-126474568 ATTTGTTTTGGTATTTAAGAAGG - Intronic
1075989548 10:126823670-126823692 ATTTGGGTGGGAATGGAAAATGG + Intergenic
1082900273 11:58241829-58241851 ATTAGGGTGGGTATAAAAGATGG - Intergenic
1083578867 11:63812661-63812683 ATGAGGGTTGCTATAGAAGAGGG + Intergenic
1084831157 11:71770383-71770405 ATTTGGGTGTGTTTGGAAGAAGG - Intergenic
1085555762 11:77420140-77420162 ATTTGGGTTGGTATTGAAGAAGG + Intronic
1087296170 11:96376762-96376784 ATTTTGGTTGCGATTGTAGATGG + Intronic
1087786712 11:102363288-102363310 ATTTGTGATGGGATTGGAGAAGG + Intronic
1088151030 11:106745611-106745633 AGATGGGTTGGTAGTTAAGAAGG - Intronic
1088451306 11:109984160-109984182 ATGTGGATTGGAATTCAAGATGG - Intergenic
1092167570 12:6352347-6352369 ATTTGGGTCAGAAATGAAGAAGG - Intronic
1093577205 12:20746432-20746454 ATTTGGGTTTTTCTCGAAGAAGG - Intronic
1095793950 12:46196750-46196772 ATTTTGCTTGGTCTTGGAGAAGG - Intronic
1096155339 12:49338534-49338556 ATTTGGGTGGGGGTTGAAGTTGG + Intergenic
1096851910 12:54445154-54445176 ATTTAAGTTGGAATTGAAGGTGG + Intergenic
1097590419 12:61567632-61567654 ATTTGGGCTGCCATCGAAGAAGG - Intergenic
1097631458 12:62068900-62068922 ATTTGTGTTGGCATTGATGTTGG - Intronic
1097676649 12:62609977-62609999 CTTAGTGTTGGTATTGATGATGG + Intergenic
1098231470 12:68375743-68375765 ATTTGAGTTGGCCTTGGAGATGG - Intergenic
1099381422 12:81957440-81957462 CTTAGGGTTGGTATAGAATAGGG - Intergenic
1101425547 12:104585391-104585413 ATTTGGGTTGGAATAGAAGAGGG + Intronic
1101696411 12:107131420-107131442 ATTTGGCTTGTTTTTAAAGAGGG + Intergenic
1102610538 12:114108022-114108044 ATTAGGGTTGGTCTTATAGAAGG - Intergenic
1105584146 13:21728532-21728554 ATTTGGGTTAGGATTAGAGAAGG - Intergenic
1106650290 13:31683044-31683066 ATTTTGGGTGGTAGGGAAGATGG - Intergenic
1106757188 13:32834573-32834595 GTTTGAGTTGATGTTGAAGATGG + Intergenic
1110708512 13:78623935-78623957 ATTTGGGTTGGCATTTACCAGGG - Intronic
1111527992 13:89497523-89497545 ATTTGAGTTGATATTGAAAATGG + Intergenic
1113226030 13:108160449-108160471 ATTTGGATTTGTATTCACGATGG - Intergenic
1113423565 13:110188864-110188886 ATCGTGGTTGGTATGGAAGATGG - Intronic
1113655006 13:112062632-112062654 GTTTGGTTTGGTTTTGAAGGAGG - Intergenic
1115344141 14:32324149-32324171 ATGTGGGGTGGAAGTGAAGAAGG + Intergenic
1116859139 14:49979648-49979670 GTTTTGGTTGGTAGTGAAGTTGG + Intergenic
1117011459 14:51474632-51474654 ATTTGGGATGGCATTGGAGTGGG + Intergenic
1120129947 14:80794975-80794997 ATTTGTGTTGGGATTGAATGAGG - Intronic
1120189264 14:81425400-81425422 TTTTGTGTTGGTAGTGGAGATGG - Intronic
1122275827 14:100590359-100590381 ATTTGGGTTAATATTGCAGTTGG - Intergenic
1124806149 15:32885202-32885224 CTTTGGGTTGGAATTGGAAAGGG - Intronic
1126277907 15:46906306-46906328 ATTTGGGTTGGGATTCTAAAGGG + Intergenic
1127230992 15:56994899-56994921 ATTTGGGTAAATATTGTAGATGG + Intronic
1131618356 15:94040438-94040460 GTTTGGTTTGGTTTTTAAGATGG - Intergenic
1134464785 16:14465603-14465625 ATTTTGGTTGGGATTGAATTAGG - Intronic
1135560650 16:23474224-23474246 ATTTGGGTTGGGATTCAAGAAGG - Intronic
1139197982 16:64943571-64943593 GTTTGGGTTGGGATTGTAAATGG - Intergenic
1139224971 16:65225785-65225807 ATTTTGGTTCGTATTAAATAAGG + Intergenic
1139489060 16:67276909-67276931 ATTTGGGGTAGTACTGAAGAGGG + Intergenic
1144843804 17:18205400-18205422 CTTTGGGTTGGCCTTGCAGAGGG - Intronic
1144897693 17:18554283-18554305 ATATAGTTTGGTAATGAAGAAGG + Intergenic
1145134679 17:20391436-20391458 ATATAGTTTGGTAATGAAGAAGG - Intergenic
1145775168 17:27522629-27522651 TTTCTGGTTGGTATTGGAGAGGG + Intronic
1147394104 17:40128131-40128153 ATTTAGGTTGGTAAAGAGGAAGG + Intronic
1150177061 17:63068967-63068989 ATTTGGGGAGGGATGGAAGAAGG + Intronic
1152138081 17:78517651-78517673 ATTTGGGTAGGTTGTGGAGAGGG - Intronic
1152669496 17:81593909-81593931 ATTTGGGCTAGGATTGAAGGAGG - Intronic
1155021616 18:21901986-21902008 ATTTGGGGTGGGGTTGAAAAGGG - Intergenic
1156629907 18:38954590-38954612 GATTTGGTTGGTATAGAAGAAGG + Intergenic
1157503941 18:48212797-48212819 ATTGGGCTGGGTCTTGAAGAAGG + Intronic
1157851311 18:51054160-51054182 ATTTGGGTTGGGTTTCTAGAGGG + Intronic
1159891367 18:73956107-73956129 ATTGTGGCTGGCATTGAAGATGG - Intergenic
1160381894 18:78464659-78464681 ATTTGTGTTTGTATTGTAAATGG + Intergenic
1163493294 19:17630011-17630033 ATTGAGGTTGGGATTGAAGTTGG - Intronic
1164001230 19:21101311-21101333 CTCTGGGTTTGTAGTGAAGAGGG + Intronic
1164007994 19:21169514-21169536 CTCTGGGTTTGTAGTGAAGAGGG + Intronic
1164224441 19:23229704-23229726 CTATGGGTTTGTAATGAAGAGGG - Intronic
1164239620 19:23373072-23373094 ATCTGGGTTTGTAGTGAAGAAGG - Intronic
1164253284 19:23503658-23503680 CTCTGGGTTTGTAGTGAAGAGGG - Intergenic
1164297140 19:23922048-23922070 CTCTGGGTTTGTAGTGAAGAGGG + Intronic
1164317628 19:24107842-24107864 CTCTGGGTTTGTAGTGAAGAGGG + Intronic
1164569096 19:29356630-29356652 ATTGGGGTTGGCATTGAATCTGG - Intergenic
1168418498 19:56184783-56184805 AATTGAGTTAGGATTGAAGAAGG - Intronic
926422285 2:12711961-12711983 ATTTGTGTAGGTAGAGAAGAAGG - Intergenic
929010946 2:37443528-37443550 ATTTGGGGTGGGAGTGAGGAAGG + Intergenic
931002324 2:57800796-57800818 ATTTGGGTAGGTATAGAAATTGG - Intergenic
931167489 2:59763692-59763714 TTTTGTGTTGCTATTGAGGAGGG - Intergenic
933774230 2:85762088-85762110 ATTATGGTTGGTCTTGCAGAAGG - Intronic
938573474 2:132583640-132583662 ATATGGGTTGAGATTGAAGAGGG + Intronic
940291082 2:152078130-152078152 CTTTGGATTGATATTGAAAATGG - Intronic
942545468 2:177058764-177058786 AAGTGGATTGGTAGTGAAGATGG + Intergenic
942827070 2:180191585-180191607 ATTTGTGTTTGTATTAAAGCTGG - Intergenic
943124425 2:183779079-183779101 ATTTGGGTGGCTATTGTAAATGG + Intergenic
944863284 2:203835825-203835847 ATCTGTGTTAGTATTGAAGCCGG - Intergenic
945784797 2:214219835-214219857 ATTTGGTTTGGTATTTCAGATGG - Intronic
948547557 2:238743532-238743554 ATTTGAGTGGATATTGAAGGAGG + Intergenic
1169237688 20:3944773-3944795 ATGGGGGTAGGGATTGAAGAAGG - Intronic
1169806842 20:9568277-9568299 ATTAGGGTGGTTATTGTAGATGG + Intronic
1171096184 20:22334382-22334404 CTGTGGGTTGGTTTTGAAGTGGG - Intergenic
1171937852 20:31293104-31293126 ATTTTTGTTTCTATTGAAGATGG - Intergenic
1172336098 20:34116928-34116950 ATCTGGGGTGGTATTGAGCATGG - Intergenic
1172850687 20:37961022-37961044 ATTTAGCTTTGTATTGAAGTAGG + Intergenic
1172850835 20:37962588-37962610 ATTTAGCTTTGTATTGAAGTAGG - Intergenic
1173114361 20:40225964-40225986 ATTTGCCTTGTAATTGAAGATGG + Intergenic
1175780980 20:61681948-61681970 ATCTGGGTTGTCATTGCAGAAGG + Intronic
1181428946 22:22865569-22865591 ATTTAGGTAGGTATTGGATAAGG + Intronic
1182557114 22:31135213-31135235 ATTGGGGTGGGTGTTGGAGAGGG - Exonic
949371071 3:3335318-3335340 ATTTGGGTTGGGATTGGGGTTGG - Intergenic
951710112 3:25578156-25578178 GCTTGGGTTGGTAATGAAGGCGG - Intronic
954946208 3:54426609-54426631 ATTGGGGCTGGTATTTATGAAGG - Intronic
957548570 3:81673350-81673372 ATTTGGTTTGGCATTGAACAGGG - Intronic
962493485 3:135916774-135916796 ATTTGGGCTCATTTTGAAGATGG + Intergenic
963611076 3:147469194-147469216 ATTTTTGATGTTATTGAAGATGG + Intronic
963853990 3:150235497-150235519 ATTGGGCTTGGAGTTGAAGAGGG + Intergenic
965827061 3:172742129-172742151 ATTAGATTTGGTATAGAAGAAGG + Intergenic
966705333 3:182907201-182907223 ATTTGGATTGGTAGTAATGATGG + Intronic
967021723 3:185528676-185528698 ATCAGGCTAGGTATTGAAGAGGG + Intronic
967404890 3:189104352-189104374 ATCTGGGTTGGAATTGCAAAGGG + Intronic
973865403 4:55107881-55107903 ATCTGGGGTGGGACTGAAGATGG + Exonic
974329521 4:60459628-60459650 ATTTTGGTTGCTAGTGAAGTTGG + Intergenic
975606055 4:76155514-76155536 GTTTGGGTTGTAATTGAAGTCGG - Intergenic
976282974 4:83343536-83343558 GTTTGGGTTGGTACTGAAATAGG - Intergenic
979187904 4:117821845-117821867 ATGAGTGTGGGTATTGAAGAAGG - Intergenic
979403917 4:120285436-120285458 ATTTGGGATGGAAATAAAGATGG + Intergenic
980915612 4:139030702-139030724 ATTCTCGTTTGTATTGAAGATGG + Intronic
988537324 5:32080532-32080554 ATTTGCTTTGGAATAGAAGAGGG + Intronic
989790732 5:45397295-45397317 ATTTGTGTCAGGATTGAAGACGG + Intronic
990736568 5:58869925-58869947 ATTAGGTTTGATTTTGAAGAAGG + Intergenic
992119763 5:73580390-73580412 ATTTGGGTTGGTATTCAGATGGG + Exonic
994964249 5:106646821-106646843 ATTTGGCCTGCTATTGATGATGG - Intergenic
995212416 5:109555591-109555613 ATTTGTGCTGCTACTGAAGAGGG + Intergenic
995449676 5:112286783-112286805 TTTTGGTTTTGTTTTGAAGATGG - Intronic
995991285 5:118242746-118242768 CTATGAGTTGGTAATGAAGAAGG - Intergenic
997009621 5:129861096-129861118 ATTGGGGTTGATGGTGAAGAGGG - Intergenic
998013821 5:138716592-138716614 TGTGGGGTGGGTATTGAAGAAGG + Intronic
998630841 5:143896844-143896866 ATTTGGGTTGGTTTTGGAGTGGG + Intergenic
999382759 5:151132972-151132994 GTTTGGGTTGGGAATGAAGTAGG + Intronic
1001190636 5:169627560-169627582 ATTTGGGGTAGTGTTTAAGAAGG + Intergenic
1001254755 5:170175111-170175133 ATGTGGGATGGTCTTGAGGAGGG + Intergenic
1005155882 6:22805887-22805909 ATTTGGGTTTGAATTTTAGAAGG - Intergenic
1009442323 6:63695805-63695827 ATATAGGTTGGTATTGGTGAAGG + Intronic
1009597898 6:65759729-65759751 ATTTGTGTTTATATTGAATACGG - Intergenic
1009935304 6:70227031-70227053 ATTTGGGTTTATAATGAAGGTGG + Intronic
1011578017 6:88826257-88826279 ATTGGTGATGGTGTTGAAGAAGG - Intronic
1015458005 6:133451138-133451160 ATTTGTGTAGGTATTGTATATGG - Intronic
1017246875 6:152236267-152236289 ATTTGGGCTGGTATTCATTAAGG + Exonic
1020601836 7:10285140-10285162 ATTTAGGTTTGCATTGAGGAAGG + Intergenic
1027126910 7:75563063-75563085 AGTTGGGTGGGTTCTGAAGACGG + Exonic
1028278957 7:88896733-88896755 AATTGATTTGGAATTGAAGATGG + Intronic
1028572476 7:92306090-92306112 ATCTGGGATGTTATAGAAGAAGG - Intronic
1028976317 7:96918392-96918414 ATTTGGGTTAGAATTATAGAAGG - Intergenic
1029046776 7:97638492-97638514 ATTTGGGGCGGGGTTGAAGAAGG + Intergenic
1031551334 7:123116817-123116839 ATTTGGGTTGGTTTGGAAATTGG + Intronic
1031622008 7:123945687-123945709 ATTTTCCCTGGTATTGAAGATGG + Intronic
1033252529 7:139773434-139773456 CTTTGGGTTGGTGTCAAAGACGG - Intronic
1034580353 7:152036024-152036046 ATTTGGACTGGGCTTGAAGAGGG + Intronic
1036503783 8:9336913-9336935 ATTTGGATCTGCATTGAAGAGGG - Intergenic
1036516772 8:9451543-9451565 ATTTGAGTGGGCATTGAACATGG - Intergenic
1036527425 8:9548239-9548261 ATTTGGGTTGGTTTAGCACATGG - Intergenic
1038661648 8:29502698-29502720 ATTTGGGAAGGAATTGGAGAAGG - Intergenic
1038729353 8:30113379-30113401 ATACGGGATCGTATTGAAGAGGG + Intronic
1039398806 8:37249991-37250013 ATTTGGGCTGGGCTTGAGGAAGG + Intergenic
1041157944 8:55007124-55007146 ATGTGGGTTGGTTTTAAAAAGGG - Intergenic
1041208997 8:55528145-55528167 GCTTGGGTTGGTTTTGAAAAAGG - Exonic
1042497905 8:69476211-69476233 ATTTGTCTTTGTAGTGAAGAAGG - Intronic
1043197685 8:77319272-77319294 ATTTGGATTAGCATTGAGGATGG + Intergenic
1043468684 8:80540044-80540066 AATTGCCTTGATATTGAAGAGGG + Intergenic
1043775520 8:84263562-84263584 TATTAGGTTAGTATTGAAGACGG + Intronic
1044345786 8:91102866-91102888 TTGTGGTTTGGTATTGAAGATGG + Intronic
1045399329 8:101796285-101796307 ATTTGGGATTGAATTGAAAATGG - Intronic
1046026331 8:108728505-108728527 TGTTGGGTTGGAATTGGAGAGGG - Intronic
1046170130 8:110495049-110495071 GTTTGGGTTAGTGTTGATGATGG - Intergenic
1046735643 8:117773832-117773854 CTTTTGGTTTTTATTGAAGAAGG - Intergenic
1048809054 8:138268614-138268636 ATGTGGATTGTTGTTGAAGAAGG - Intronic
1051108180 9:13604258-13604280 ATTTTGGTTCTTAGTGAAGAAGG + Intergenic
1052947967 9:34183675-34183697 ATTTGTTTTGGTATAGAAGCAGG - Intronic
1056966999 9:91171694-91171716 TTTTTGGTAGGTATTGCAGATGG - Intergenic
1059554718 9:115268097-115268119 ATTTATGTTGGTATTTAAGAGGG - Intronic
1059644352 9:116249806-116249828 ATTTGGGTTGGGATGAAACAAGG + Intronic
1060776148 9:126376427-126376449 TTGTGGGTTGGGATTTAAGATGG + Intronic
1061223242 9:129264736-129264758 ATGTGGGCTGGGATTGAGGAAGG + Intergenic
1062185250 9:135214797-135214819 ATCAGGGGTGGTATTGGAGAGGG - Intergenic
1062225690 9:135448592-135448614 AGATGGCTTGGTATTGAAGAAGG + Intergenic
1186053868 X:5628226-5628248 ATATGGTTTGGTATTAGAGAAGG + Intergenic
1186090312 X:6039764-6039786 AATTGGATTGCTATTCAAGATGG - Intronic
1187875908 X:23803977-23803999 CTTTGGGATGGTCTTGGAGAGGG - Intergenic
1188281838 X:28279655-28279677 ATCTGGGTGGGAATTGATGATGG + Intergenic
1188282810 X:28291147-28291169 ATTTTGGTGGAGATTGAAGAGGG - Intergenic
1188431738 X:30111343-30111365 ACATGGGCTGGTATAGAAGAGGG - Intergenic
1189648015 X:43155352-43155374 CTTTTGGGTGGAATTGAAGAGGG - Intergenic
1190278334 X:48913465-48913487 ATTTGGGAAGGAATGGAAGATGG - Exonic
1190391947 X:49940820-49940842 ATTGGGGGTGGCAGTGAAGAAGG + Intronic
1192035487 X:67558488-67558510 ATTTGGGTTGGTAAAGGTGAAGG - Intronic
1192367013 X:70482239-70482261 ATTTGCCTGGGTATTGCAGAGGG + Intronic
1192724551 X:73734680-73734702 ATTTTGGTGGGTATTGTAAATGG + Intergenic
1193276703 X:79597204-79597226 ATTTAGCTTGGTATTGCAGATGG - Intergenic
1194905793 X:99575237-99575259 ATTTTTCTTGGTACTGAAGATGG + Intergenic
1197088314 X:122506458-122506480 ATTTGGCTTTCTATTGAAGAAGG + Intergenic
1199446834 X:147934253-147934275 ATTAAAGTTGGTTTTGAAGATGG + Intronic
1201506783 Y:14710683-14710705 AATTGGCTTGCTATTCAAGAAGG + Intronic
1201581830 Y:15517914-15517936 ATTTGGGTAGGTAAAGGAGAAGG - Intergenic