ID: 1085556467

View in Genome Browser
Species Human (GRCh38)
Location 11:77427185-77427207
Sequence CTGTCTCTGCAGAGACACTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 279
Summary {0: 1, 1: 0, 2: 2, 3: 15, 4: 261}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085556467_1085556473 9 Left 1085556467 11:77427185-77427207 CCTAAGTGTCTCTGCAGAGACAG 0: 1
1: 0
2: 2
3: 15
4: 261
Right 1085556473 11:77427217-77427239 CTCTGCAGGGATAGGCTGTCAGG 0: 1
1: 0
2: 1
3: 17
4: 168
1085556467_1085556472 1 Left 1085556467 11:77427185-77427207 CCTAAGTGTCTCTGCAGAGACAG 0: 1
1: 0
2: 2
3: 15
4: 261
Right 1085556472 11:77427209-77427231 CTGAGGGTCTCTGCAGGGATAGG 0: 1
1: 0
2: 1
3: 30
4: 246
1085556467_1085556470 -5 Left 1085556467 11:77427185-77427207 CCTAAGTGTCTCTGCAGAGACAG 0: 1
1: 0
2: 2
3: 15
4: 261
Right 1085556470 11:77427203-77427225 GACAGACTGAGGGTCTCTGCAGG 0: 1
1: 0
2: 0
3: 15
4: 188
1085556467_1085556474 30 Left 1085556467 11:77427185-77427207 CCTAAGTGTCTCTGCAGAGACAG 0: 1
1: 0
2: 2
3: 15
4: 261
Right 1085556474 11:77427238-77427260 GGAGACACATATCACAATGCTGG 0: 1
1: 0
2: 0
3: 21
4: 422
1085556467_1085556471 -4 Left 1085556467 11:77427185-77427207 CCTAAGTGTCTCTGCAGAGACAG 0: 1
1: 0
2: 2
3: 15
4: 261
Right 1085556471 11:77427204-77427226 ACAGACTGAGGGTCTCTGCAGGG 0: 1
1: 0
2: 3
3: 15
4: 216

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085556467 Original CRISPR CTGTCTCTGCAGAGACACTT AGG (reversed) Intronic
900672972 1:3867354-3867376 CTGTCTATTCACTGACACTTGGG + Intronic
902292233 1:15442804-15442826 CAGCCTCTGGAGAGACACTGTGG - Intronic
904354721 1:29931494-29931516 CTCTCTGTGCAGAGACACTTCGG - Intergenic
905168512 1:36097347-36097369 CTGACACTGCACAGACATTTGGG + Exonic
905247026 1:36622203-36622225 CTGTCTCTACAGAAAAACCTGGG - Intergenic
905357974 1:37398106-37398128 CTTGCTCTGCAGAGCCACCTTGG - Intergenic
905684054 1:39896286-39896308 CTGGCTCTGCAGCCACCCTTGGG - Exonic
909880523 1:80870909-80870931 CTTTCTCTCAAGAGAGACTTTGG + Intergenic
911588867 1:99723173-99723195 CTGTCTATGCAGGAACACATTGG - Intronic
911623918 1:100099160-100099182 CTGTCTCTGAATACACACTGTGG + Intronic
913529257 1:119721892-119721914 CTGTTTCTGCAGAAACACAGGGG + Intronic
915104853 1:153527442-153527464 CTGTGTCTGCTGAGGGACTTGGG - Intergenic
919071678 1:192763576-192763598 CAGTCACTTCAGAGACTCTTTGG - Intergenic
920906481 1:210174574-210174596 CTGCCTCTGCTGAGAGAATTGGG + Intergenic
922392198 1:225156374-225156396 CTTACTCTCCAGAGACTCTTGGG + Intronic
922883960 1:229003794-229003816 CTGACTCTGAGGAGACACTCTGG + Intergenic
924163419 1:241257439-241257461 CTGTCTCCTAACAGACACTTAGG + Intronic
924784735 1:247184446-247184468 CTGTCACTGCAGAGGCTCATTGG + Intergenic
1063102366 10:2961939-2961961 CTGTCTGTGCCAAGACACTGAGG - Intergenic
1064019786 10:11799731-11799753 CTGTCCCTGCTGAGTGACTTGGG - Intergenic
1065122065 10:22540064-22540086 CTGTCTCTGCAGACTCGCCTAGG - Exonic
1065403378 10:25332572-25332594 CTGTATTTGCAGAGGCATTTGGG + Intronic
1065416256 10:25490212-25490234 GTTTGTATGCAGAGACACTTTGG + Intronic
1067053693 10:43039439-43039461 CTCTCTCTGCACAGACCCCTAGG + Intergenic
1067848203 10:49739210-49739232 CTGCCTCTGCAGCCACACATGGG - Intronic
1070416465 10:76194700-76194722 CTGTCTCTGCAGACAGACCATGG + Intronic
1071535286 10:86423832-86423854 CTGTCTCTGCAGGAACAATGGGG - Intergenic
1072115499 10:92366736-92366758 CTGTGTGTGCAGAGACACCTGGG + Intergenic
1073467005 10:103700122-103700144 CTGTGGCTGAAGACACACTTAGG - Intronic
1074028685 10:109663398-109663420 CTGGGTCTGCAGTGACAGTTTGG - Intergenic
1075635883 10:124029929-124029951 CTGTATCTGCAGAGATCCTAAGG - Intronic
1077028573 11:452656-452678 CTGTCCCTGTAGAGACGCATGGG + Intronic
1079116700 11:17644781-17644803 CTGTCTTGTCAGAGACACATCGG - Intronic
1079394286 11:20048714-20048736 TTGTCTCTTCACAGACTCTTTGG + Exonic
1080305090 11:30827024-30827046 CTGTCACTGCATGGGCACTTGGG - Intergenic
1080532176 11:33187813-33187835 CTGTCTGTGGAGAGTCAATTTGG + Intergenic
1080719679 11:34837063-34837085 AAGTCTCTGCAGAAACACTGGGG + Intergenic
1081587738 11:44398776-44398798 CTGGCTCTGCAGAGATGCTCTGG - Intergenic
1082592122 11:55024877-55024899 GTGTCTGTGAAGAGATACTTGGG - Intergenic
1083270730 11:61571201-61571223 GTGTCTGTGCAGAGGCACATGGG - Intronic
1083371868 11:62188884-62188906 CTGTGTCATCAGAGACACCTTGG - Intergenic
1084409447 11:68997867-68997889 CTGACTCTGCAGTGACAGTGAGG + Intergenic
1084744988 11:71164322-71164344 CTGTCTAGGCAGAGAGGCTTTGG + Intronic
1084906623 11:72353334-72353356 CTCTCACTTCAGAAACACTTGGG - Intronic
1085556467 11:77427185-77427207 CTGTCTCTGCAGAGACACTTAGG - Intronic
1087193591 11:95282482-95282504 CTGTTTCTCCAGAGAAACGTAGG - Intergenic
1089161077 11:116437819-116437841 CTGATTCTGCAGAAACACTGTGG - Intergenic
1089306103 11:117527316-117527338 CTGCCTCTGGAGAGTCACGTGGG - Intronic
1089427406 11:118390708-118390730 CTGTCTGTGCAAAGAGAGTTGGG - Exonic
1089826396 11:121281790-121281812 CTGTCTCTGCTGAGTCACGCAGG + Intergenic
1090702255 11:129307433-129307455 CTGTCTCTGCAGACCCACACTGG - Intergenic
1091967434 12:4756525-4756547 CTGTCTCTGCTAAGTCACTGTGG + Intronic
1092296960 12:7208516-7208538 CTGTCGCTGCAGGGACTCGTTGG - Exonic
1093432041 12:19095240-19095262 CTGTCTCTTGGAAGACACTTTGG - Intergenic
1094497550 12:30997923-30997945 CTGTGTCTGCAGGGCCTCTTTGG + Intergenic
1096608469 12:52784889-52784911 CTTTCTCTGCAGTGGCACTGTGG + Intergenic
1096631140 12:52927419-52927441 CTGTCCCTAGGGAGACACTTGGG + Intronic
1097018834 12:56005983-56006005 CAGTATCTGCAGGGACACCTAGG + Intronic
1098219450 12:68253112-68253134 CTGTTTTTTCAGAGACTCTTTGG - Intronic
1099926144 12:89020285-89020307 CTGTGCATGCAGAGACACATAGG + Intergenic
1100144446 12:91660257-91660279 CCCTCTCTGCAGAGAGACCTGGG - Intergenic
1100802655 12:98249723-98249745 CTATCTCTGCTGTGATACTTGGG + Intergenic
1100813227 12:98360950-98360972 CTCTCTCTGCAGAGGCCCTGGGG + Intergenic
1101083989 12:101216576-101216598 CTGTGTCTTCATAGACATTTTGG + Intergenic
1102810348 12:115818940-115818962 TTATCTCTGCAAAGACTCTTAGG - Intergenic
1103029959 12:117605170-117605192 CTGTCCATCCACAGACACTTGGG - Intronic
1104504518 12:129318865-129318887 CTGCCTCTGCTGAGTCACGTAGG + Intronic
1104611187 12:130229096-130229118 CTGGTTCTGCTGAGACACTGAGG - Intergenic
1106571654 13:30933221-30933243 CTGCCTCTGCAGACACAGCTGGG - Intronic
1107604909 13:42048209-42048231 GAATCTCTCCAGAGACACTTGGG - Intronic
1108503723 13:51090657-51090679 CCCTCCCTCCAGAGACACTTAGG - Intergenic
1111431174 13:88149948-88149970 CTCTCTCACCAGAGACAGTTAGG + Intergenic
1111551449 13:89818370-89818392 GTGCCTCAGTAGAGACACTTTGG - Intergenic
1114533107 14:23407542-23407564 CAGTCTCTGCAGAGAAAATGGGG + Intronic
1121870404 14:97401847-97401869 ATGCCTCGGCAGAGACACTCCGG - Intergenic
1123431637 15:20222681-20222703 ATGTTTCTGCTGAGACATTTAGG - Intergenic
1123595317 15:21904280-21904302 CTGCCTCTGCAAAGATCCTTAGG + Intergenic
1124042231 15:26116191-26116213 CTGTCCCTGCAGACAGAATTTGG + Intergenic
1124581844 15:30962811-30962833 CTCTCTCTGCAGCGAGAGTTAGG - Intronic
1127839712 15:62820511-62820533 CTGTTTCTGCAATGACAGTTGGG - Exonic
1128903670 15:71448705-71448727 CTTTCTCTGCAGGGACTTTTAGG + Intronic
1129928357 15:79385745-79385767 CTGGGTCTGCAGCCACACTTTGG + Intronic
1132566236 16:624833-624855 CTGTCACTGCCGAGATATTTAGG + Intronic
1133685685 16:8163246-8163268 CTGTCGCTAAAGAGACCCTTTGG - Intergenic
1133971298 16:10570033-10570055 CTGGGTCTGCTGAGACACTGGGG + Intronic
1135161672 16:20102059-20102081 CTGGGTGTGCAGAGGCACTTAGG + Intergenic
1135497874 16:22968415-22968437 CTGTCTCTGCTGGGGCACTGGGG + Intergenic
1138394298 16:56692182-56692204 CAGACTCTGAAGAGCCACTTTGG - Intronic
1139505187 16:67395057-67395079 CTTTTTCTGCAGAGACACGGGGG + Exonic
1139515947 16:67452469-67452491 CTGTCCCTGCAGGGACAAGTGGG + Intronic
1141949526 16:87331653-87331675 CTGTCTCTGCAGGGGCAGCTGGG + Intronic
1141958780 16:87391331-87391353 CTGTTCCTACAGAGACACATTGG + Intronic
1203114608 16_KI270728v1_random:1476970-1476992 ATGTTTCTGCTGAGACATTTAGG + Intergenic
1142757136 17:2023270-2023292 TTCTCTGTGCAAAGACACTTTGG + Intronic
1143101444 17:4506750-4506772 CAGTCTCTGCAGAGACCATGAGG - Intronic
1144730398 17:17522705-17522727 CTGTCCCTGGGGAGACACATGGG + Intronic
1144836899 17:18161300-18161322 CTGTCCCTGCAAGGACACATGGG - Exonic
1145251454 17:21298985-21299007 CTGACCCTGCAGGGCCACTTTGG + Intronic
1146009333 17:29180814-29180836 GTGCCTCTGCAGAGCCACCTTGG - Intergenic
1146564461 17:33900347-33900369 GTGTCTCAGCAGAGACCCTATGG - Intronic
1148724613 17:49779670-49779692 CTGACTCTGCCCAGAGACTTGGG + Intronic
1149144971 17:53479368-53479390 GTGTCTCTGCAAAGCCACATAGG - Intergenic
1150591143 17:66563801-66563823 CTGTCTGTGCAGAGGTACGTTGG + Intronic
1151030071 17:70727290-70727312 CTGGCTCTCCTGAGACACTGTGG - Intergenic
1152446666 17:80348883-80348905 GTGGCTCTGCAGAGTCACTGAGG - Intronic
1153446140 18:5174860-5174882 CTGTCTCTGCAGGGAATCTGAGG - Intronic
1155219800 18:23673891-23673913 CTGCCTCTGCACAGAGACATGGG - Intergenic
1156339161 18:36195885-36195907 CTGTATCTGCAGTGACAGTGGGG + Intronic
1156731268 18:40196137-40196159 CATTCTCTGCCCAGACACTTAGG + Intergenic
1159921986 18:74234902-74234924 CTGGCTATGCAGTGACACGTCGG + Intergenic
1159939711 18:74397578-74397600 CTGTCTGAGCTGAGACACTGAGG - Intergenic
1161408525 19:4103374-4103396 CTGCCTCTGAAGAGGCACCTTGG - Intronic
1162842010 19:13363615-13363637 CTGCCTCTGCGGATCCACTTGGG + Intronic
1164534289 19:29073568-29073590 CTGTCTTTGCCAAGACAATTAGG - Intergenic
1165324573 19:35106799-35106821 CTCTCTCTGCAGACAAACCTGGG - Intergenic
1165888984 19:39099269-39099291 CTGTCCCTTCAGAGACACACTGG - Intronic
1167379495 19:49130326-49130348 CTGTGTCTCCGGAGACACTCTGG + Intronic
925402448 2:3585413-3585435 CTGTCTCATCAGAGACTATTAGG - Intergenic
928656729 2:33459782-33459804 CTGTCTTTCCAGAGAGACTGGGG + Intronic
928693926 2:33829565-33829587 CTATCTCTGCACAGATACATGGG - Intergenic
933993028 2:87647259-87647281 CTGTCTCTGCAGAGGCCCCTTGG - Intergenic
934051117 2:88211845-88211867 CTGTCTCTCCAGATGCAATTGGG - Intergenic
935243363 2:101197003-101197025 CTTTCTCAGCAGAAACACTGTGG - Intronic
936300829 2:111303620-111303642 CTGTCTCTGCAGAGGCCCCTTGG + Intergenic
938041277 2:128078181-128078203 CTGTCTTGGGAGAGATACTTGGG + Intergenic
938449849 2:131408086-131408108 CTTTTGCTGGAGAGACACTTTGG + Intergenic
938883924 2:135623977-135623999 CTGTCTATACAGAGAGACATGGG + Intronic
939309233 2:140452157-140452179 CTGTCTCAGCAGCTACATTTGGG - Intronic
940236491 2:151516465-151516487 CTGCATCTGCTGAGACTCTTTGG + Exonic
940381116 2:153016375-153016397 GTGTCTCTGCAGAGTAATTTTGG + Intergenic
940834007 2:158500253-158500275 CTTTCTCTACAGAAACACTGGGG - Intronic
945198608 2:207259974-207259996 CTGTGTCTGCATAAACATTTTGG + Intergenic
945395609 2:209312179-209312201 CTGTCACTGCTGAGACCTTTAGG - Intergenic
945419588 2:209617823-209617845 ATAACTCTTCAGAGACACTTTGG + Intronic
945749743 2:213766776-213766798 AGGTCTCAGCAGAGACACATGGG + Intronic
946177068 2:217928544-217928566 CTGTCTTTGGAGGGACACTCAGG - Intronic
947563160 2:231175812-231175834 CTGTTTGTGCAGAGATTCTTTGG + Intergenic
948164987 2:235854229-235854251 CTGTCACAGCTGAGAAACTTAGG + Intronic
948605665 2:239133166-239133188 CTGTCTAAACAGAGACACATGGG + Intronic
1168900341 20:1358466-1358488 CAGTCTCTGCAGAGCCTGTTGGG + Intronic
1172096917 20:32465019-32465041 TTCTCTCTGCAGAGACCCTGGGG + Intronic
1174915158 20:54646025-54646047 CTCTCTCTGCAGAGAAATCTTGG - Intronic
1175541471 20:59750699-59750721 ATTTCCCTGCAGAGACACTCGGG - Intronic
1176663925 21:9666625-9666647 CTGTTTCTGCAGAGGGATTTGGG + Intergenic
1176870065 21:14076755-14076777 CAGCCTATGCAGAGACACGTTGG - Intergenic
1177717609 21:24859778-24859800 CTTTCTATGCAGAGACCCTGAGG - Intergenic
1179404505 21:41114102-41114124 CTCTCTCTGCAGAGACCCTTGGG - Intergenic
1179884718 21:44308925-44308947 CTGTGTCTGCCAACACACTTGGG - Intronic
1181049808 22:20233177-20233199 CAGTCTCTGCAGGGACACCCCGG + Intergenic
1181393780 22:22603659-22603681 ATGTGTCTGCAGTGACACTGGGG - Intergenic
1182102438 22:27667589-27667611 CAGTCTCTGCAGAGGGACTGTGG + Intergenic
1182136073 22:27904414-27904436 CTGTCTCTGTAGATATACTGTGG - Intronic
1182248435 22:28979665-28979687 CTGTTTTTGCTGAGCCACTTGGG - Intronic
1183062567 22:35345231-35345253 CTGCGTCTGCAGAGACACCAGGG + Intronic
1183442144 22:37829336-37829358 CTGGCTCTTCAGACACAATTGGG + Intergenic
1184721121 22:46314088-46314110 CTGTTTCTGCAGAACCACTTAGG + Intronic
950917011 3:16656381-16656403 TTGTGTCTTCAGAGACACTATGG + Intronic
951269604 3:20608265-20608287 CTGTCTCTGCTGAGTCATGTAGG - Intergenic
952328958 3:32346267-32346289 CTGTCTCTGAGGAGAAACATGGG - Intronic
953971049 3:47347250-47347272 CTGTCTCTAGAGAGGGACTTAGG - Intergenic
955849107 3:63200638-63200660 ATGTATTTGCAGAGAAACTTTGG - Intergenic
956162331 3:66368297-66368319 CTGTCTCTGTAGGGCCTCTTCGG + Intronic
956601976 3:71032278-71032300 CTGTCTGTGCAGTGGCACTGAGG + Intronic
957667756 3:83256356-83256378 TTGTCTATACACAGACACTTTGG + Intergenic
958072698 3:88635189-88635211 CTCTCTCTGGATAGACACTCTGG - Intergenic
958815186 3:98906237-98906259 CTGTCTGTGCAGAAACATCTGGG + Intergenic
961220411 3:125194758-125194780 CAGTCTCTGCAGGTGCACTTTGG - Intronic
961516732 3:127442674-127442696 CTGGCTCTGCAGTGTCACCTTGG + Intergenic
962877798 3:139549239-139549261 CTATCTCTCCAGAGGCACTGGGG - Intergenic
964298206 3:155257613-155257635 CTGTCTCAGCAGACACAGCTAGG - Intergenic
971520355 4:27541833-27541855 CTGTCTCTGCCAAGAGACTCTGG + Intergenic
971554967 4:28002198-28002220 CTGTCTCTGCTGAGTCACACAGG + Intergenic
972380146 4:38511949-38511971 CTGTCTCTGAAAAGACAGTCTGG - Intergenic
974366009 4:60950016-60950038 CTGACCCTGCAGAGATACTCTGG + Intergenic
975143547 4:70941706-70941728 CTTTCTTTTCAGAGAAACTTTGG + Intronic
976727720 4:88231029-88231051 CTGTCTCTGCACTGAGATTTGGG - Intronic
977502777 4:97862197-97862219 GTGTCTCTGCACACACACATAGG - Intronic
980619578 4:135282351-135282373 TTGTCTCTGGAGAGAAATTTAGG + Intergenic
981075685 4:140589044-140589066 CGGTCTTTGCAGATACACATAGG - Intergenic
981416805 4:144503362-144503384 CTGTCTCTGCCCTGACACTGTGG - Intergenic
981449445 4:144879542-144879564 TTGTGTCTGTGGAGACACTTGGG - Intergenic
981935202 4:150232170-150232192 CTGTCCCTACAGGGACAATTAGG + Intronic
982133085 4:152247747-152247769 CTGCCTCTGCAGAGAGGCTCTGG - Intergenic
982630545 4:157824351-157824373 CTGCCTCTGCTGAGTCACTCAGG - Intergenic
984078962 4:175218825-175218847 TTGTCTGTCCATAGACACTTAGG + Intergenic
984196585 4:176664688-176664710 CTGTTTCTGCAGAAACACCTGGG - Intergenic
985148871 4:186924725-186924747 TTGTCTCTGCAAAAAGACTTTGG + Intergenic
985334596 4:188878287-188878309 CTGTCCCTGCAGAGACTCACAGG - Intergenic
985409382 4:189667307-189667329 CTGTTTCTGCAGAGGGATTTGGG + Intergenic
985683824 5:1271361-1271383 GAGTCTCTGCAGACACACATGGG + Intronic
986965348 5:13263737-13263759 CTGACTCTGCAGTGGCACCTTGG - Intergenic
988428301 5:31089720-31089742 CTGTCAATTCAAAGACACTTTGG + Intergenic
988461674 5:31444268-31444290 CTCTTTCTGAACAGACACTTGGG + Intronic
990514218 5:56517078-56517100 CTGACTGTGCAGAGCAACTTTGG + Intronic
991003855 5:61808963-61808985 CTGGGGCTGCAGAGACACTGAGG + Intergenic
991048880 5:62251695-62251717 ATGTTTCTGCTGAGACATTTAGG - Intergenic
991711205 5:69410525-69410547 CTCCCTCTGAAGCGACACTTTGG + Exonic
992886837 5:81167837-81167859 CATTCTCTGGAGAGACTCTTAGG + Intronic
994429552 5:99640094-99640116 ATGTCTTTGCAGAGAGATTTGGG + Intergenic
995647786 5:114332309-114332331 CTGTGTCTTGAGAGACAGTTAGG + Intergenic
996551694 5:124737269-124737291 ATGTGTCTGCAGGGACATTTAGG - Intronic
997345600 5:133189755-133189777 TTGTCTCTCCACACACACTTGGG - Intergenic
997798352 5:136834178-136834200 CTGTCTCTGCTGAGTCACACAGG + Intergenic
999751476 5:154631211-154631233 CTGTCCCAGCAGATCCACTTTGG + Intergenic
1000186895 5:158867494-158867516 CTGGAACTACAGAGACACTTTGG + Intronic
1001998360 5:176180229-176180251 CTTTTGCTGGAGAGACACTTTGG - Intergenic
1002442620 5:179272312-179272334 CAGTCTCTGCACAGACTCATGGG - Intronic
1002770553 6:287129-287151 CCCTCTGTGCAGGGACACTTCGG + Intergenic
1002981559 6:2143328-2143350 CTTTCTCTGCAGAGCCACACGGG + Intronic
1005504294 6:26456753-26456775 CTGTCACAGCAGAGACACAGTGG + Intergenic
1007342987 6:41204053-41204075 CAGTCTCTCCAGAGACACTAGGG + Intergenic
1007866253 6:44973147-44973169 ATGTATTTACAGAGACACTTTGG - Intronic
1008077384 6:47159307-47159329 CTGTCTTTCCAGACTCACTTTGG - Intergenic
1008126881 6:47678894-47678916 CTGTCACTGCAGTGACACCTTGG + Intronic
1009454366 6:63838447-63838469 CTGTCTCTGGAGAAGCCCTTAGG - Intronic
1009859468 6:69308190-69308212 CTGCCTCTACAGAGTGACTTTGG + Intronic
1014348164 6:120302052-120302074 AGGTCTCTCCCGAGACACTTGGG + Intergenic
1014764745 6:125393479-125393501 CAGACTCTGAGGAGACACTTAGG - Intergenic
1018617197 6:165698281-165698303 CTGTCTCTACAGAAATACTATGG + Intronic
1020088148 7:5322706-5322728 CTGCCCCTGCCAAGACACTTGGG + Intronic
1020387926 7:7628011-7628033 CTGTCTCTGGAAAGACAATGTGG + Intergenic
1020638639 7:10727925-10727947 CTGTATCTTAAAAGACACTTGGG - Intergenic
1021593717 7:22292758-22292780 CTGTGTCTGTAGTGACACATGGG + Intronic
1021980458 7:26049250-26049272 CTGTCCCTGCAGTGACTCTGAGG - Intergenic
1023940098 7:44763728-44763750 CTGTCTTTGCAGAAATACTCTGG + Intronic
1025206163 7:56994419-56994441 CTGCCCCTGCTGAGACACTTGGG - Intergenic
1025665777 7:63582520-63582542 CTGCCCCTGCCGAGACACTTGGG + Intergenic
1026262714 7:68769684-68769706 CTGTCTTTGCAGGCTCACTTGGG - Intergenic
1027149518 7:75722988-75723010 CTGTCTATGCAGCGAGACATGGG + Intronic
1028501824 7:91527599-91527621 CTGTCTCTGCTGAGTCACACAGG - Intergenic
1029899184 7:104021961-104021983 CTGGCTCTGCAGTCACAGTTTGG - Intergenic
1032952042 7:136925682-136925704 CTGTCTCTGCAGAAATATTCAGG + Intronic
1034214953 7:149398114-149398136 CTGTTTCTGCAGAAACCCTGTGG - Intergenic
1034499227 7:151439506-151439528 GGGTCTCTTCAGGGACACTTAGG - Intronic
1035048510 7:155984513-155984535 GTGCCTCTGCAGAGATACCTGGG + Intergenic
1036644828 8:10606400-10606422 ATGACTCTGCAGAAATACTTGGG - Exonic
1039765529 8:40624272-40624294 CTCTCTCTGCACACACACTGAGG + Intronic
1040412544 8:47169100-47169122 CTGTCACAGCAGAGACTCTTTGG + Intergenic
1041144818 8:54862812-54862834 CTGTGGCTGCAGAGACATCTGGG + Intergenic
1043193066 8:77251393-77251415 GTGTTTCTGCAGAGACACAAAGG - Intergenic
1043193068 8:77251398-77251420 GTGTCTCTGCAGAAACACCTGGG + Intergenic
1043493413 8:80773763-80773785 ATGTCTCTGCTGAGAAACTATGG - Intronic
1043800890 8:84608307-84608329 CTGTCCCTGCAGGGAGACATGGG + Intronic
1044153829 8:88817827-88817849 CTGTCTCTGAAGACACACTATGG + Intergenic
1044551225 8:93514644-93514666 CTGCCTCTGCAGACACACAAAGG + Intergenic
1045231525 8:100310665-100310687 CTGTCTTTGCAGAGGCTGTTAGG + Intronic
1048940710 8:139398209-139398231 CTGTCTCCACAATGACACTTAGG + Intergenic
1051436640 9:17040689-17040711 CTGTCTGTTGACAGACACTTAGG + Intergenic
1051485415 9:17603274-17603296 TTATCTCTCCACAGACACTTGGG - Intronic
1051617197 9:19017536-19017558 CAGTCTCTGCAGAGTGATTTGGG + Intronic
1051977500 9:22969810-22969832 CTGGCTCTGCTGAAACCCTTTGG - Intergenic
1053385420 9:37683579-37683601 CAGTATCTGCAGAGACACGAGGG + Intronic
1055419326 9:76121692-76121714 TTTTCTCTCCAGAGACCCTTGGG + Intronic
1056736828 9:89217002-89217024 CTTTTTCTGCAAAGAGACTTTGG - Intergenic
1057517875 9:95737208-95737230 ATGTCTATGCAGAGTGACTTGGG - Intergenic
1058507596 9:105681973-105681995 CTGTCTCTCCAGAGAGACCTGGG - Intergenic
1059134757 9:111794748-111794770 TTGTCTCTACAGAGCCACATCGG + Intronic
1060240239 9:121896947-121896969 CTGACTTTGCAGAGCCAGTTTGG - Intronic
1060778758 9:126396211-126396233 TTGTCTCCGCAAAGAAACTTGGG + Intronic
1062632328 9:137469384-137469406 CTGTATCTGAAGAGACAGTGTGG + Intronic
1203662175 Un_KI270753v1:55137-55159 CTGTTTCTGCAGAGGGATTTGGG - Intergenic
1185664500 X:1754729-1754751 CTGACTCTGCAGGGATACTGAGG - Intergenic
1186509405 X:10119133-10119155 CTGTGTTTGCAAACACACTTTGG + Intronic
1188283803 X:28303317-28303339 CTGTCTCTGAAGAAACTTTTAGG + Intergenic
1189329554 X:40135028-40135050 CACTTTCTGCAGAGACACTTAGG + Intronic
1189900165 X:45698300-45698322 TTGTCTCTGAAGAGATGCTTGGG + Intergenic
1189995846 X:46636683-46636705 CTGTCTGTGCTGTGGCACTTTGG - Intronic
1191129991 X:56997548-56997570 CTGACTCTGCAGATAAACTTGGG + Intergenic
1191169888 X:57433013-57433035 TTTTCTTTGCAGAAACACTTTGG + Intronic
1192672554 X:73161244-73161266 CTGTCTTTGCTGAGCCACCTGGG + Intergenic
1194548598 X:95269416-95269438 CTTTCTATGCAAAGAGACTTGGG - Intergenic
1194739671 X:97557554-97557576 ATGTCTCTGCCAAGACTCTTGGG + Intronic
1194766492 X:97848560-97848582 CTGTCTCTGTAGAGAGGCTAAGG - Intergenic
1195233998 X:102878974-102878996 CTGCCTTTGCAGAGACAATGGGG - Intergenic
1195650074 X:107274846-107274868 CTGGCTCTGCAGCCACGCTTGGG + Intergenic
1196685650 X:118508228-118508250 CTGGCTCTGCAGAGGTACCTGGG + Intronic
1196725349 X:118890309-118890331 CTGACTCAGCAGTGACAATTAGG - Intergenic
1199082878 X:143595732-143595754 CTGGCTCTGCAGCCACCCTTGGG - Intergenic
1201474717 Y:14367791-14367813 CCAACTCTGCAGAGTCACTTTGG - Intergenic