ID: 1085558093

View in Genome Browser
Species Human (GRCh38)
Location 11:77443843-77443865
Sequence AGCTGCTTGGTGCCCTAGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 113
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 105}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085558093 Original CRISPR AGCTGCTTGGTGCCCTAGAC AGG (reversed) Intronic
900373354 1:2342258-2342280 TGCTGCCTGGTGCCCTACACAGG - Intronic
901474867 1:9482587-9482609 AGCGGGTTAGTGTCCTAGACAGG + Intergenic
903072552 1:20733666-20733688 AGCTGCTTGGTGGCTGAGACAGG - Intergenic
905878162 1:41446672-41446694 AGCTGCTTGGTGGCAAAGCCTGG + Intergenic
906673844 1:47678940-47678962 AGCTGCTCTGTGGCCGAGACAGG - Intergenic
917961988 1:180153048-180153070 AGGTGCTCAGAGCCCTAGACTGG - Intergenic
919411372 1:197247475-197247497 AGCTGCTAAGTGCCCTTGAAAGG - Intergenic
1067030739 10:42877685-42877707 TGCAGCTGAGTGCCCTAGACAGG - Intergenic
1067282297 10:44881585-44881607 AGCTGCATGGTCACCCAGACAGG - Intergenic
1071346477 10:84698729-84698751 AGCTGCTTGGTGTTCTAAGCAGG + Intergenic
1073143597 10:101264792-101264814 AGCTGCTGGGAGCCTTAGAATGG - Intergenic
1074743447 10:116507385-116507407 AACTGCTTGATGCCCAAGATTGG + Intergenic
1078549628 11:12271181-12271203 AGCTGCTTCGTGCCACAGGCTGG + Intergenic
1081569201 11:44279135-44279157 AGCTCCCTGCTACCCTAGACTGG - Intronic
1084727198 11:70949587-70949609 TGAGGCTTGGTGCCCTAGTCTGG - Intronic
1085558093 11:77443843-77443865 AGCTGCTTGGTGCCCTAGACAGG - Intronic
1087244511 11:95818297-95818319 AGCTGCTTGGAGGCTGAGACAGG + Intronic
1088611534 11:111582063-111582085 AGCTACTTAGTGCCCTAACCAGG + Intergenic
1089256300 11:117196105-117196127 AGCTCCTTTGTGTCATAGACCGG + Exonic
1089305554 11:117524190-117524212 AGCTCCTTGGACCCCTAGAAGGG + Intronic
1090265605 11:125351214-125351236 AGCTGCTGGGTGCCCAGGGCGGG + Intronic
1102295579 12:111733958-111733980 AGGTGCTTGCTGTCCTTGACTGG + Exonic
1103840579 12:123860746-123860768 AGCTTCTTGGTGCCCTCCAGAGG + Intronic
1105512008 13:21060097-21060119 GGCTGCTTGGCGCCCTGGTCGGG + Intronic
1105915876 13:24915373-24915395 AGCAGCTGGGTGCACTAGAATGG + Intronic
1108058090 13:46505178-46505200 AGCTGCGTGTTGCACTACACCGG + Intergenic
1111152754 13:84279241-84279263 AACTGCCTGTTACCCTAGACAGG - Intergenic
1113710056 13:112457287-112457309 TGCTCCTGGGTGCCCCAGACAGG - Intergenic
1116757116 14:48961900-48961922 AGCTCCTTGGTGACCATGACGGG - Intergenic
1119385229 14:74254009-74254031 AGCAGCTAGAAGCCCTAGACTGG - Intronic
1121226617 14:92325859-92325881 AGCTGTTTTGTGCCCTGGATTGG - Exonic
1121549080 14:94784735-94784757 AGCTGCTTGGTGCAGTGGACAGG + Intergenic
1125334252 15:38612291-38612313 AGCTGCTGGGAGCCCTGGGCTGG + Intergenic
1125601782 15:40919337-40919359 GCCTGCTTGGTCCCCTAGGCTGG - Intergenic
1139307197 16:65996997-65997019 AGCTGCTGGGTGCTCTGGACAGG + Intergenic
1141894363 16:86949191-86949213 GGCTGCTTGCTTCCCTGGACGGG - Intergenic
1142753064 17:1999885-1999907 AGCTGCTCTGGGCCCTAGACAGG - Intronic
1143089155 17:4438508-4438530 AGCCTCTTGGTGTCCTAGAAAGG - Intronic
1148435143 17:47678350-47678372 AGCTGCTTGGAAGCCTATACTGG + Exonic
1151376837 17:73694939-73694961 AGCTGCTTGCTGGGCTTGACGGG + Intergenic
1151558855 17:74860435-74860457 AGCTGCTGGGTGAGCAAGACGGG - Intronic
1151625947 17:75275857-75275879 AGCTGCTTGGAGGCCAAGGCAGG + Intronic
1151706515 17:75771735-75771757 AGGTGTCTGGTGACCTAGACAGG + Intergenic
1152710162 17:81867373-81867395 AGCTGCTTGATTCCCTGGCCGGG - Intergenic
1160748878 19:724430-724452 AGCTACTTGGAGGCCGAGACAGG - Intronic
1164044352 19:21522782-21522804 AGCTACTTGGAGGCCGAGACAGG + Intronic
1166196389 19:41208531-41208553 AGCTGCTTGGAGGCCGAGGCGGG - Intergenic
1168614466 19:57826693-57826715 ACCTGCGTGGTGCACTACACCGG - Intronic
925142020 2:1557390-1557412 AGCTGCCTGGTGCCCCATCCAGG - Intergenic
927882309 2:26697473-26697495 GGCTTCTAGGTGCCCTAGGCTGG - Intronic
928230372 2:29493705-29493727 ATGTGCTTGCTGCACTAGACAGG - Intronic
931833888 2:66079367-66079389 AAATGCTGGGTGCCCTACACAGG + Intergenic
937670588 2:124533548-124533570 AGCTGCTTGAGGCCCTAGGTGGG - Intronic
938582671 2:132661294-132661316 ATCTGCTTGGTGCCATGTACTGG - Intronic
946020595 2:216637302-216637324 CCCTGCTTGGTCTCCTAGACAGG - Intronic
948164094 2:235848061-235848083 GGTTTCTGGGTGCCCTAGACAGG + Intronic
948722784 2:239912007-239912029 AGCTGCATGTTGCCCCAGAGAGG + Intronic
1168904560 20:1392833-1392855 ACCTGCGTGGTGCACTACACCGG - Exonic
1171322516 20:24258876-24258898 AGCTGATTGGTGGGCTAGACTGG - Intergenic
1173733334 20:45343256-45343278 CACTGCATGGTGCCCTAGAGAGG - Intronic
1174918529 20:54677865-54677887 AGCTGGATGGGGGCCTAGACAGG - Intergenic
1179955951 21:44738723-44738745 AGCTGCCTGGTGTCCTCCACAGG + Intergenic
1181080476 22:20411432-20411454 AGCTGCTTGGAGACTTAGGCAGG + Intergenic
1183088733 22:35506619-35506641 AGGTTCTTGTTGCCTTAGACAGG + Intergenic
1184240543 22:43209353-43209375 AGCAGCGAGGTGCCCTGGACAGG + Intronic
949941240 3:9156463-9156485 AGCTGCTGGGTGGCTTAGCCAGG + Intronic
950585008 3:13886124-13886146 AGCTGCTGGGAGCCCTGTACTGG + Intergenic
950722233 3:14891581-14891603 AGCTGGTTCCTGCCCGAGACTGG - Intronic
953186528 3:40643032-40643054 AGCGGCTTGGTGCCCAATAACGG - Intergenic
955544071 3:60008808-60008830 TGCTGCTTTGTCCCCTAGAGGGG + Intronic
955944959 3:64184728-64184750 AGCTACTTGGAGCCTGAGACAGG - Intronic
965416907 3:168407445-168407467 ACCTGCTTGGTGCCCAGAACAGG + Intergenic
965448166 3:168801840-168801862 GGCTGCTCTGTGCCCTGGACTGG + Intergenic
970446223 4:16125270-16125292 GGCTGCTGTGTGCCCTGGACTGG + Intergenic
971244947 4:24919016-24919038 AGCTGCTTGGTGCAATAGCAGGG - Intronic
972336044 4:38107858-38107880 AGCAACATGGTGCCCTAGAAGGG - Intronic
976872665 4:89813601-89813623 AGATCCTTGGTGACCTAGATGGG - Intronic
981018922 4:140004759-140004781 AGCTGCTGGGAGCCCTGGGCTGG - Intronic
984399316 4:179241323-179241345 AGCTGACTGGTCCCCTCGACTGG - Intergenic
985372892 4:189305707-189305729 AGCTGCATGGTGCTCTAAATGGG + Intergenic
997226302 5:132211760-132211782 AGCTGGTTGGCGCCCTAGTGAGG - Intronic
1002824224 6:758153-758175 AGCTTCTTGGAGCCATAAACAGG - Intergenic
1003219521 6:4146433-4146455 ATCTCCTTAGTGCCCAAGACAGG - Intergenic
1004263939 6:14132845-14132867 ATCTGCTTGATGCCCCAGGCAGG - Intronic
1004959029 6:20764482-20764504 AGCTGCTTGGTGACGTACTCTGG - Intronic
1005391886 6:25342337-25342359 AGCTGTTTGGTGACCAAGGCAGG + Intronic
1005781716 6:29200330-29200352 AGCTGCTGGGTCCCTTGGACAGG - Intergenic
1006370363 6:33640466-33640488 AGCTGCTTTGTTCCCCAGGCTGG + Exonic
1006863222 6:37187456-37187478 AGCTGCTCCCTGCCCTAGAGAGG - Intergenic
1016809412 6:148245086-148245108 AGCTGCTTGATGCCTTAAAGAGG + Intergenic
1016876475 6:148870555-148870577 AGGTGCATGGTGCCCTGGCCAGG + Intronic
1017615225 6:156240260-156240282 AGCTGTCTGGTACCCTAGGCTGG - Intergenic
1017864417 6:158430633-158430655 AGCTGCTTGGAGGCTGAGACAGG + Intronic
1020290554 7:6719385-6719407 AGCTGCTTGGAGGCTGAGACAGG + Intergenic
1024491847 7:49994713-49994735 TGCTGCTTGGAGCCCTTGACAGG - Intronic
1034964678 7:155383851-155383873 AGCTGCTTGCTGTCCCAGGCTGG - Intronic
1037823950 8:22149644-22149666 ATGTGCTTGGTGCCCGAGAAGGG - Intronic
1041289275 8:56293352-56293374 AGCTGCCTGGAGCTCTTGACTGG - Intergenic
1048134751 8:131737737-131737759 AGATGCATGGTGCCATAGAATGG - Intergenic
1049530049 8:143149497-143149519 AGCTGCGTGGTGCCCAGGCCTGG - Intergenic
1049560070 8:143305791-143305813 AGCTGGGTGGTGCCATCGACGGG - Intronic
1049625533 8:143618020-143618042 TGCTGCTTGCTGCCCGAGCCTGG - Intronic
1053297629 9:36926149-36926171 AGCTTCTAGGTGCCCAAGCCAGG + Intronic
1057282584 9:93723441-93723463 GGCTTCCTGGTGCCCTAGGCAGG - Intergenic
1060542665 9:124441214-124441236 AGCTGCTTGGGGGCCTGGGCTGG - Intergenic
1060670254 9:125462452-125462474 AGATGCTGGGTTCCCTAAACTGG - Intronic
1060978541 9:127779384-127779406 AGCTGGTTGCTGGCCCAGACTGG + Intergenic
1062427597 9:136513020-136513042 AACTGCCTGCTGCCCTACACAGG - Exonic
1190604470 X:52126616-52126638 AGCTGCTTGGAGAGCTAGCCAGG + Intergenic
1191946340 X:66538907-66538929 AGCTGTTTGGAGCCTTTGACAGG + Intergenic
1192148477 X:68697495-68697517 AACTCCTGGGTGCCCTGGACTGG - Intronic
1201643401 Y:16202003-16202025 AGCTGTTTGGTTCCCTCAACAGG + Intergenic
1201659414 Y:16383318-16383340 AGCTGTTTGGTTCCCTCAACAGG - Intergenic