ID: 1085560408

View in Genome Browser
Species Human (GRCh38)
Location 11:77467275-77467297
Sequence TGCCATGTGAACACAGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 632
Summary {0: 2, 1: 1, 2: 14, 3: 95, 4: 520}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085560408 Original CRISPR TGCCATGTGAACACAGAGGA AGG (reversed) Intronic
900985976 1:6072957-6072979 TGCCATGGCAACAAAGAGGCAGG + Intronic
901120009 1:6883492-6883514 TGCCAGGTGAGTACAGTGGAGGG + Intronic
901781155 1:11595551-11595573 TGCCAGTTGGACACAGAGGGTGG - Intergenic
902290317 1:15430988-15431010 TGCCAGGTGAGCAGAGAGGAGGG + Intergenic
903764493 1:25725397-25725419 TGCTACGGGAATACAGAGGAAGG + Intronic
905102569 1:35538069-35538091 TGCTATGGGAACACAAAGAATGG - Intronic
905137945 1:35814644-35814666 AGTCTTTTGAACACAGAGGACGG + Intronic
905540617 1:38757527-38757549 TGCTATGGGAAAGCAGAGGAGGG - Intergenic
905590915 1:39162541-39162563 TGCCATGGCAACATAGATGAGGG - Intronic
905861712 1:41356408-41356430 TGCCATGTGAAGACACAGGCGGG + Intergenic
905960560 1:42038981-42039003 TGCCTTGAGAACACAGAGGAAGG - Intergenic
906874043 1:49516290-49516312 TGCCATGAGATCACATAAGAGGG + Intronic
906880781 1:49587385-49587407 AGCTATGGGAACACAGAGGAGGG - Intronic
906920773 1:50062285-50062307 TGCCCTGAGAGCCCAGAGGAGGG + Intronic
907061208 1:51427540-51427562 TGCTATTGGAACACAGAGAATGG + Intronic
908020351 1:59892115-59892137 TGCCATGTGATGACACAGTATGG + Intergenic
908113078 1:60916238-60916260 TGCCATGTGAAGACACAGCAAGG - Intronic
908161202 1:61410161-61410183 TGCCATGTGAAGACATGGGAGGG + Intronic
908547407 1:65175399-65175421 TGCCATCTGCTCACACAGGATGG - Intronic
908648231 1:66302976-66302998 TGCCATGGAAACCCATAGGATGG - Intronic
908804293 1:67914235-67914257 TACCATGTGAAAACAAAGCAAGG + Intergenic
908827636 1:68148911-68148933 TGCCATGGGAACACAAAGAAAGG + Intronic
908850384 1:68369815-68369837 GGACATGTGTACACATAGGATGG + Intergenic
908870380 1:68604230-68604252 TGTCAGGTGAAGATAGAGGAAGG + Intergenic
908977588 1:69918049-69918071 TGCTATAGGAACACAGAAGAAGG - Intronic
909585767 1:77286040-77286062 TACCATGGGAACACAGAAGAAGG + Intronic
909599103 1:77442318-77442340 AGCCATGTGGGCACAGAGGGTGG + Intronic
909838760 1:80290899-80290921 TTTCATGTGCACACAGTGGAAGG + Intergenic
910010072 1:82450915-82450937 TGCCATGTGAACACACTGTGAGG - Intergenic
910289532 1:85587139-85587161 TGCCATGTGGAGAAAGAGAAAGG + Intergenic
910813973 1:91269634-91269656 TGCAATGGGAATGCAGAGGAAGG + Intronic
910819222 1:91328364-91328386 ACCCATGGCAACACAGAGGAGGG - Intronic
910828225 1:91431824-91431846 TGCTGTGGAAACACAGAGGAAGG - Intergenic
911356604 1:96828716-96828738 TGCCATGAGAGCACATGGGAAGG + Intergenic
911482444 1:98460720-98460742 TTTCATGGGACCACAGAGGAGGG + Intergenic
911524064 1:98963275-98963297 TGCCATTGGAACACAGAGAAGGG - Intronic
912558882 1:110536105-110536127 TGCTATGGGATCACAGAGGAGGG + Intergenic
912764020 1:112392704-112392726 GGCCATGTGAAGACGGAGGCAGG + Intergenic
913113568 1:115677269-115677291 TGCCATGGCAACAGAGAAGAGGG - Intronic
913265125 1:117036002-117036024 GTCCATGTGAGCAGAGAGGAGGG - Intronic
913287999 1:117245121-117245143 AGCTATGGGAACACAGATGAAGG + Intergenic
913484314 1:119319899-119319921 TGCTATGAAAATACAGAGGAAGG - Intergenic
914387405 1:147183590-147183612 TGTAATGAGAGCACAGAGGAAGG + Intronic
914820126 1:151095116-151095138 TGCCATGGGAGCACAAAGGAGGG + Intronic
914820161 1:151095601-151095623 TGCTATGGGAGCACAGAGGAGGG - Intronic
915013503 1:152712202-152712224 GGCCATTTGCACAGAGAGGATGG + Intergenic
915081495 1:153355668-153355690 CGCCATGGGAGCACACAGGAAGG + Intergenic
916667152 1:166976500-166976522 TGCCTTGGGAACATAGAGGAAGG + Intronic
916795532 1:168163622-168163644 TGCTATGAGAATACAGAGAAAGG - Intergenic
916803101 1:168232648-168232670 AGCCATGGGGACAAAGAGGAAGG - Intronic
917212756 1:172646825-172646847 TGCCATGTGAACTCACAGGGAGG + Intergenic
918057735 1:181036655-181036677 AGCCATGGGAGCACAAAGGAAGG - Intronic
918120158 1:181531312-181531334 TGCTAAGTGGGCACAGAGGAAGG - Intronic
918150601 1:181795227-181795249 TTTCCGGTGAACACAGAGGAGGG - Intronic
918252151 1:182712475-182712497 TGACATGTGAGCACATTGGAAGG - Intergenic
919960024 1:202457684-202457706 TGCTATGAGAGCATAGAGGAGGG + Intronic
920006103 1:202834993-202835015 TGCCCTGGGAGCTCAGAGGAGGG - Intergenic
920075511 1:203333590-203333612 GGCCATGTGAAGACACAGGCAGG + Intergenic
920107952 1:203567729-203567751 AGCCATGTGAAGACAGAGGCTGG + Intergenic
920728577 1:208461380-208461402 TGCCTTGTCCACAGAGAGGAGGG + Intergenic
921333003 1:214058645-214058667 TGTCATGTGATCAAAGAGGAAGG + Intergenic
921558583 1:216629072-216629094 TGGCATGGGAGCACAAAGGAAGG - Intronic
923278395 1:232418248-232418270 TGCAATGAGAACAGAGGGGATGG + Intronic
923560535 1:235036978-235037000 TGCCATGTGAGGACAGAGTGAGG + Intergenic
923809852 1:237301753-237301775 TACCATGCGAATAAAGAGGAGGG - Intronic
924288582 1:242513487-242513509 TGTTATGGGACCACAGAGGAGGG + Intronic
1063219168 10:3950434-3950456 GGACATGTGAACACAAAGAAGGG + Intergenic
1063544168 10:6963673-6963695 TACCACATGCACACAGAGGAAGG - Intergenic
1063875484 10:10473218-10473240 AGCCATGTGAAGACAGAGACAGG + Intergenic
1064502742 10:15992262-15992284 TGCTTTGGGAACACAGGGGAAGG - Intergenic
1064871062 10:19937476-19937498 AACCATGGGAACACAGATGAGGG - Intronic
1065698319 10:28400891-28400913 TGCTATGTATGCACAGAGGAAGG + Intergenic
1065827926 10:29588818-29588840 TTACATGTGAAAACAAAGGAGGG - Intronic
1065865365 10:29910493-29910515 GGCAATGGGAACAAAGAGGAGGG - Intergenic
1067722217 10:48736753-48736775 TGCTATGGGAACACAGAAGTAGG + Intronic
1069151310 10:64964641-64964663 TGTCATGTAAACTCAGAGAAAGG - Intergenic
1070083929 10:73216544-73216566 GACCTTGTGACCACAGAGGATGG + Intronic
1070085923 10:73237011-73237033 AGCCATGTAAAGACAGAGGCAGG - Intronic
1070520255 10:77246491-77246513 GGCTATGTGAAGACAGGGGAGGG + Intronic
1071291639 10:84193529-84193551 TCCCAGGAGCACACAGAGGAGGG + Intergenic
1071424478 10:85534292-85534314 AGAAATGTAAACACAGAGGAAGG - Intergenic
1071528928 10:86374571-86374593 GACCATGTGATCACAGAGGCAGG + Intergenic
1071829867 10:89360943-89360965 TGCCATGTGAAGAGAGAGCATGG - Intronic
1072183308 10:93009574-93009596 TGCAGTGAGAACACAGAGAAAGG + Intronic
1072527356 10:96285171-96285193 GACCATGTGAAGACAGAGGCAGG - Intergenic
1072534829 10:96354218-96354240 TGCAATGTGCAAACAGAAGACGG + Intronic
1073318327 10:102598469-102598491 TGCCATTAGAACAAACAGGAAGG - Intronic
1073366864 10:102950094-102950116 TGCTATGGGCACCCAGAGGAAGG + Intronic
1073596446 10:104805235-104805257 TGTCTTGAGAACACAGAGGATGG + Intronic
1073690519 10:105803405-105803427 TGTCAGGTGAACAAAGAGCATGG - Intergenic
1073851159 10:107619820-107619842 TGCCCTGTGAACTCAGATGCTGG + Intergenic
1074168514 10:110908644-110908666 TGCCATGGGAACACAGAATAGGG + Intronic
1074414060 10:113251675-113251697 TGCCATGGGAACTCAGAGGAAGG + Intergenic
1074520239 10:114214093-114214115 TGCCATGTGCTTAAAGAGGATGG + Exonic
1074772816 10:116744350-116744372 TGCCTTGAGGACACTGAGGAGGG - Intergenic
1074899831 10:117806412-117806434 AGCCATGGGAACACCGGGGAAGG - Intergenic
1075256868 10:120932286-120932308 TCCCATCTGAACACACAGGGAGG + Intergenic
1075539080 10:123297221-123297243 GGCCATGTGACCACAGAGGCAGG - Intergenic
1075638393 10:124046309-124046331 TGCCTTGTGATCACAGAAGATGG + Exonic
1076432565 10:130416219-130416241 GGCCAGGAGTACACAGAGGAGGG - Intergenic
1076742235 10:132492173-132492195 TTCTAAGTGAACACACAGGAAGG + Intergenic
1076794892 10:132793659-132793681 TGACCTGTGGACACAGAGGCCGG + Intergenic
1077862364 11:6194455-6194477 TGCTATGTGAATTCAGAGGGAGG + Intergenic
1078658001 11:13260457-13260479 TGCCATGCAAACACAGATCAGGG + Intergenic
1079142441 11:17821055-17821077 GGCCACGTGAAGACAGAGGCAGG + Intronic
1079468724 11:20758000-20758022 TGCCATGTGAAGATAGAGCAAGG - Intronic
1080183909 11:29456517-29456539 TGTCATGTGACTACAGAGGCAGG - Intergenic
1080698561 11:34624342-34624364 TGCCATCTGAAGACAGAGGCAGG + Intronic
1080935111 11:36855063-36855085 TGCTGTGGGAACACAGAAGAAGG + Intergenic
1081446900 11:43139437-43139459 AGCCATGTGATGACAGAGGCGGG + Intergenic
1081565216 11:44256558-44256580 CTACATGTGTACACAGAGGAAGG + Intergenic
1081847017 11:46248018-46248040 TGCCATGAGACCACAGGAGAGGG + Intergenic
1083313018 11:61795345-61795367 TCCCATGGCAACACAGAGGAGGG - Exonic
1084069626 11:66725950-66725972 TGCCCTGGAAGCACAGAGGAGGG - Intronic
1084081109 11:66825533-66825555 TGCCATGTGAGGACACAGGGAGG + Intronic
1084107080 11:66987285-66987307 GGTCATGTGAGCACAGAGGTTGG + Intergenic
1084143790 11:67252360-67252382 TGCCATTTTAATACAGATGAAGG + Intronic
1084447698 11:69213273-69213295 GGCCATGTGGAGACAGAGGCAGG + Intergenic
1084873730 11:72115472-72115494 ATACATGAGAACACAGAGGAGGG + Intronic
1084875476 11:72129177-72129199 AGTCATGTGAACATGGAGGAAGG - Intronic
1085474071 11:76778542-76778564 TGCCATGGCAGCACAGAGGAAGG + Intergenic
1085560408 11:77467275-77467297 TGCCATGTGAACACAGAGGAAGG - Intronic
1085662505 11:78382163-78382185 TGCCATGAGAGCACAGAGGAGGG - Intronic
1085724127 11:78939614-78939636 TGCTATGGGAACATAGAGAATGG - Intronic
1085743480 11:79095895-79095917 TGCCATGGGAACACAGGGTGTGG - Intronic
1086335823 11:85799756-85799778 TCAGATGTGAGCACAGAGGAAGG - Intronic
1086649842 11:89274782-89274804 TGCCAGATGAACACAAAAGAGGG - Intronic
1087045864 11:93843365-93843387 AGCTATGTGAACACAGGGGTTGG + Intronic
1087245622 11:95833006-95833028 TGCTATGGGGGCACAGAGGAAGG + Exonic
1087675273 11:101154469-101154491 ATACATGTGAACCCAGAGGAAGG + Intergenic
1089426032 11:118375877-118375899 AGCTATGGGAGCACAGAGGAGGG + Intronic
1089962986 11:122632211-122632233 TCCCATATGAATTCAGAGGAAGG + Intergenic
1090220076 11:125012543-125012565 GTCCATGTGAGCACAGAAGAAGG + Intronic
1090469720 11:126969402-126969424 TGCTATGGGAACTCAGAGGAGGG + Intronic
1091010103 11:131993281-131993303 AGCCATGCAAACAGAGAGGAGGG + Intronic
1091133483 11:133166526-133166548 TGTTATGGGAACACAGAGGAAGG + Intronic
1092073539 12:5653766-5653788 TGTCATGGAAACATAGAGGAGGG + Intronic
1092597647 12:10024855-10024877 TGCTATCAGAACACAGAAGATGG + Intergenic
1092696824 12:11181140-11181162 TGCAATTACAACACAGAGGAGGG + Intergenic
1094075192 12:26464791-26464813 TGCCATGGGCACACACAGGAGGG + Intronic
1094204060 12:27822021-27822043 TACCATGTGATCACAGAGCCTGG + Intergenic
1094367072 12:29695130-29695152 GGCAATGTGAAGACAGAGGCAGG - Intronic
1094416834 12:30225278-30225300 TGCCATGAGAAGTCAGAGAAAGG - Intergenic
1094623818 12:32104742-32104764 TGCCACGGGAGCACACAGGAGGG + Intergenic
1094634983 12:32217580-32217602 TGACTTGTGAAGACAGAGAAAGG + Intronic
1094694162 12:32800188-32800210 TGCCACATGAACACAGATGAAGG - Intronic
1095409077 12:41902648-41902670 GGCCATGTGAAGACAGAGGCAGG - Intergenic
1095728212 12:45474970-45474992 TCTCATGTGAACTCAGTGGAAGG - Intergenic
1096454044 12:51770552-51770574 TGCCAGGTCAACATCGAGGAAGG + Exonic
1096912733 12:55000447-55000469 TGCAATGAGAGCTCAGAGGAGGG + Intergenic
1100398110 12:94202512-94202534 TGTCATGGAGACACAGAGGAGGG + Intronic
1100764632 12:97850045-97850067 TGCCTTGTGACAACAGAGGCAGG + Intergenic
1100978428 12:100145496-100145518 TGCTATAAGAACACAGAGGAAGG + Intergenic
1101652351 12:106689078-106689100 TGCTGTGTGAGCACAGAGGAGGG + Intronic
1101655847 12:106719556-106719578 TGCTATGTGAGTGCAGAGGAGGG + Intronic
1101727210 12:107398023-107398045 TGCTATGAGAACACACAGCAGGG + Intronic
1102731255 12:115112679-115112701 GGCCATGTGAAGACAGAGGCAGG - Intergenic
1103049927 12:117770299-117770321 CGTCATGTGAAGACAGAGGCAGG + Intronic
1103807161 12:123582629-123582651 TGCATTGTAAACAGAGAGGAAGG + Intergenic
1104814379 12:131637471-131637493 TCCCATGTGTCCACAAAGGATGG - Intergenic
1106815803 13:33405421-33405443 AGCCATGTGAACACAAGGAATGG - Intergenic
1107114152 13:36728331-36728353 TGCCATGTGAAATGAAAGGACGG + Intergenic
1107614387 13:42149303-42149325 TGCAATGAGAACACAGTGAAGGG - Intronic
1109283419 13:60383574-60383596 TGGCATGTGACCATAGAGGCGGG + Intergenic
1110537080 13:76663608-76663630 TGCCAAATGAACACAGAGGAGGG + Intergenic
1110615763 13:77540435-77540457 TGCTATTTGAACACATAGTAGGG + Intronic
1110882287 13:80587053-80587075 TGCCTTGTAAACTCAGGGGAGGG - Intergenic
1112182390 13:97096715-97096737 TTCCAGGTGAAGAGAGAGGAAGG + Intergenic
1112870585 13:103965890-103965912 TGCCTTGGGAACACAGAGGCGGG + Intergenic
1113074926 13:106458840-106458862 TGCCAGGTGAAGACAGAGATGGG - Intergenic
1113639768 13:111949087-111949109 TGCTGTGAGATCACAGAGGAAGG + Intergenic
1113698512 13:112365589-112365611 TGCCATGTGAGGACACAGCAAGG + Intergenic
1113739012 13:112698119-112698141 TGACATTTGAACACAGAGGACGG + Intronic
1116607416 14:47018917-47018939 TGCCATGTGAACACAGAGGACGG - Intronic
1117434312 14:55701637-55701659 TGAGATGGGAACTCAGAGGAAGG - Intergenic
1118321324 14:64754917-64754939 TGCCAAGTGAGCACCAAGGAAGG + Intronic
1118516435 14:66533498-66533520 TGCCGTGGGTGCACAGAGGAAGG + Intronic
1118598533 14:67454753-67454775 TCCCATGGGAACACAAAGGCAGG + Intronic
1118908615 14:70042769-70042791 TGCCATGGGAACACAATGGAAGG - Intergenic
1119815400 14:77561966-77561988 TGCTGTGGGAGCACAGAGGAGGG - Intronic
1120221201 14:81736104-81736126 TGCCCTAGGAACACAGAAGAGGG + Intergenic
1121010887 14:90519495-90519517 CACCAAGTTAACACAGAGGATGG + Intergenic
1121036172 14:90705458-90705480 TGCCCTGGGAACCCAGAGGCCGG - Intronic
1121370722 14:93355947-93355969 TGTCATGGGAACACAGGAGATGG - Intronic
1121567694 14:94923103-94923125 TGCCATGTGAATACAGGAGATGG - Intergenic
1121854937 14:97259505-97259527 TGCAATGTGAAATCAGAAGAGGG - Intergenic
1121960255 14:98253157-98253179 TGCCAGGTCAGCACAGAGGAGGG - Intergenic
1122757479 14:103993648-103993670 TGCCATGTGACAACAGAGACAGG - Intronic
1123133014 14:106002112-106002134 TGAAATGTAGACACAGAGGATGG - Intergenic
1123583044 15:21732558-21732580 TGAAATGTAGACACAGAGGATGG - Intergenic
1123619694 15:22175155-22175177 TGAAATGTAGACACAGAGGATGG - Intergenic
1123711467 15:22990851-22990873 GGCAGTGTGAACACAGAGGCAGG + Intronic
1124057791 15:26258560-26258582 TGCCATGTGCATACTGGGGATGG + Intergenic
1125459201 15:39892657-39892679 GCCCATGTGACCACAGAGGCAGG + Intronic
1125730612 15:41890819-41890841 TGCCATTTGGACAGGGAGGATGG + Intronic
1126779291 15:52124893-52124915 TGCTATGGGACCAGAGAGGAAGG + Intronic
1128118073 15:65124844-65124866 TGACAGGTGAGCACAGAGCACGG - Intronic
1128643943 15:69361131-69361153 TGCCCTGTGAGAACAGAGGCAGG - Intronic
1128719791 15:69939972-69939994 AGCCAGGTGGACAGAGAGGAGGG - Intergenic
1128855224 15:71005293-71005315 TGCTAAGGGAACACAGAGAAAGG - Intronic
1128932277 15:71716171-71716193 TGCCATGTGAAAACAAAGGCTGG - Intronic
1130911937 15:88276856-88276878 CACCATGGGAACACAGAGGAGGG + Intergenic
1131852234 15:96555411-96555433 TCCCATGTGAGCACATAGGCTGG + Intergenic
1132014029 15:98300267-98300289 AGCCAAGTGAAAGCAGAGGAAGG - Intergenic
1132241522 15:100261240-100261262 TGCCATGTGACAATGGAGGAGGG + Intronic
1132625845 16:891120-891142 GGCCACGTGGACACAGGGGAAGG + Intronic
1133030126 16:3006736-3006758 GGCCATGTGAAGACGGAGGCAGG - Intergenic
1133318477 16:4898545-4898567 GGCCATGTGAAGACGGAGGAAGG + Intronic
1133839199 16:9393626-9393648 TGGGATGAGAACACAGAAGATGG + Intergenic
1133849807 16:9491895-9491917 TGTCAAGTACACACAGAGGATGG - Intergenic
1134304756 16:13022089-13022111 GGCCATGTGGAGACAGAGGCAGG - Intronic
1134612395 16:15619584-15619606 AGCTTTGAGAACACAGAGGAAGG - Intronic
1134920766 16:18114310-18114332 TAACATATTAACACAGAGGACGG + Intergenic
1135278496 16:21134055-21134077 TGCCCTGGGGACACAAAGGAGGG + Intronic
1135835164 16:25818860-25818882 TGATATCTGAAGACAGAGGATGG + Intronic
1136025401 16:27465182-27465204 GGCCAGGTGCACACTGAGGATGG - Intronic
1136178237 16:28533305-28533327 TTCCGTGTGATCCCAGAGGAGGG + Intronic
1137067895 16:35868686-35868708 TGGGAAGTGGACACAGAGGAAGG + Intergenic
1137312862 16:47283555-47283577 TGAAATTTGAAGACAGAGGATGG + Intronic
1137512213 16:49111276-49111298 TGCCGTGTGTCCACAGAGCAGGG + Intergenic
1137611896 16:49823847-49823869 TCCCATGGGAAGACAGAGGTAGG + Intronic
1138162821 16:54771967-54771989 TGCAATAGGAACAGAGAGGAGGG - Intergenic
1138538540 16:57673769-57673791 TGCCAGGTTAGCCCAGAGGAGGG + Intronic
1138546390 16:57722243-57722265 TGTCATGGGAACCCAGAGGGGGG + Intronic
1139002945 16:62536433-62536455 TGGAAAGTGAATACAGAGGATGG + Intergenic
1139024896 16:62804524-62804546 TGCCATGTGAAGACACAAGAAGG + Intergenic
1140345345 16:74207899-74207921 CACTATGGGAACACAGAGGATGG + Intergenic
1140588619 16:76324473-76324495 TGCCAGGAGAAAACAGAGCATGG + Intronic
1140990101 16:80202467-80202489 TGCTATGTGAGCCCAGAGGCGGG - Intergenic
1141384210 16:83604263-83604285 TGCCATGGGAAGTCAGAGAATGG - Intronic
1141956187 16:87373029-87373051 GGCCATGTGAAAAAAGAGGCCGG - Intronic
1142131301 16:88432773-88432795 TTCCCTGTGAACAGAGAGGAGGG + Exonic
1142593744 17:1019616-1019638 TATCATTTAAACACAGAGGAGGG + Intronic
1142767157 17:2071388-2071410 TGCCATCAGAACACACAGGTAGG - Intronic
1142878126 17:2864635-2864657 AACCCTGTGAACACAGAGGCTGG + Intronic
1142933329 17:3307137-3307159 TGCTATGGGAAGACAGAGGAAGG + Intergenic
1143675477 17:8429445-8429467 CTCCATGTGAGCTCAGAGGAAGG + Intronic
1143690403 17:8558342-8558364 TGCTATGGGAACATAGAGAAAGG + Intronic
1143698521 17:8639118-8639140 GGCCATGAGAAGAAAGAGGAAGG - Intergenic
1144581116 17:16460125-16460147 TGCCATGTGAGGACACAGGAAGG + Intronic
1144720760 17:17468345-17468367 TGCCATGTGAGAACAGAGTGAGG - Intergenic
1146659784 17:34658070-34658092 TGCTATGGGAACTCAGGGGAAGG - Intergenic
1146669518 17:34727129-34727151 TCCCATGAGAGCACAAAGGAGGG + Intergenic
1148985926 17:51621391-51621413 TGCTGTGTGAGCTCAGAGGATGG + Intergenic
1149382476 17:56107718-56107740 TACCAGGTGAACACAGGGGAGGG - Intergenic
1149558775 17:57593471-57593493 GGCCATGTGAAGACAGAGGTAGG - Intronic
1150134546 17:62688762-62688784 TGCAATGTGAGCAAAGAGGCTGG - Intronic
1151870602 17:76833985-76834007 TGCCATGTGAGGACACAGCAAGG + Intergenic
1151957410 17:77387288-77387310 GGCCATGTGAAGACGGAGCAGGG - Intronic
1152307676 17:79530773-79530795 TGCCGCGGGACCACAGAGGACGG + Intergenic
1152990085 18:355282-355304 TGCTATGGGAACAAACAGGAAGG + Intronic
1153116928 18:1669379-1669401 TGCAATGGGAACACAGAAGAGGG + Intergenic
1153409459 18:4777587-4777609 TGCCATGCAAACACAGAGGAAGG + Intergenic
1153415483 18:4841321-4841343 GGCCATGTGAGCACACAGCAAGG - Intergenic
1153459050 18:5313548-5313570 TCCCAAATGCACACAGAGGATGG - Intergenic
1154334242 18:13453156-13453178 TGCCCTTTGAAAACAGATGATGG + Intronic
1155192206 18:23439990-23440012 TGATATGTGAATACGGAGGAAGG - Intergenic
1155873446 18:31055337-31055359 TGCCAAGTGATTACAAAGGAGGG + Intergenic
1156028918 18:32690070-32690092 TGCCAGGCAAATACAGAGGAAGG + Intronic
1157807220 18:50667105-50667127 TGCCATGGGAATTCAGAGAAAGG - Intronic
1158410472 18:57200690-57200712 GGCCATGTGAAGACAGAGGTAGG + Intergenic
1159626340 18:70699497-70699519 GGCAGTGTGAACACAGAAGAAGG - Intergenic
1159853750 18:73559416-73559438 TGGCATGTGAACTGAGAGTATGG - Intergenic
1159923043 18:74243564-74243586 TGAGATGTGAAGCCAGAGGAGGG - Intergenic
1160053803 18:75461110-75461132 TGCCATGTGAAGACACAGTGAGG - Intergenic
1161982011 19:7634857-7634879 TGCCATGTGACCACGGAGGCAGG - Intronic
1162057353 19:8072495-8072517 CCCCATGTGAACACACAGGTTGG - Intronic
1163820229 19:19492230-19492252 TGCCATGTGTCCACAGGGGTGGG + Intronic
1164624384 19:29716479-29716501 TGCCATGGGCACCCAGAGGACGG + Intergenic
1164773769 19:30834488-30834510 TGTCATATGAAGACAGAGGATGG + Intergenic
1165057398 19:33186581-33186603 TGCCATGTGGCAAGAGAGGAAGG + Intronic
1165491464 19:36125831-36125853 GGCCATGGGCACACACAGGAGGG - Exonic
1166651277 19:44577018-44577040 GGCCATGTGAACACTGGGGCAGG + Intergenic
1166747676 19:45149347-45149369 TGCCACGTGAAGACAGAGGATGG + Intronic
1166919055 19:46216073-46216095 GGCCATGTGAAGACACAGGGAGG + Intergenic
1166922030 19:46235227-46235249 GGCCATGTGAAGACACAGGGAGG + Intergenic
1167549893 19:50153173-50153195 AACCATGTGAAGACAGAGGAAGG + Intronic
925392252 2:3503892-3503914 TGCCGAGTGAACAGAGAAGAGGG + Intronic
925898878 2:8494497-8494519 CGCCATGTGAGGACAGAGGCCGG - Intergenic
926437977 2:12856765-12856787 TGCTATGCGTGCACAGAGGAGGG - Intergenic
926752140 2:16206333-16206355 GGCCATGTGAAGACAGAGGCAGG + Intergenic
927213046 2:20650534-20650556 TGCCATGGGAACACAGTACAGGG - Intronic
927431854 2:23033256-23033278 TGCCATGTGAAGACATAGCAAGG - Intergenic
927432926 2:23042097-23042119 TCCCTTGAGACCACAGAGGATGG - Intergenic
927917850 2:26948050-26948072 TGGCAGGTGAAGACAGGGGAAGG - Exonic
928731250 2:34235971-34235993 TGCCATGTGAGGACACAGCAAGG - Intergenic
929029562 2:37637773-37637795 GACAATGTGACCACAGAGGATGG - Intergenic
929253922 2:39789318-39789340 TGGCCTGTTTACACAGAGGATGG + Intergenic
929613585 2:43290541-43290563 GGCCGTGGGAACCCAGAGGAGGG - Intronic
929657931 2:43752635-43752657 TGCCATGACAACACAGTGGCTGG - Intronic
929658185 2:43755208-43755230 CAGAATGTGAACACAGAGGAGGG - Intronic
930162569 2:48173129-48173151 TGCTATGTAAACACAGAGGTGGG + Intergenic
931570599 2:63665354-63665376 TGCCATGTGAAGGCAGAGATTGG - Intronic
932106315 2:68946060-68946082 TGACAAGTGAAAAGAGAGGATGG - Intronic
932753537 2:74388609-74388631 TGCTCTGTGAGCACAGAGGAGGG - Intronic
932886426 2:75553256-75553278 TGCTATGTGCACCCACAGGAGGG - Intronic
935708334 2:105875630-105875652 TGCCATGTGAGGACACAGCAAGG + Intronic
935731901 2:106071188-106071210 ACCCATGTGAAGACAGAGGCAGG - Intronic
937152444 2:119695340-119695362 TGCCATGGGAACAGAGGGGAGGG - Intergenic
937620857 2:123983654-123983676 TGCCATGTGGCCCCAGAGAAAGG + Intergenic
937711146 2:124981466-124981488 CCCCATGTGAACACAGATGTGGG - Intergenic
937780693 2:125833756-125833778 AGCCATGTGATGACAGAGGCAGG + Intergenic
938078639 2:128356391-128356413 TGACCTATGAACACAGTGGATGG - Intergenic
938588278 2:132712853-132712875 TGTTATGGGATCACAGAGGAGGG + Intronic
938797573 2:134731255-134731277 GACCATGTGAAAACAGAGGGAGG + Intergenic
940412160 2:153377546-153377568 TGGCAAGAGAGCACAGAGGAGGG - Intergenic
941865138 2:170326583-170326605 TGCCATGTCAATAGAGATGATGG - Intronic
942211746 2:173678176-173678198 ATCAATGTGAACACAGAGGGAGG + Intergenic
942227722 2:173831719-173831741 GGCCATGTGCACACTGAGCAAGG + Intergenic
943199593 2:184803376-184803398 TGCTATGTGAATATAAAGGAAGG - Intronic
944438078 2:199712770-199712792 TGCCATGTGATGACAGGGGCAGG - Intergenic
944911745 2:204317406-204317428 TGCTATGGGAACACAGAGGAGGG + Intergenic
945805660 2:214487081-214487103 TTCCATGTGAAGACAGAGGAAGG + Intronic
946157307 2:217815507-217815529 CACCATGCGAACACAGTGGAAGG + Intronic
946184295 2:217970070-217970092 CACCACGTGAAGACAGAGGATGG + Intronic
946352038 2:219161457-219161479 TGCCGTGGGAGCAAAGAGGAAGG - Intronic
946465991 2:219912734-219912756 TGCCAGGTGAACAAAGGGAAAGG + Intergenic
946918623 2:224553714-224553736 TGCCCTGTGAAGACACAGCAAGG + Intronic
946996314 2:225396089-225396111 GGCCATGCGAACAGAAAGGAAGG + Intergenic
947120195 2:226805944-226805966 TGCCAAGTGAATAGAGAGCACGG - Intergenic
947529297 2:230898696-230898718 TGCCATGGGATCACAGAGGAGGG + Intergenic
948316046 2:237029200-237029222 TGCCATGAGGGCCCAGAGGATGG - Intergenic
948389060 2:237598975-237598997 AGCCATGTGAAGACGGAGGCAGG - Intronic
1168973689 20:1948321-1948343 TCCCATGAGAACTCAGAGCAAGG - Intergenic
1169826116 20:9770602-9770624 TGCCAAGTGATTACAAAGGAAGG + Intronic
1170043614 20:12063749-12063771 GACCATGTGAAGACAGAGGGTGG + Intergenic
1170435929 20:16328792-16328814 TGCCATGTGAGAACACAGAAGGG - Intronic
1170892029 20:20384175-20384197 TGCCATGTGAGGACACAGGGAGG - Intergenic
1172119719 20:32590912-32590934 TGCCATGAGAACACATGGCAGGG + Intronic
1172701040 20:36853912-36853934 TTCCATGTGAACAGGAAGGAAGG + Intronic
1173157418 20:40626014-40626036 GACCATGTGAAGACAGAGGCAGG - Intergenic
1173652881 20:44678528-44678550 GGCCGTGAGAGCACAGAGGAGGG + Intergenic
1173970609 20:47149453-47149475 TGCCATTTTAACCAAGAGGATGG - Intronic
1174366486 20:50059716-50059738 GGCCGTGTGAAGACAGAGGCAGG + Intergenic
1176004273 20:62851687-62851709 TGTCATGTGGACACAGAAAAGGG + Intronic
1177562825 21:22778853-22778875 TGCCAAGTGAAGACACAGCAAGG - Intergenic
1179155767 21:38849773-38849795 TTCACTGTGAAGACAGAGGAAGG + Intergenic
1179169172 21:38959457-38959479 GGCCATGTGAAGGCAGAGAATGG + Intergenic
1179530217 21:42013149-42013171 TGTTATGGGAGCACAGAGGAGGG - Intergenic
1181048137 22:20226310-20226332 TGCCATGTGATCCCTGAGGCTGG + Intergenic
1181665621 22:24394326-24394348 TACCATGTGAAGACACAAGATGG - Intronic
1181806677 22:25378918-25378940 TGCCCTGTGCACAGAGAGGCAGG - Intronic
1182823542 22:33241338-33241360 TGTCATGAGAGCACAGAGAAGGG - Intronic
1182990761 22:34765299-34765321 CACCATGAGAACTCAGAGGAGGG + Intergenic
1183060901 22:35335800-35335822 GGCTCTGTGGACACAGAGGAGGG + Intronic
1183196467 22:36357171-36357193 TGCCGTGGGAACAAAGAGAAAGG + Intronic
1183258619 22:36779501-36779523 TGCGAGGTGGACACAGGGGAAGG + Intergenic
1184059439 22:42073315-42073337 TGGCATGGAAAAACAGAGGAGGG - Intergenic
1184106667 22:42371325-42371347 GGCCATGTGAAGACAGATGCAGG - Intergenic
1184566293 22:45294046-45294068 TGCCGTGGGAATCCAGAGGAGGG + Intronic
1184870600 22:47235585-47235607 TGATCTGTGAACACAGGGGATGG + Intergenic
1184970443 22:48016262-48016284 TGTAATGAAAACACAGAGGAAGG - Intergenic
949432161 3:3989413-3989435 TGCTATGGGAACATAGAAGAGGG + Intronic
950352795 3:12373802-12373824 TGCTGTGGGAACACAGAGAATGG + Intronic
950674319 3:14545407-14545429 AGGCATGTGAACACAGAGTCAGG + Intergenic
950884854 3:16354231-16354253 AGTTATGAGAACACAGAGGAGGG + Intronic
951188463 3:19741542-19741564 TAGCATGGGAAAACAGAGGAGGG - Intergenic
951946055 3:28137569-28137591 TACCATGAGAAAACTGAGGAAGG + Intergenic
952653170 3:35750736-35750758 TGACATGCAAAGACAGAGGAGGG + Intronic
952953924 3:38545036-38545058 CGCCCTGGGAACCCAGAGGAAGG + Intergenic
953458745 3:43064421-43064443 GGCAATGTGAAAACAGAGGTAGG - Intergenic
954704418 3:52471607-52471629 AGACATGTGATGACAGAGGAGGG - Intronic
954769442 3:52952924-52952946 TACCATGTGAAGACACAGCAAGG + Intronic
955015511 3:55065435-55065457 TGCCATGTGAACACTGGTCAGGG + Intronic
955453340 3:59094071-59094093 TGCTATGGGAGCACAAAGGAAGG - Intergenic
955475566 3:59332856-59332878 GGCCATGGGAACACAAAGCAGGG - Intergenic
956660022 3:71588144-71588166 GGACATGAGGACACAGAGGATGG - Intergenic
956781640 3:72607780-72607802 GGCCATGTGAAGACAGAGGCAGG + Intergenic
956974749 3:74566564-74566586 GACCATGTGAAGACAGAGGCAGG - Intergenic
957194607 3:77051335-77051357 TGCCATGTGTACAGGGAGGTGGG - Intronic
958454410 3:94311658-94311680 TGACATGTTAACACAGTGAAAGG + Intergenic
958907211 3:99955232-99955254 TGGCATGCTCACACAGAGGATGG + Intronic
959079421 3:101784340-101784362 TGCTATGGGAACTCTGAGGATGG + Intronic
959150791 3:102605194-102605216 TGTTTTGAGAACACAGAGGAGGG + Intergenic
959792516 3:110380039-110380061 TGCATTGTGAACACATAGCAGGG + Intergenic
960983234 3:123251488-123251510 TGCTAAGGGAACACAGAGGCAGG - Intronic
961584062 3:127907800-127907822 TGCTCTGGGAACACAGACGACGG + Intergenic
961929241 3:130516355-130516377 TGCCATAGGAACCCAGAAGAGGG - Intergenic
961979740 3:131064380-131064402 GGCCATGTGAAAACAGAGCAAGG - Intronic
962313877 3:134345867-134345889 TGCTATCTGGACACAGATGAGGG - Intergenic
962358446 3:134714949-134714971 TGTCATGGGACCACAGAGGAGGG + Intronic
963274990 3:143320938-143320960 TGCCATGTGAAGACAAAGGAAGG + Intronic
964874425 3:161350093-161350115 TGGAATGTGAACACAGTTGAGGG + Intronic
965014804 3:163143340-163143362 TGGAATGTGAGCACTGAGGAAGG - Intergenic
965523826 3:169696175-169696197 TGCCATGTGAGGACATAGCAAGG - Intergenic
966601341 3:181778278-181778300 TGCTATGGGAACATAGAGGAAGG - Intergenic
967286957 3:187881231-187881253 TACAATGGGAACACAGAGAAAGG + Intergenic
967391658 3:188962051-188962073 TGGTAAGGGAACACAGAGGAAGG + Intronic
968593171 4:1469768-1469790 GGCCATGTGAAGACAGAGGCAGG - Intergenic
969399967 4:6948026-6948048 TGCTTTGGGAGCACAGAGGAGGG + Intronic
969435252 4:7185720-7185742 TGCCATGGGAACAGAGAGCGGGG - Intergenic
970074581 4:12203078-12203100 TGCCATGGGAACACAGAGGAAGG + Intergenic
970124791 4:12797193-12797215 TGCTGTGGGAACACAGGGGAGGG + Intergenic
970179119 4:13370545-13370567 TGCTGTGGGAACACAGAGGAAGG + Intronic
970371662 4:15413198-15413220 CATGATGTGAACACAGAGGATGG - Intronic
970421005 4:15905784-15905806 TTCGATGTGAAGACAGTGGAAGG - Intergenic
970427614 4:15959926-15959948 TTCCATGTGAAGACAGAGGCAGG + Intergenic
971045359 4:22799758-22799780 TGCAATGGGAGCAAAGAGGAGGG - Intergenic
971098550 4:23435855-23435877 TGCCATGTGAGAACACAGCAAGG + Intergenic
971197189 4:24480789-24480811 TGCCATTTGAAGACAGATGATGG + Intergenic
972035491 4:34514483-34514505 TACCATGGGAACTTAGAGGAAGG - Intergenic
972474944 4:39441274-39441296 TGCCATGTGAAGGAAGAGGTAGG - Intronic
972706857 4:41553326-41553348 TGCTGTGGGAACATAGAGGAGGG + Intronic
972932456 4:44090311-44090333 TGCCATTTGAATACTGAGCATGG + Intergenic
973226701 4:47793166-47793188 TGCTCTGGGAACACAAAGGAGGG - Intronic
973549449 4:52018486-52018508 TGCCATTAGAACAGAAAGGAAGG - Intergenic
974097258 4:57376961-57376983 TGCCATGTGAAGATAGATGTAGG - Intergenic
974379491 4:61120186-61120208 GGCCATGGGAAGACAGAGGCAGG + Intergenic
974484906 4:62492631-62492653 TGCCATGTGAGGACAGAGCCAGG + Intergenic
974824604 4:67111632-67111654 GGCCATGTGAAGACAGAGGGAGG - Intergenic
975351582 4:73352909-73352931 TGTCATGTGAAAACATTGGATGG + Intergenic
975850431 4:78566280-78566302 TGGAATGTGAGAACAGAGGAGGG - Intronic
976334421 4:83869206-83869228 GGCCCTGTGAAGACAGAGGCAGG + Intergenic
976523793 4:86061937-86061959 TGCCATGTGTCCATAGAGAAAGG + Intronic
976869536 4:89774359-89774381 TGCTATGGGAACCAAGAGGAAGG + Intronic
977545822 4:98375238-98375260 TGCCATGTGAAGACAGAGGCAGG - Intronic
977772621 4:100877937-100877959 TGCCATTAGAACACTGAGAAAGG + Intronic
978133227 4:105225615-105225637 TGCCATGGGAATACAGGAGAGGG - Intronic
979552817 4:122010117-122010139 AGCCATGTGAAGACAGAGACAGG - Intergenic
979973453 4:127166383-127166405 TCCCATGAGAACACAGATGCAGG - Intergenic
981070836 4:140536373-140536395 TTCTATGTGAATATAGAGGAAGG + Intronic
981492088 4:145350119-145350141 TGGATTGGGAACACAGAGGAAGG + Intergenic
981913342 4:150007833-150007855 TGCCATGTGATGATAGAGGCAGG - Intergenic
982004175 4:151048825-151048847 TGTCATGAGAGCACATAGGAAGG - Intergenic
982069775 4:151685233-151685255 TGCAGTGGGAACAGAGAGGAGGG - Intronic
982295048 4:153819436-153819458 TGCCATCTGCAAACAGAGGCAGG - Intergenic
982440736 4:155432900-155432922 TGCCAACTGAAAACAAAGGAGGG + Intergenic
982722373 4:158871665-158871687 TGGCATGTGACCACAAAGCAGGG - Intronic
983183744 4:164678046-164678068 TGGGATCTGAGCACAGAGGAAGG - Intergenic
984268184 4:177519166-177519188 TGCAGTGTGAATGCAGAGGAGGG + Intergenic
984422512 4:179542764-179542786 GGCCATGTGAAGACAGAGGCAGG + Intergenic
984946399 4:184971929-184971951 TGTCATGGGAACACAAAGGAAGG - Intergenic
985962436 5:3312708-3312730 TGCAGTGTGAACATAGAGAAAGG + Intergenic
986053088 5:4108485-4108507 GGCCATGTGAGCACAATGGAAGG + Intergenic
986987051 5:13512101-13512123 GGCCATGTGAAGACACAGGGAGG - Intergenic
987939861 5:24519987-24520009 GGCCAAGTGAACACACAGGGAGG - Intronic
988419897 5:30992526-30992548 TGCCATGTGATGACAGAGGAAGG - Intergenic
988429762 5:31105748-31105770 TGCCATGTGATAACATAGTATGG - Intergenic
989030669 5:37115283-37115305 TGCCATTTGAAAAAAGAGTATGG - Intronic
989111725 5:37913302-37913324 GGCCATGGGAACAAAGGGGAAGG + Intergenic
989402198 5:41020401-41020423 TGCCATGTTAACAAAAATGAGGG - Intronic
989430563 5:41350217-41350239 TTCAATGAGAAAACAGAGGACGG - Intronic
990167130 5:53006757-53006779 GGCACTGTGAAAACAGAGGAAGG - Intronic
990283789 5:54279427-54279449 TGCCATGTGAGGACATAAGAAGG - Intronic
990807567 5:59682657-59682679 TGCCATGTAAAAACACAGCAAGG + Intronic
991413448 5:66367781-66367803 TGCCATGCTAACACAGTGAAGGG + Intergenic
991432825 5:66566350-66566372 TGCCATGGGATCACAGAGAAAGG + Intergenic
991776145 5:70087994-70088016 TACCATGTAGACACAGTGGAAGG + Intergenic
991855433 5:70963448-70963470 TACCATGTAGACACAGTGGAAGG + Intergenic
991869442 5:71096221-71096243 TACCATGTAGACACAGTGGAAGG + Intergenic
993120500 5:83768546-83768568 TCTCATGTGGACACTGAGGAAGG - Intergenic
993423814 5:87737052-87737074 TGCCATCTGAAGAAAGGGGATGG - Intergenic
993635579 5:90339108-90339130 TGCTGTGGGAACACACAGGAAGG - Intergenic
993685381 5:90930980-90931002 TGCCATGAGACCTCAGAGAAGGG + Intronic
993686458 5:90943757-90943779 GGCCATGTGACCACAAAGGAAGG - Intronic
994624792 5:102205193-102205215 GAACATGTGAACACAGAGAAGGG + Intergenic
995062232 5:107823358-107823380 AACCATGGGAATACAGAGGAGGG - Intergenic
995803984 5:116030462-116030484 TGGCATGTGAACACAGAGAGAGG + Intronic
996037478 5:118774485-118774507 TGCCTTTTGAATACAAAGGAAGG - Intergenic
996212235 5:120825532-120825554 TGCCATGTGAGGACATAGCAAGG + Intergenic
996591962 5:125158274-125158296 TGCTGTGGGAGCACAGAGGAGGG - Intergenic
996850458 5:127945816-127945838 GTCCATGTGAACACAAAGAAGGG - Intergenic
997674461 5:135702366-135702388 TGCCATGTGATGACAGAGGCAGG + Intergenic
998099329 5:139418963-139418985 TGCTTTAAGAACACAGAGGAAGG + Intronic
998755938 5:145379550-145379572 TGCAATGTTAACACAGAGTATGG + Intergenic
999058348 5:148606401-148606423 TTTCATGTGAACACAGTTGAAGG + Intronic
999662478 5:153880212-153880234 TGCCATGGTAGCATAGAGGAAGG - Intergenic
1000169913 5:158692019-158692041 TGAAATGTCAACACAAAGGAAGG - Intergenic
1000384177 5:160658258-160658280 GTCCATGGGAGCACAGAGGAAGG + Intronic
1001228677 5:169967203-169967225 GGACATGAGAACTCAGAGGAGGG + Intronic
1001229988 5:169978329-169978351 TGCCATGTGAACTGAGGGAAAGG - Intronic
1001537205 5:172506533-172506555 TGACAGGTGAAGACAGATGAAGG - Intergenic
1001652102 5:173323427-173323449 TGCCCTGAGAACACACAGGCCGG + Exonic
1001906356 5:175476851-175476873 TGCCATGAGAACACACAGAAGGG - Intergenic
1003494363 6:6651340-6651362 TGACATAGGAACACAGAGGCTGG - Intronic
1003644299 6:7902051-7902073 GGGCATGTGAGGACAGAGGACGG + Intronic
1003876382 6:10441335-10441357 TGGAATGTGATCACAGGGGAGGG + Intergenic
1004067839 6:12266594-12266616 TGCACTGGGAGCACAGAGGAGGG + Intergenic
1004068315 6:12273109-12273131 TGCACTGGGAGCACAGAGGAGGG + Intergenic
1004323214 6:14649310-14649332 TGACATATGAACAAAAAGGAAGG - Intergenic
1004371991 6:15060690-15060712 TACAATGTGAACACAAAGGCAGG - Intergenic
1004447206 6:15711312-15711334 TGCCATGAGAACACAGTGGCAGG + Intergenic
1004597247 6:17111856-17111878 TGCCATGTGAGGACACAGAAGGG - Intronic
1004886995 6:20060711-20060733 TGCCATGAGAACACTTAGGAGGG + Intergenic
1005047790 6:21658633-21658655 TGCAATGTGACCACTGAGGAGGG + Intergenic
1005074320 6:21891570-21891592 TGGCATTTGAACAGAAAGGAAGG - Intergenic
1005388542 6:25310260-25310282 TACCATGAGAACATAAAGGAGGG + Intronic
1005479710 6:26243845-26243867 TGCCTTTTGTAAACAGAGGAAGG + Intergenic
1011220328 6:85048371-85048393 TGCTCTGGGAACACAGATGAAGG - Intergenic
1011398439 6:86935178-86935200 TGTTATGGGAGCACAGAGGAGGG - Intergenic
1011808802 6:91105347-91105369 TGCCATGTGATGCCACAGGAAGG + Intergenic
1012065294 6:94542597-94542619 GTCCATGTGAACACAAAGAAGGG + Intergenic
1013085948 6:106857793-106857815 TGAGATGTGAGCAGAGAGGAGGG + Intergenic
1013339448 6:109199146-109199168 AGCCATGTGAAAACAGCTGAAGG + Intergenic
1014912304 6:127109634-127109656 TTCCATGTGAAGACATAGCAAGG - Intergenic
1017495631 6:154980709-154980731 TGCCATGTGACTACAGAGACGGG + Intronic
1018234901 6:161714424-161714446 TGCCATGTGAAGACACAGCAAGG + Intronic
1018761617 6:166898789-166898811 CGCCATGTGAACACACAGAGGGG + Intronic
1018761748 6:166899491-166899513 TGCCACGTGAACACACACGGGGG + Intronic
1018762163 6:166902131-166902153 CGCCACGTGAACACACAGAAGGG + Intronic
1019096316 6:169582958-169582980 TGCCATGTTAACTCAGAGTCAGG + Intronic
1019281384 7:202176-202198 TCCCATGTGCATAGAGAGGACGG + Intronic
1019677540 7:2323561-2323583 TGCCATGTTAACAGAGAGAAAGG + Intronic
1021415058 7:20374570-20374592 TGCCATGGAAACACAGGGGCGGG + Intronic
1021461595 7:20893602-20893624 TGCTTTGTGAGGACAGAGGAAGG - Intergenic
1021820397 7:24492414-24492436 TGCCAGGGGAATACAAAGGAGGG - Intergenic
1022063016 7:26819603-26819625 TGTCTTGTGAACACTGAGAAGGG - Intronic
1022357538 7:29630121-29630143 GGCCATGTGAAGACAGAGGCAGG - Intergenic
1022367850 7:29743085-29743107 GGCCATGTGAAGACAGAGGCAGG - Intergenic
1023446603 7:40238147-40238169 TGCCATGTGTACATAGCAGAGGG + Intronic
1024140165 7:46455053-46455075 TGCCATGTGCACAGAGAAGGAGG - Intergenic
1024334636 7:48195015-48195037 AGCCATGTGAGCACACAAGAGGG + Intronic
1024611275 7:51066346-51066368 TTCCCTGTGTCCACAGAGGAAGG - Intronic
1026167297 7:67921853-67921875 TGCCATGAGAATACAGAACAAGG + Intergenic
1027576280 7:79934864-79934886 TGGCAGGAGAACACAGACGAGGG + Intergenic
1028101150 7:86822552-86822574 TTGCATGTGAGCAAAGAGGAAGG + Intronic
1028697374 7:93730824-93730846 TGCCATGTGCACAAAGAGAAAGG + Intronic
1029943061 7:104500778-104500800 TCACATCTGAACACAAAGGAGGG - Intronic
1030402375 7:109068074-109068096 GGCCATGTAAAGACAGAGGCAGG - Intergenic
1030641081 7:112007143-112007165 TGTCCTGAGAACACAGATGAGGG - Intronic
1032004408 7:128288742-128288764 TGGCATGTGGAGACAGAGGCAGG + Intergenic
1032073035 7:128821455-128821477 TGCCATGGCAAGAAAGAGGAGGG - Intronic
1032287566 7:130552971-130552993 TGCTATGTGAATACACAGAAAGG + Intronic
1033148377 7:138891068-138891090 TGTCTGGAGAACACAGAGGAGGG - Intronic
1034731626 7:153392202-153392224 TACCATTAGAACAGAGAGGAAGG + Intergenic
1034949782 7:155289448-155289470 TGCTATGGAAACACAGAAGAGGG - Intergenic
1036460824 8:8950923-8950945 TGCTATGGGAGCACAGAGAAGGG + Intergenic
1036487685 8:9194396-9194418 AGCCATGGCAACAGAGAGGAAGG - Intergenic
1037993285 8:23335804-23335826 TGGGGTGTGAAGACAGAGGAAGG + Intronic
1038129202 8:24710510-24710532 TTTCATGGGAACACAAAGGAGGG - Intergenic
1038146938 8:24905780-24905802 TGTCATGAGAGCACAGAGGATGG - Intergenic
1038461160 8:27718218-27718240 TGCTCTGCGAGCACAGAGGAGGG - Intergenic
1038873574 8:31522599-31522621 AGCCATGTGTATACAGAGGCTGG + Intergenic
1039541132 8:38371782-38371804 TGCCATGTGAACTTTGAGAAAGG - Intronic
1039854466 8:41400323-41400345 CGCCAGGGGAACACAGAGGTGGG + Intergenic
1039948193 8:42147879-42147901 TGCTCTTTGATCACAGAGGAGGG + Intergenic
1040923927 8:52655404-52655426 TGCCTTTTGATCACAGAAGATGG - Intronic
1041174801 8:55184239-55184261 TCCCATGAGAACACTAAGGATGG - Intronic
1041474135 8:58244574-58244596 TGGCATGTGACAACAGAAGAAGG - Intergenic
1041774841 8:61512389-61512411 AGCAATGTGAACACAGAGGCAGG + Intronic
1041984141 8:63900273-63900295 TGCCTTGTGAAGAAAGATGATGG + Intergenic
1042390302 8:68226802-68226824 TGTCATGAGAACACAGAGAAGGG + Intronic
1043397536 8:79853583-79853605 GGTTATGGGAACACAGAGGAAGG - Intergenic
1044294188 8:90508565-90508587 TATTATGTGAACACAGAAGAAGG + Intergenic
1044361839 8:91294905-91294927 TGCTATGAGACCACAGAGGGTGG + Intronic
1045060418 8:98406057-98406079 TACAATGGGAACATAGAGGAGGG - Intronic
1045070240 8:98495995-98496017 TGCTATGATAACACAGAGAAGGG - Intronic
1045201589 8:99988643-99988665 TGCCATGGTAACACAAAGGAAGG + Intronic
1045203740 8:100014904-100014926 GTCCATGGGAACACACAGGATGG - Intronic
1045542742 8:103102137-103102159 TGCCATATCAACACACAGCAAGG - Intergenic
1045895613 8:107212531-107212553 TGCTCTGTGGACACAGATGATGG + Intergenic
1046607454 8:116387770-116387792 TGCCATGTGAAGAAGGATGAAGG + Intergenic
1047337298 8:123949001-123949023 AGCCATGTGGACACAGAGGAGGG + Intronic
1047503293 8:125458909-125458931 TTCTGTGGGAACACAGAGGAGGG + Intergenic
1047773352 8:128048779-128048801 TGCCCTTTGAAGAAAGAGGAAGG + Intergenic
1047800052 8:128299663-128299685 TGCTATGGGAACACAGAGAAGGG - Intergenic
1047819139 8:128499429-128499451 TGTTATGAGAATACAGAGGAGGG - Intergenic
1047928739 8:129705534-129705556 TGCCATGTGAAGAAGGAAGAAGG - Intergenic
1047949542 8:129919545-129919567 TGCTATGGGAAAACAGATGAGGG + Intronic
1048053208 8:130838887-130838909 TGCAATGTGGGTACAGAGGAAGG + Intronic
1048060256 8:130912163-130912185 TGCAATGAGAACACAGGGAAGGG - Intronic
1048245816 8:132797584-132797606 TGCCAGGTGTACACAGAGTTTGG + Intronic
1048276304 8:133068565-133068587 TTCCATGAGAACACCCAGGAAGG - Intronic
1048431324 8:134374215-134374237 TGCCATGGGAACATGGAGCAGGG + Intergenic
1048516389 8:135115495-135115517 AGTCATGTGAGCACAGGGGAGGG + Intergenic
1049537891 8:143190414-143190436 GGCCACGTGAAGACAGAGGAGGG - Intergenic
1049742348 8:144247222-144247244 TGCCACCTGTACCCAGAGGAGGG - Intronic
1050498119 9:6265911-6265933 TTCCATGTGAACAAGGAGCATGG - Intergenic
1050555401 9:6785285-6785307 TGCCATGTGAAGATGGAGGCAGG - Intronic
1050966401 9:11809594-11809616 GTGCATGTGAACACAAAGGAGGG - Intergenic
1051264665 9:15299030-15299052 TACTTTGTGAGCACAGAGGAGGG - Intronic
1052187426 9:25616228-25616250 TGCTTTGGGAACACAGAGTAAGG + Intergenic
1052275622 9:26672799-26672821 TGCCCTGGGAACATAGAGGCTGG - Intergenic
1052322750 9:27185572-27185594 TGCAGTGTGAACACAGTGGCTGG + Exonic
1052944715 9:34159033-34159055 TTCCAAGTGAACATATAGGAAGG - Intergenic
1053431536 9:38044908-38044930 GGACATGTGTACACAGAGGAGGG + Intronic
1055252733 9:74327822-74327844 TGCCATGAGATGACAGAGCAAGG - Intergenic
1055657142 9:78462308-78462330 TGACATGGGAACACAGGAGAAGG + Intergenic
1056100106 9:83293017-83293039 TCCCATGGGAGCACAAAGGAGGG + Intronic
1056967964 9:91180000-91180022 TGCGCTTTGAAGACAGAGGAAGG + Intergenic
1056980002 9:91300880-91300902 TGCCATGTAAGCATAGAGGAAGG - Intronic
1057303881 9:93901605-93901627 TGGCACGTGAACACTGAGGCAGG - Intergenic
1057552352 9:96061246-96061268 TGCCATGTGAAGGGAGAAGATGG + Intergenic
1057742055 9:97720563-97720585 AGCAATGTGACCACAGAGGTTGG + Intergenic
1057931492 9:99197412-99197434 TGGCGTGTGAGCACAGATGAAGG + Intergenic
1059029245 9:110672437-110672459 TGCTATGTGAACATAGGGTAGGG + Intronic
1059364638 9:113776752-113776774 TGCAATACGAACTCAGAGGATGG - Intergenic
1059437424 9:114285096-114285118 TCCCATGTCCACACAGATGATGG - Intronic
1059627506 9:116083103-116083125 TACCATGGGGACATAGAGGAAGG - Intergenic
1059663947 9:116428112-116428134 AGCTGTGTGAAGACAGAGGAAGG + Intronic
1060112524 9:120916850-120916872 TGACATGTGAGAACAGTGGAGGG + Intronic
1060235636 9:121860695-121860717 CACCATGTGAACATAGAAGAAGG + Intronic
1060869151 9:127025629-127025651 TGGCAAGTAAACACAGGGGAAGG - Intronic
1061016961 9:127986874-127986896 TGACATGAGCACACAGAGCAGGG - Intergenic
1061177712 9:129007638-129007660 TGAAATGTGGACACTGAGGACGG + Intronic
1061406042 9:130393599-130393621 TGCTGTGGGAGCACAGAGGAGGG + Intronic
1186328629 X:8508251-8508273 TGCACTGTGACCACAGGGGAAGG - Intergenic
1186927674 X:14353041-14353063 TGCAATGGGAGCATAGAGGATGG + Intergenic
1187050417 X:15690401-15690423 TGCTATGGGACCACAGAGGAAGG + Intronic
1187203096 X:17154860-17154882 TGCTCTGAGAACACACAGGAGGG + Intergenic
1187223631 X:17354642-17354664 TGTCATAGCAACACAGAGGATGG - Intergenic
1187286177 X:17906028-17906050 TGACATGTGAACACAGTGCTAGG + Intergenic
1187523659 X:20035199-20035221 TGCTCTGTCAACACAGAGAAGGG + Intronic
1187555627 X:20348687-20348709 TGCCATGTGAAGACACAGCGAGG - Intergenic
1189370292 X:40422766-40422788 TGCCATGTGAGCCCTGAGGAAGG + Intergenic
1189656945 X:43254527-43254549 AGTCATGTGAACACACAAGATGG + Intergenic
1189696091 X:43664467-43664489 TCCAATGTCAGCACAGAGGAGGG + Intronic
1189922549 X:45916663-45916685 TGCCGTGTGGACACTGAGGAAGG - Intergenic
1190484170 X:50908221-50908243 TGTCATGTATACAGAGAGGAGGG - Intergenic
1190735547 X:53253638-53253660 TACCTTGGGAACCCAGAGGAGGG - Intronic
1190990926 X:55549443-55549465 TTCATTTTGAACACAGAGGATGG - Intergenic
1191108615 X:56788242-56788264 TCCCATGTGAATAAAGAGGAAGG - Intergenic
1192306724 X:69968197-69968219 TGTCATGGGAGCATAGAGGAGGG + Intronic
1192492216 X:71586070-71586092 TGCCATAGGAGTACAGAGGAGGG + Intronic
1192538148 X:71946152-71946174 TGCCATGGGAGGACAGAGAAGGG + Intergenic
1195006701 X:100692191-100692213 TGCTATGGGAGCACAGAGGAAGG - Intronic
1195588215 X:106591390-106591412 AGCCATGTGAAGACTGAGGCAGG - Intergenic
1196320890 X:114339055-114339077 TGCCAGGTGAATACAGTGAAAGG - Intergenic
1196397531 X:115281071-115281093 GGCCATGTGATGACGGAGGAAGG - Intergenic
1196604206 X:117637593-117637615 TGCTATGAGATCACAGAGGGAGG - Intergenic
1197146772 X:123180603-123180625 TACCATGGCAGCACAGAGGATGG - Intergenic
1197605185 X:128577178-128577200 TGTTATGGAAACACAGAGGAGGG - Intergenic
1197766370 X:130061701-130061723 TGCTGTGGGAACCCAGAGGAGGG + Intergenic
1198662122 X:138981103-138981125 TGCTATGAGAACACAGAAAAGGG + Intronic
1198895024 X:141444338-141444360 GACCATGTGAAGACATAGGAAGG - Intergenic
1198981588 X:142403645-142403667 TGCTATGGGAACCCAAAGGATGG - Intergenic
1199005068 X:142686256-142686278 TTCCCTGTGAACCCAGAGGTGGG + Intergenic
1200010994 X:153120728-153120750 GGCCATGTGAACACATAACATGG + Intergenic
1200028605 X:153279194-153279216 GGCCATGTGAACACATAACATGG - Intergenic
1200050959 X:153431506-153431528 GGCCATGTGAAGACAGAGACAGG + Intergenic
1201433679 Y:13932694-13932716 TGCACTGTGACCACAGGGGAAGG + Intergenic
1202103897 Y:21341090-21341112 AGCCATGTGAAGACAGAGGTAGG - Intergenic