ID: 1085568623

View in Genome Browser
Species Human (GRCh38)
Location 11:77539464-77539486
Sequence CAGTTTTAAGAGATGGAAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 447
Summary {0: 1, 1: 0, 2: 3, 3: 33, 4: 410}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085568620_1085568623 -9 Left 1085568620 11:77539450-77539472 CCACAGAGAATAGCCAGTTTTAA 0: 1
1: 0
2: 1
3: 23
4: 197
Right 1085568623 11:77539464-77539486 CAGTTTTAAGAGATGGAAGAAGG 0: 1
1: 0
2: 3
3: 33
4: 410

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085568623 Original CRISPR CAGTTTTAAGAGATGGAAGA AGG Intronic
903877146 1:26482756-26482778 CAGTATTAAGAAAGTGAAGAAGG - Intergenic
904237722 1:29125042-29125064 GGCTTTTAAGAGCTGGAAGAGGG - Intergenic
905081964 1:35330752-35330774 CACTTTTAAGTGATGGAATCAGG + Intronic
905970001 1:42134515-42134537 CAGCTTTAAGGGCTGCAAGAGGG + Intergenic
906288872 1:44606368-44606390 TAGTTTTAAGAGAAGGAGGAAGG + Intronic
907345836 1:53779298-53779320 CAGTTTTTATATCTGGAAGATGG - Intronic
907363563 1:53941628-53941650 TAGTTTTAAGAGGAGAAAGATGG + Intronic
907727269 1:57031354-57031376 CAGTATTATCAGATGGAACATGG - Intronic
908629868 1:66091567-66091589 CAATTAGAAGAGATGGAAAAAGG - Intronic
910071454 1:83219105-83219127 CAGTTGTAACAGGTGGAAAATGG - Intergenic
910106355 1:83635143-83635165 CAGCTTTAAAAGATGCATGAGGG + Intergenic
910416752 1:87009234-87009256 CAGTTTAAAGGGATGGAGAAAGG - Intronic
911119421 1:94280491-94280513 AAGTACTAAGAGATGGAAGGAGG + Intergenic
911616623 1:100019610-100019632 CAGTTTCAGGAGATGGAATGAGG - Intronic
911686852 1:100787247-100787269 CAGCCTTTAGAGATGGGAGAGGG + Intergenic
912232435 1:107810848-107810870 CAGTTGTAAGGAAAGGAAGATGG + Intronic
912514082 1:110207262-110207284 CAGGTTTCAAAGAAGGAAGATGG + Intergenic
912600545 1:110928385-110928407 TAGTTTTAAGACCAGGAAGAAGG - Intergenic
912949260 1:114109418-114109440 TAGTCTTAAGAGCTGGAAGCTGG - Intronic
913389167 1:118291311-118291333 AAGTTTTAAAAGATGCAAGATGG + Intergenic
914986129 1:152458645-152458667 GAAGTTTCAGAGATGGAAGACGG + Intergenic
915442690 1:155955420-155955442 CAGTGCTAAGAAATGGGAGAAGG - Intronic
916572034 1:166036513-166036535 CACTTTTAAGAAATAGAAAATGG - Intergenic
916745248 1:167680209-167680231 CAGATCTAAGACATGGAAAATGG + Intronic
917078594 1:171233324-171233346 CAGTATTTACAGATGGAAAAAGG + Intergenic
917641156 1:176984318-176984340 CAATTTTAAGTGATGGGGGATGG + Intronic
918139484 1:181708417-181708439 CAGTTTTCTGAGCTGGAAAATGG + Intronic
918160494 1:181894425-181894447 CAATTTTCAGGGATGGAAAATGG + Intergenic
918477521 1:184941096-184941118 CAGTTTTGACAAATGGAAGAAGG + Intronic
920009595 1:202858326-202858348 CAGCTTTAAAAAATGGAGGAGGG + Intergenic
920571244 1:207019597-207019619 CATTTTGAAGAGATGCAAGAGGG - Exonic
921181517 1:212635520-212635542 CAGTCTTCAGAGATGGATGAGGG + Intergenic
921257332 1:213354499-213354521 CTGTTATAAGAAATGGAAAATGG - Intergenic
922173383 1:223176131-223176153 GAGTTTTCAGAGCTGGAAGGGGG + Intergenic
922320906 1:224485764-224485786 AAGTTTTAAAAGAAAGAAGAGGG - Intronic
922552316 1:226504890-226504912 CAGTTTAAGGAGATAGAAGTGGG + Intergenic
922678287 1:227567104-227567126 AAGTTTTAGGAGATGGGACATGG + Intronic
1063956500 10:11272479-11272501 CAGTTTTCAGAAATGGTGGATGG - Intronic
1064045910 10:12015269-12015291 AACTTTTAGAAGATGGAAGATGG - Intronic
1065236527 10:23658064-23658086 CAGTTTCAAGAGAGGCATGAGGG + Intergenic
1066372227 10:34826945-34826967 CAGTTTTAAGATGAGGAAAACGG + Intergenic
1066601348 10:37110760-37110782 CAGTTTTCAGTGCTAGAAGAAGG + Intergenic
1068647867 10:59489185-59489207 CAGTTTTTAGAGACTGAAAAGGG - Intergenic
1069126010 10:64634800-64634822 CATTTTTAAGAAATGGATGTTGG + Intergenic
1070124035 10:73605872-73605894 CAGTTTTATGAGATGAAACAGGG + Intronic
1071836885 10:89427076-89427098 CATTTTTAAGAGATGGTGAAAGG - Intergenic
1072781370 10:98253920-98253942 CAGTTTTAAGAGTCAGGAGATGG + Intronic
1072788752 10:98302436-98302458 GAGGTTTTGGAGATGGAAGATGG - Intergenic
1073370780 10:102987070-102987092 CAAATTTAAAAGATGGAAGCAGG + Intronic
1073654578 10:105399332-105399354 CAGTTTTAAGTGACAGAAGTAGG + Intergenic
1073916271 10:108408315-108408337 GATTTTTAAGACATGAAAGATGG + Intergenic
1074802732 10:117017728-117017750 CAAAAATAAGAGATGGAAGAAGG + Intronic
1077988397 11:7378557-7378579 CAGTTGATGGAGATGGAAGAGGG + Intronic
1078050586 11:7962060-7962082 CAGCTTTCAGTTATGGAAGAAGG - Intronic
1078236570 11:9490530-9490552 CACTTTTGAGAGATTGAAGCAGG - Intronic
1078538487 11:12194304-12194326 CAGCTGTAAGACATGGATGATGG + Intronic
1079676753 11:23237589-23237611 CAGATTAAAAAGATGGGAGAGGG + Intergenic
1080092054 11:28360202-28360224 CACTTTTAAGAGAAGGCAAATGG - Intergenic
1080230032 11:30010829-30010851 GAGTATCTAGAGATGGAAGAAGG - Exonic
1080602578 11:33834207-33834229 GAGTTTTAAAAGATGGTAAAAGG - Intergenic
1080787752 11:35491298-35491320 CAGTTTACAGAGAGGGAGGATGG - Intronic
1081267580 11:41045334-41045356 CAGCTTGAAGAGATGTAAAAAGG - Intronic
1081452308 11:43183259-43183281 CAGTTTTCTGATATGGAAAAAGG - Intergenic
1081726939 11:45336671-45336693 CAGTTTTGGGAGGTGGAAGGAGG - Intergenic
1083867471 11:65464596-65464618 CATTTTTAAGAGAATGAAGACGG + Intergenic
1084406203 11:68975053-68975075 CAGATTGAAGACAGGGAAGAGGG + Intergenic
1085568623 11:77539464-77539486 CAGTTTTAAGAGATGGAAGAAGG + Intronic
1085725901 11:78954251-78954273 CACGTTTAGGAAATGGAAGAAGG + Intronic
1086116980 11:83262794-83262816 CAGTTTTAAGAAATGGGATTAGG + Intronic
1086588923 11:88488567-88488589 AAGTTGAAGGAGATGGAAGAAGG - Intergenic
1086846084 11:91751363-91751385 CATTTTTGAGAGAAGGAAGTGGG - Intergenic
1087136832 11:94729650-94729672 CAGATTTGAGGGATGGAGGAGGG - Intronic
1087504909 11:99007345-99007367 CAGCCTTAATAGAAGGAAGATGG - Intergenic
1088099956 11:106144105-106144127 CAGTTATAAAAGATTGAGGAGGG - Intergenic
1088311287 11:108463419-108463441 CATTTTTAAGAGTTGGGAGAAGG + Intronic
1088680452 11:112237096-112237118 CAGTGGAAATAGATGGAAGAAGG + Intronic
1090223032 11:125047403-125047425 CAATATTAAGGGATTGAAGATGG - Intergenic
1090915399 11:131158277-131158299 CAGCTTTAAGAGTTGATAGAAGG - Intergenic
1091039609 11:132264614-132264636 TATTTTTAAGAGATTTAAGATGG - Intronic
1091069169 11:132547193-132547215 CACTTTTCAAAGAGGGAAGAAGG - Intronic
1091094358 11:132805227-132805249 CAATTTTAAGAGAAGAAAAAAGG + Intronic
1091094359 11:132805258-132805280 CAATTTTAAGAGAAGAAAAAAGG + Intronic
1091314878 11:134607405-134607427 CAGTTTTTATATCTGGAAGATGG - Intergenic
1092043174 12:5403618-5403640 CTATTTTAAGGGATAGAAGATGG + Intergenic
1092640564 12:10504153-10504175 CAATTTTAAAAAATGGATGAAGG + Intergenic
1092865548 12:12757625-12757647 TACTTTTGGGAGATGGAAGAGGG - Intronic
1093112227 12:15165872-15165894 AACCTTTTAGAGATGGAAGATGG + Intronic
1093356852 12:18177043-18177065 TAGTTTTGGGAGATGGAAGCTGG - Intronic
1093958424 12:25248828-25248850 TGCTTTTAAGAGATGGTAGATGG - Intronic
1095585888 12:43848731-43848753 CAGGATTAAGAGATTAAAGACGG + Intronic
1097376621 12:58851128-58851150 CAGTTTATAGACTTGGAAGATGG - Intergenic
1097407827 12:59212607-59212629 CAGGTTTGAGAAAGGGAAGAAGG + Intergenic
1097917551 12:65036742-65036764 CAGTTTTAAAAGATGAAGAAGGG - Intergenic
1098237165 12:68428353-68428375 CAGTTCTTAGAGATAGCAGAGGG + Intergenic
1099016437 12:77348942-77348964 CTGGTTTTAAAGATGGAAGAAGG - Intergenic
1099059423 12:77887923-77887945 CAGTTTTTAGATATCTAAGAGGG + Intronic
1100167544 12:91934054-91934076 CTGTTGTAAGAGTTAGAAGAAGG - Intergenic
1100506387 12:95224827-95224849 CAGTTTTTCCAGATGGAGGATGG + Intronic
1101087876 12:101254757-101254779 CAGTGTTAAGAGCTGGATGCGGG + Intergenic
1102586243 12:113924964-113924986 CAGTTTTAGAAGAAGGAAGTAGG + Intronic
1105531456 13:21224474-21224496 CAGCAGCAAGAGATGGAAGAAGG + Intergenic
1106034123 13:26028499-26028521 CAGTTTTAAAAGTTGGGGGAAGG - Intergenic
1106350228 13:28922688-28922710 CACTGTCAAGAGATGGGAGACGG + Intronic
1106432359 13:29693340-29693362 CTGTTTTAAGAGATTTAATAAGG - Intergenic
1106482478 13:30147351-30147373 GAGTTTGAAGAGAAGAAAGAGGG - Intergenic
1106893814 13:34276100-34276122 GAGTATTAAGAAATGGAAGTAGG - Intergenic
1107135962 13:36944472-36944494 CAGTTTTGAGATATGGATGTTGG - Intergenic
1107299939 13:38955173-38955195 CAGTTTTAAAAAATGATAGAAGG + Intergenic
1107749409 13:43548441-43548463 CAGAATTAAGAGATGGAGAAAGG - Intronic
1108789731 13:53953752-53953774 CATTTTTAAGAAAAGAAAGAAGG - Intergenic
1109002502 13:56824164-56824186 CAGGTATAAAAGATGGAGGAAGG - Intergenic
1109237059 13:59835716-59835738 CAGTTGTAAGAGTGGGAAGTGGG - Intronic
1109606631 13:64705813-64705835 CAGAATTAAGAGAAGGAAAAGGG - Intergenic
1110149310 13:72230259-72230281 CACTGTGAAGAGATGAAAGAGGG + Intergenic
1110555483 13:76854870-76854892 CTGTTCTAAGAGATTGCAGAAGG + Intergenic
1111617340 13:90676964-90676986 CTATTTTGAGAGATGGAAAATGG + Intergenic
1113507477 13:110827128-110827150 CAGTGTTCAGTGATGGTAGATGG + Intergenic
1113507497 13:110827227-110827249 CAGTGTTCAGTGATGGTAGATGG + Intergenic
1113507510 13:110827293-110827315 CAGTGTTCAGTGATGGTAGATGG + Intergenic
1113758808 13:112833357-112833379 CAGTTTTCTGAGATGCAGGAGGG - Intronic
1115912718 14:38274333-38274355 CAGTAGGAAGAGATGGAAAAAGG + Intergenic
1116253197 14:42514745-42514767 CATTTATTAGAGATGTAAGAGGG - Intergenic
1117167356 14:53050113-53050135 CAGTTCTAAGGAATGAAAGATGG + Intronic
1117442173 14:55770291-55770313 AAGAGTTCAGAGATGGAAGATGG + Intergenic
1117709929 14:58517164-58517186 CAGTGTTAAGAGAATGAAAAAGG + Intronic
1118032409 14:61831560-61831582 CAGTTTAAAGAGGTCTAAGAAGG - Intergenic
1120015206 14:79465754-79465776 GAGTTTTAAGGGTTGGAACATGG + Intronic
1121136554 14:91504146-91504168 TTTTTTTAAGAGATGGAAGGGGG - Intronic
1121481617 14:94281888-94281910 CACTTTTAAGAGATGAAATCTGG - Exonic
1124815342 15:32985357-32985379 CATATTTAAAAGATGGAAGGAGG - Intronic
1126330158 15:47523089-47523111 CACTGTTAGCAGATGGAAGATGG - Intronic
1126768207 15:52030153-52030175 CACTGCTAAGAGATGGGAGAAGG - Intronic
1127107089 15:55628053-55628075 CAGTTTTAAGAACAGGAAGGAGG - Intronic
1131124868 15:89851065-89851087 GATTGTTAAGAGCTGGAAGAAGG + Intronic
1131602923 15:93868273-93868295 CTATTCTAAGAGATGGGAGATGG - Intergenic
1131727976 15:95247954-95247976 CAGTTAGAAGATATGTAAGAGGG - Intergenic
1131811959 15:96181863-96181885 CATTTTTGAGGGCTGGAAGAGGG - Intergenic
1134026267 16:10956364-10956386 CCGTTTTTAGAGATTGTAGATGG + Intronic
1135524180 16:23201268-23201290 CAGTTTGAAAAGGGGGAAGAGGG - Intronic
1137494079 16:48956177-48956199 CAGATTAAAAAAATGGAAGAGGG + Intergenic
1138170702 16:54846677-54846699 AAATTTTTAGAAATGGAAGAAGG + Intergenic
1138201985 16:55095876-55095898 CGGTTTCAAGAGCTGCAAGAAGG - Intergenic
1138316786 16:56077078-56077100 GGGATTTAAGAGATGAAAGATGG + Intergenic
1140028162 16:71311009-71311031 AGGTTTAAAGAGATGGAGGAAGG + Intergenic
1140355549 16:74302846-74302868 CAGTTTTAAGATTTAGAAAAGGG + Intronic
1140558445 16:75948259-75948281 CTGTCTTTAGAGATGGAGGAAGG + Intergenic
1141059880 16:80856631-80856653 GAGTTGTAATAGATGGATGAAGG - Intergenic
1141421561 16:83921126-83921148 GAGTTTTAATGGAAGGAAGATGG + Exonic
1141742802 16:85905246-85905268 CATCTTTAAGACATGGCAGAGGG + Intronic
1143387232 17:6538302-6538324 CAGTGTTAGGACATGGAAAATGG - Intronic
1144261606 17:13527184-13527206 CAGTTTAAAGGAATGAAAGAGGG - Intronic
1145354721 17:22132016-22132038 CATTTTTTAAAGCTGGAAGATGG + Intergenic
1146636907 17:34513314-34513336 CAGATTTATGAGTAGGAAGACGG + Intergenic
1147788770 17:42999548-42999570 CAGTCTCAGGAGATGGGAGAGGG - Intronic
1148022256 17:44561189-44561211 CACTGTTAAGAAATGGAAGATGG - Intergenic
1148590898 17:48816277-48816299 TTGTTTTAAGAGATGGAGGTGGG - Intronic
1148744721 17:49911869-49911891 CAGTGTTAAGAGATGGGAAGGGG - Intergenic
1149373207 17:56017330-56017352 CAGTATTAAAAGATGAATGAGGG - Intergenic
1149520436 17:57314491-57314513 CAGTGGCAAGAGATGGAAAAGGG + Intronic
1149557981 17:57587813-57587835 CATTATTAAGAGATGGAATGGGG + Intronic
1150266748 17:63837218-63837240 CAGGTTAAAGAGGAGGAAGATGG - Exonic
1150990966 17:70258697-70258719 CAGCTATGAGAGATGGAATATGG - Intergenic
1152138100 17:78517787-78517809 CAGTTGTAAGAGAGAGAAGCTGG - Intronic
1152365976 17:79856580-79856602 CAGTTTTAGAAGATAGAAGCTGG + Intergenic
1152873639 17:82773027-82773049 CTGTTTCATGAGATGCAAGAAGG + Intronic
1153914550 18:9734062-9734084 CAGTTATGTGAGATGGAAGCTGG + Intronic
1154129935 18:11727925-11727947 CAGTTTTAAGAGATGAATACAGG + Intronic
1155803172 18:30134550-30134572 TTGTTTTAATAGATGGAATAAGG - Intergenic
1155943921 18:31826578-31826600 GAGATTTCAGAGAGGGAAGAGGG - Intergenic
1158102958 18:53851401-53851423 CAGAGATGAGAGATGGAAGAAGG - Intergenic
1158233942 18:55291489-55291511 CAGCTTTATGAAAGGGAAGATGG - Intronic
1158817769 18:61123793-61123815 CAAATTTCAGAGATGAAAGATGG - Intergenic
1158923723 18:62227456-62227478 GAGTTTCAAGAGTTGGAGGAAGG - Exonic
1159399104 18:67907012-67907034 CAGTTTTAGGAACTAGAAGATGG + Intergenic
1159873509 18:73785276-73785298 GAGTTTGAAGTGATGAAAGATGG + Intergenic
1160821128 19:1058693-1058715 TAGTGTGAAGAGAAGGAAGAGGG - Exonic
1161791777 19:6364378-6364400 CAGGTTTAGGAGATGGAATAGGG + Intronic
1162146923 19:8618105-8618127 CAGTATTAAAAGATGAAGGAGGG - Intergenic
1163326371 19:16605994-16606016 CAGTTTTGAGTGAAGGAAGAAGG - Intronic
1165252314 19:34549862-34549884 CAGTTATAAAAGATGTAACATGG - Intergenic
1165680782 19:37773030-37773052 AAGTATTAAGTGATGGAAAATGG - Intronic
1166092442 19:40519035-40519057 CTGGTTTAAGAGATGGCAGCTGG + Intronic
1166331703 19:42081485-42081507 CAGTGCTAAGAGGTGGAAGGTGG - Exonic
1167615567 19:50531054-50531076 CACTTTTCAGAGAAAGAAGATGG + Intronic
1167651956 19:50736343-50736365 CAATTTTAAAAGACTGAAGATGG - Intergenic
1168288125 19:55344545-55344567 CGGTTTTCAGAGAAGAAAGATGG - Intronic
925080443 2:1059216-1059238 CAGCTCTAAGAGATGGCAGAAGG - Intronic
925591621 2:5515533-5515555 CTGATTTCAGAGATGTAAGATGG + Intergenic
925798319 2:7570586-7570608 TAGTTTTAAGACATTGAAAAAGG - Intergenic
926175615 2:10589094-10589116 CAGTTTTATGAGATCAAAGCAGG - Exonic
926266499 2:11327207-11327229 AAGTTTAAAGTGATGGAAAATGG + Intronic
926586976 2:14697219-14697241 CAGTTTGAAGAATTGGAAGAAGG + Intergenic
927658846 2:24974583-24974605 CTGTTTGTAGAGAGGGAAGAGGG - Intergenic
929379465 2:41333397-41333419 CATTTTTCAGAGCTGGAAAATGG - Intergenic
929685468 2:44030223-44030245 CAGATTTGAGAGCTGGATGACGG + Intergenic
930240447 2:48930667-48930689 TTGTTTTAAGACATGGAAGAAGG + Intergenic
931403888 2:61957061-61957083 TAGTTTTAATTGAAGGAAGATGG + Intronic
931673520 2:64671259-64671281 AAGTTTTAGGAGCTGGAATATGG + Intronic
931869030 2:66439848-66439870 CAGTGCTAAGAGAGGGAAGAGGG - Exonic
931879342 2:66550956-66550978 AAGTTTTAAGAAATCCAAGAAGG - Intronic
932279337 2:70476211-70476233 TGGTTTGAAGAGATGAAAGAAGG - Intronic
933593380 2:84258283-84258305 CAGCATTAAGAGCTGGAATATGG + Intergenic
934662968 2:96152939-96152961 CAGTTTTATAATCTGGAAGAGGG + Intergenic
934725542 2:96615579-96615601 CAGTTTTCAGAGAAAGAAAAAGG + Intronic
935687888 2:105700394-105700416 CAGATATAAGAGGAGGAAGATGG - Intergenic
936401759 2:112169936-112169958 CTGTTTTAAGAAAAGGAAGAAGG + Intronic
937458916 2:122068613-122068635 CAGGTTAGAGAGTTGGAAGATGG - Intergenic
937474526 2:122203132-122203154 CAGTTTCAATAGAGGGAAGGGGG + Intergenic
937648531 2:124294549-124294571 CAGTTTGAAGAACTGGAGGAAGG + Intronic
939327072 2:140706021-140706043 CAGTTTTACGAGCTTGGAGAGGG - Intronic
939469695 2:142604963-142604985 CATTTATATGAAATGGAAGAAGG - Intergenic
941252974 2:163189583-163189605 TATTTTTAAAAGATGGAAGATGG + Intergenic
941595646 2:167473675-167473697 CACAATCAAGAGATGGAAGAAGG + Intergenic
942337812 2:174909275-174909297 TTGTTTTAAGTGAAGGAAGAAGG - Intronic
942547750 2:177082091-177082113 TAGTTCTAAGAAATGAAAGAAGG - Intergenic
943347336 2:186754933-186754955 CATTTTGAACAGAAGGAAGATGG + Intronic
944643705 2:201755557-201755579 GTGTTTTAAGAGATGGGAGCCGG - Intronic
944686030 2:202118703-202118725 CAGTGTTGAGAGATTGTAGAAGG + Intronic
945586637 2:211673186-211673208 CAGTGTGAGAAGATGGAAGATGG - Exonic
945718833 2:213392479-213392501 CAGTTTGAAAATATGGAAGTTGG + Intronic
946025459 2:216669299-216669321 AAGGATTAAGAGAAGGAAGAGGG + Intergenic
946858018 2:223972576-223972598 AAGATTTAAGAGATGGTCGAAGG + Intergenic
947511862 2:230762598-230762620 CAGTTTTAAGATAAGGATTAAGG - Intronic
948177598 2:235956453-235956475 CAGTTTGAAGGGATGACAGAAGG - Intronic
948426558 2:237890971-237890993 CAATTTTAAGAAAGGGAAAAGGG - Intronic
1169339268 20:4783787-4783809 CTGTGTTTAGAGAGGGAAGAGGG - Exonic
1169359992 20:4940069-4940091 CAGTTTTGGGAGGTGGAAGCAGG + Intronic
1170480431 20:16760103-16760125 GAGTTGGAAGAGATGGAAGGAGG - Intronic
1170758394 20:19225604-19225626 CAGGGTTCAGAGATGGAAGAAGG - Intronic
1173018208 20:39245748-39245770 CAGTTTTCACAGAGGGAGGAGGG + Intergenic
1173187966 20:40855754-40855776 GAGCTTTCAGAGATGGTAGATGG - Intergenic
1173239388 20:41280338-41280360 CAGTATTTATAGAGGGAAGAGGG + Intronic
1173561832 20:44011608-44011630 CAGTTTTACCAGATGGCTGAGGG + Intronic
1173594683 20:44251113-44251135 CACTTTTAAGAAAAGGAAGCAGG - Intronic
1173683198 20:44902090-44902112 CAATTTTAAAAGATGGAGGGAGG - Intronic
1173881870 20:46420723-46420745 CATCTTTCAGAAATGGAAGATGG + Intronic
1174443502 20:50575010-50575032 GAGTCTGAAGAGAGGGAAGAAGG + Intronic
1177283165 21:19011641-19011663 CAGTGTTAACATTTGGAAGAGGG - Intergenic
1178020148 21:28398540-28398562 CATCTTTAGCAGATGGAAGAGGG - Intergenic
1178219178 21:30636658-30636680 AAGTTTTAAGAGTTGGTTGACGG - Intergenic
1178228409 21:30752068-30752090 CAGTTACAAGAGACGGAAAATGG - Intergenic
1180106772 21:45623762-45623784 CAGTGATGAGAGAGGGAAGAAGG - Intergenic
1182253560 22:29021281-29021303 CAGTTTTAGTAGATAGCAGAAGG + Intronic
1183864629 22:40694451-40694473 CAGCTTCCAGAGAAGGAAGATGG - Intergenic
949302894 3:2605343-2605365 CAGTGTTAGGAGGTGGGAGAAGG + Intronic
951613303 3:24516532-24516554 CAGATTTGAGAGATGTCAGAAGG - Intergenic
951652506 3:24966342-24966364 CAATTTTAACAAATGAAAGAAGG + Intergenic
953518913 3:43622448-43622470 GGTCTTTAAGAGATGGAAGAGGG - Intronic
953551036 3:43903237-43903259 TCTTTTTAAGAGAAGGAAGAAGG + Intergenic
954362625 3:50130290-50130312 CAGTTTCAAGAGGCTGAAGAAGG - Intergenic
954553563 3:51501653-51501675 CACATTTAAGAGAAGGAGGATGG - Intergenic
956366264 3:68506356-68506378 CAGTTTTAAGAAATAGAATGTGG - Intronic
956929148 3:74022908-74022930 AAGATTTAAGAGATGGTAGTTGG + Intergenic
957141760 3:76368626-76368648 CCGTTTCAAGAGATGGGAAATGG + Intronic
957440206 3:80236545-80236567 CAGGTTTTGGAGATGGAAAAGGG - Intergenic
959099000 3:101989157-101989179 TAGTTTGAAGTGATGGAGGAGGG + Intergenic
959725515 3:109537424-109537446 CAGTTTTAAGTAATGGAATTGGG + Intergenic
960326899 3:116308125-116308147 CAATTTTAAAAGATGGTAGGGGG - Intronic
960425550 3:117502586-117502608 GATTGTTAAGAGAAGGAAGAAGG + Intergenic
960506222 3:118497989-118498011 CAGTTTTTAAATATGGAACATGG + Intergenic
961985290 3:131125555-131125577 CAACTGTAAGAGATGGCAGAAGG - Intronic
964077156 3:152705852-152705874 CAGTTTCTAGAGATGGTAAAGGG - Intergenic
964130249 3:153279009-153279031 CAGTTTCAAGAGAGGGAGGAGGG - Intergenic
964530977 3:157667481-157667503 CAGAATTAAAAGATGGAGGAAGG + Intronic
965000173 3:162943156-162943178 CACTTTAAAGAGATACAAGAGGG - Intergenic
965022328 3:163248940-163248962 CAGTTTTCAGAAGTGGCAGATGG - Intergenic
965449942 3:168825289-168825311 CAGTTTTAAGACAATAAAGAAGG + Intergenic
966101577 3:176275561-176275583 CAATTTCAAGAGAAGAAAGAAGG + Intergenic
966581207 3:181566374-181566396 CAGTTTTAAATGATAGTAGATGG + Intergenic
966629681 3:182058596-182058618 CAGTTGTAAGTGATTCAAGAAGG + Intergenic
967367370 3:188702415-188702437 CAGTGTTCTGAGACGGAAGAAGG - Intronic
967491037 3:190090974-190090996 TAGTTTTGAGAGATGGCAGGCGG - Intronic
968513398 4:1005032-1005054 CAGTTTACAGAGATGGAGGCAGG + Intergenic
968840934 4:3005355-3005377 GAGGTTAAAGAGAGGGAAGATGG + Intronic
970486703 4:16531912-16531934 CAGTTCAAACAGATGGAGGAAGG + Intronic
971181099 4:24329238-24329260 AAGCTTAAAGAGATGGGAGATGG - Intergenic
971761398 4:30770768-30770790 CAGTTATAACAAATGGAACACGG - Intronic
971816325 4:31495536-31495558 TGGTTTTAAGAGAGAGAAGAAGG - Intergenic
972687243 4:41362828-41362850 CACGTTTAAGAAAAGGAAGAAGG + Intronic
972822801 4:42721539-42721561 CAGTTCTAAGATGTGTAAGAGGG - Intergenic
973083255 4:46022172-46022194 CATTTTCCAGAGATGGAAGAAGG - Intergenic
973865371 4:55107682-55107704 CAGCTGTAAGAAATGCAAGATGG + Intronic
973887943 4:55341761-55341783 CAGTTGTAGGAGGTGGAGGAGGG - Intergenic
974164692 4:58186069-58186091 CAGGATTAAGAGATTAAAGATGG + Intergenic
974282789 4:59821033-59821055 CATTTTTAAGAAATGAAAGATGG + Intergenic
978135873 4:105258935-105258957 CATTTTTATAAGATGGAATATGG + Intronic
978376720 4:108081722-108081744 CAGTAGTAAGAGTTGGATGAGGG + Intronic
980792507 4:137637540-137637562 CAGTTGTAAGAGATTGTACATGG + Intergenic
981034645 4:140156837-140156859 CATTTTGGAGAGATGAAAGACGG - Intergenic
981129157 4:141138956-141138978 CAGTTTTGGGAGGTGGAAGCGGG + Intronic
982987489 4:162229778-162229800 CAGTCTCAAGAATTGGAAGAAGG - Intergenic
982990955 4:162273146-162273168 CAGAGTTATGAGATGTAAGAAGG + Intergenic
983210791 4:164955838-164955860 CAGTTTTATGAGATTAAAGAGGG + Intronic
983709147 4:170693123-170693145 CAGGCTCCAGAGATGGAAGAGGG - Intergenic
984307370 4:178011330-178011352 CAGCTTTAAGAGAATGAAAAAGG - Intergenic
984658406 4:182345411-182345433 CAGATTTAAGAGGTAGAAGTAGG + Intronic
985293573 4:188411458-188411480 CAATTTTCAGCGATGGAAAAAGG - Intergenic
987690931 5:21265878-21265900 CAGCCTTATGAGAAGGAAGAAGG + Intergenic
987875878 5:23680656-23680678 GTGTTTTAGGAGATGGAGGAGGG + Intergenic
990919029 5:60942612-60942634 TAGTTTCTAGAGAAGGAAGAGGG + Intronic
992602426 5:78415963-78415985 CAGTGTTAGGAGGTAGAAGATGG + Intronic
992913819 5:81426749-81426771 CTGTCTTAACAGTTGGAAGAGGG - Intronic
993326622 5:86546562-86546584 CAGGATTAAGAGAAGGGAGATGG + Intergenic
993533301 5:89049881-89049903 CAGGATTAAGAGATGAAAGTAGG - Intergenic
993552199 5:89287282-89287304 CAGTATGAAGAGAGAGAAGATGG + Intergenic
994076707 5:95659941-95659963 CAGTGTTCAAAGAAGGAAGAGGG - Intronic
994292272 5:98042004-98042026 AAGTATCAGGAGATGGAAGATGG + Intergenic
994480229 5:100325101-100325123 GAGTTATAAGAGATCGAAAAGGG + Intergenic
995056369 5:107763731-107763753 CAGTCATTAAAGATGGAAGAAGG + Intergenic
995246734 5:109943924-109943946 TAGATTTAAGAGATGGAATCTGG + Intergenic
995314818 5:110757354-110757376 CAGTTTTAAGTGTAGGAAGGAGG - Intronic
996101176 5:119447399-119447421 CAGTTGTAGGAGGTGGAGGAGGG - Intergenic
996308182 5:122074958-122074980 GTCTTTTAAAAGATGGAAGAAGG + Intronic
996601799 5:125273020-125273042 AAGCTTTCAGAGATGGAAGTTGG + Intergenic
997142480 5:131397524-131397546 CAGATTGAAAAGAGGGAAGAAGG - Intronic
997766099 5:136505176-136505198 AACTTTTAAGAGAGGAAAGAAGG + Intergenic
998549435 5:143063221-143063243 CAGATTCAAGAGATAGAAAAGGG - Intronic
998765974 5:145487716-145487738 CATTTTTTAGAGATGGAGGAAGG + Intronic
1001865324 5:175099214-175099236 CAGTTTTATGAAAAGGAAAATGG - Intergenic
1002072719 5:176689873-176689895 GAGTCCTTAGAGATGGAAGAGGG - Intergenic
1002477779 5:179478506-179478528 CAGCTGTAAGAAAAGGAAGAAGG + Intergenic
1003528995 6:6921957-6921979 CAGTTCTAACAAATGGAAGGTGG + Intergenic
1003891268 6:10565793-10565815 CAACTTTAAGAGAAAGAAGAAGG - Intronic
1004484958 6:16057711-16057733 CTGTTTGACGAGATGGAAGGAGG - Intergenic
1005083575 6:21981271-21981293 CAGTTTTCAGAGCAGGAAGGAGG - Intergenic
1005221203 6:23590989-23591011 AAGTTGTAACAGATGGAACAGGG - Intergenic
1005441997 6:25880094-25880116 TAGATTTAAGAGAAGGGAGAAGG - Intronic
1005461996 6:26078091-26078113 TAGTTTTGGGAGATGGAAGCTGG - Intergenic
1007393874 6:41566159-41566181 CATTTTCAAGAGATAGAAGTGGG + Intronic
1008465750 6:51828925-51828947 CATTTTTTGGAGATAGAAGAGGG + Intronic
1009357052 6:62763492-62763514 CAGATTCAAGAGGTGCAAGAAGG - Intergenic
1011162462 6:84406815-84406837 CGGTTTTAGAAGGTGGAAGAAGG + Intergenic
1011844202 6:91542602-91542624 TAGCTTTAAAAGATGGAAAAGGG - Intergenic
1012599382 6:101075821-101075843 GAGTTTTTATTGATGGAAGATGG - Intergenic
1012745531 6:103082483-103082505 CAGTATTTATAGATGGAAAAGGG - Intergenic
1013563869 6:111335600-111335622 CTTTTTTAACAGATGGAAAATGG - Exonic
1013696692 6:112710744-112710766 AAGTTTCTAGAAATGGAAGAAGG + Intergenic
1013777117 6:113690566-113690588 AAGTTTTAAGAAATGTATGATGG + Intergenic
1014179303 6:118367364-118367386 CAGTATTAGGAGCTGGATGATGG - Intergenic
1015889786 6:137958876-137958898 CAGTTTTACAAGATGGAAGAAGG - Intergenic
1016359652 6:143253750-143253772 TAGTTTTAAGAATTTGAAGACGG - Intronic
1016839941 6:148516179-148516201 CAGGCTTCACAGATGGAAGATGG + Intronic
1017147936 6:151251519-151251541 AGATTTTAAGAGTTGGAAGATGG + Intronic
1017743192 6:157425241-157425263 CAGTTTCAAGAGATATTAGAAGG - Intronic
1018381220 6:163259965-163259987 CTGGTTTCAGAGTTGGAAGAGGG + Intronic
1018725001 6:166605082-166605104 CAGTTCTAGGAGAGGCAAGAGGG - Intronic
1018993977 6:168696700-168696722 CAGTCTTAAGATCTTGAAGAAGG + Intergenic
1020085814 7:5309534-5309556 CATGTCAAAGAGATGGAAGAGGG - Intronic
1020142469 7:5620274-5620296 CAGTTTTAAGGCAAGTAAGAGGG + Intronic
1020736382 7:11954059-11954081 GAGTTTTAAGAGTTGGAGTAGGG + Intergenic
1020811840 7:12857709-12857731 CAGTTTTCAGAGAAGGGAGATGG + Intergenic
1020999493 7:15310970-15310992 GTGTTTTTAGAAATGGAAGAGGG - Intronic
1021055952 7:16046436-16046458 CAGTTTTAAAAGTTTGAAGATGG + Intergenic
1021249139 7:18303183-18303205 AAGTTTTCAGAGATGGCAAATGG + Intronic
1021631764 7:22654592-22654614 CAGTCTTCAGAGAGAGAAGAAGG - Intergenic
1022577915 7:31517016-31517038 CAGTTTTAAGAGCTGTAACACGG - Intronic
1023431928 7:40102544-40102566 CATTTTTGAGGGATGGAGGAAGG + Intergenic
1024372142 7:48597763-48597785 CATTTTTAAAAAATGGAGGATGG - Intronic
1024483954 7:49894937-49894959 TTTTTTTAAGGGATGGAAGATGG + Intronic
1024782474 7:52867005-52867027 CTGTTTAAGGAGATTGAAGATGG - Intergenic
1025723018 7:64033532-64033554 CAGGATTAAGAGATTAAAGACGG + Intronic
1027209335 7:76132281-76132303 AAGCTGTAAGAGAGGGAAGAAGG + Intergenic
1027289163 7:76684056-76684078 CAGTTGTAACAGGTGGAAAATGG - Intergenic
1027542966 7:79491731-79491753 CAGTGTGAAGACAAGGAAGATGG - Intergenic
1028338029 7:89681856-89681878 CAGTTTTGAGAGAGGGTAGCAGG + Intergenic
1028626590 7:92884453-92884475 CAATTATAAGAAATTGAAGAAGG + Intergenic
1028706185 7:93849599-93849621 CAGTTTTAGGAGAGTGAAGAGGG + Intronic
1029330173 7:99846828-99846850 CAGTTTTGAAAGATGGAAGAAGG + Intronic
1029624182 7:101709436-101709458 CAGTTTCAAAAGATGGATGGGGG + Intergenic
1030052427 7:105550452-105550474 CTGTTTTCAGAGATGGTTGACGG + Exonic
1030243533 7:107356877-107356899 CAGTTTTAAGATATTTAAGAAGG - Intronic
1030970899 7:116053517-116053539 CAGTATTGAGAGGTGGAAAACGG + Intronic
1031203922 7:118728798-118728820 TAGTTTTGAAAGTTGGAAGATGG - Intergenic
1034476109 7:151283277-151283299 CCATATTAACAGATGGAAGAAGG + Intergenic
1038879729 8:31595520-31595542 CAGTTATTAGGGATGGAAAAGGG - Intergenic
1040621987 8:49101611-49101633 CACTTGTAGGAGGTGGAAGAGGG - Intergenic
1040763844 8:50882144-50882166 CATTTTCATGAGATGGAAGGTGG + Intergenic
1042098652 8:65248351-65248373 GATTTTTAAGAGGTGGAAGAAGG - Intergenic
1042214817 8:66420226-66420248 GAGTTTTAATAGATAGGAGAAGG - Intergenic
1042268949 8:66936628-66936650 CAGTTGTAAGAGATCAAGGAAGG - Intergenic
1043044150 8:75300027-75300049 CCATTTTGAGAAATGGAAGATGG + Intergenic
1043790035 8:84454228-84454250 CATATTTTAGAGATGTAAGATGG + Intronic
1044188094 8:89280734-89280756 GTGTTTTAGGAGATGGAGGAGGG - Intergenic
1044927732 8:97223809-97223831 CAGGTTTAACACAGGGAAGAGGG - Intergenic
1044982044 8:97726772-97726794 TTGTTTTAAGAGATGGCAGCTGG + Exonic
1045974742 8:108119451-108119473 CAATCTTGAGAGTTGGAAGAAGG + Intergenic
1047016645 8:120730588-120730610 CATTTTGAAGAGACGTAAGAAGG - Intronic
1047120680 8:121900792-121900814 CAGGTTTAAGAAAGTGAAGAAGG + Intergenic
1047416229 8:124666828-124666850 GAGTTTTCAAAGAGGGAAGAGGG + Intronic
1047444844 8:124910487-124910509 CAGTTGTAGGAGGTGGAGGAGGG - Intergenic
1047643294 8:126843804-126843826 CAGTTTGCACAGATGGAAGCAGG - Intergenic
1047979393 8:130164606-130164628 CTGTTTTTAGAGTTGGAAGTAGG - Intronic
1048919268 8:139213225-139213247 CTGTGTTATGAGATGAAAGAAGG - Intergenic
1049012933 8:139899662-139899684 CAGCTTGCAGAGAAGGAAGATGG - Intronic
1049057569 8:140250884-140250906 TTGTTTTAAAAGATAGAAGAAGG + Intronic
1051148916 9:14059782-14059804 GAGTTTTAAGGGGTGGAATAAGG + Intergenic
1051423884 9:16915379-16915401 CAGAGAAAAGAGATGGAAGAGGG - Intergenic
1051718231 9:20008195-20008217 CAGGCTTAAGAGAGGGAAGAGGG - Intergenic
1052502848 9:29314876-29314898 CAGTTTGTAGAGGTGGAAGAAGG - Intergenic
1053360403 9:37482572-37482594 CATTTTTCAGAGAAGGAAAATGG - Intergenic
1053615391 9:39760457-39760479 GACTTTTAAGAAATGGAATATGG + Intergenic
1053899061 9:42774807-42774829 GACTTTTAAGAAATGGAATATGG - Intergenic
1054238129 9:62581934-62581956 GACTTTTAAGAAATGGAATATGG - Intergenic
1054262452 9:62881396-62881418 GACTTTTAAGAAATGGAATACGG + Intergenic
1054268776 9:62947024-62947046 GACTTTTAAGAAATGGAATATGG - Intergenic
1054552260 9:66616450-66616472 GACTTTTAAGAAATGGAATATGG - Intergenic
1054709012 9:68492311-68492333 CAGTTTTGAGAGTTGGAATTTGG + Intronic
1055187945 9:73478647-73478669 GAGTTATGAGAGATGGAACAGGG - Intergenic
1055291447 9:74786121-74786143 CAGATCTAAAAGAAGGAAGAAGG + Exonic
1056084858 9:83137161-83137183 GTGTTTAAAGAGATGAAAGAAGG - Intergenic
1056195276 9:84222766-84222788 CAGTTTTATCATATGTAAGATGG + Intergenic
1058752101 9:108049689-108049711 CATTTTTGAATGATGGAAGATGG + Intergenic
1058868215 9:109180683-109180705 CAGTCTTACGAGATGGATGATGG - Intronic
1058942922 9:109830899-109830921 CAATTTTAAGAGACTGCAGAGGG - Intronic
1059235896 9:112760474-112760496 GAGATTTATGAGATGGATGATGG + Intronic
1059378917 9:113908340-113908362 CAGTTTAAAAAAATGGAGGAGGG + Intronic
1059511871 9:114855672-114855694 CATTTTGCAGAGAAGGAAGAAGG + Intergenic
1059746264 9:117204585-117204607 CAGCTTTAAGAGCTGGAAGAGGG + Intronic
1060355426 9:122903278-122903300 CACTTTTTAGTGATGGAAAAAGG - Intronic
1061615943 9:131779007-131779029 CTGGCTTCAGAGATGGAAGAAGG + Intergenic
1061751265 9:132778742-132778764 CAATTTTAAACGATGGAATATGG - Intronic
1185966956 X:4616855-4616877 AATTTTTAAGAGATGGTAAAAGG - Intergenic
1186658992 X:11648972-11648994 CAATCTTAAAAAATGGAAGATGG + Intronic
1187052719 X:15710387-15710409 CATTAATAAGAGAGGGAAGAAGG + Intronic
1187222081 X:17337912-17337934 GAGTTTTCAAAGATGGAAGTGGG - Intergenic
1187696093 X:21922569-21922591 CAGTTATTAGTGATGGAAGTTGG + Intergenic
1188185158 X:27104740-27104762 TACTTTTAAGAGATTGAAAAGGG + Intergenic
1188218385 X:27508242-27508264 CAAGTTTAAGGGATGGGAGAAGG + Intergenic
1189011191 X:37047306-37047328 AATTGTTAAGAGATGGAGGAAGG - Intergenic
1189510726 X:41658620-41658642 CAGTGTGAAGAGGTGGGAGAGGG + Intronic
1190435273 X:50418228-50418250 CAGTTTTCAGAGATGTTACAAGG - Intronic
1192094984 X:68201210-68201232 CATTTTTGAGGGAGGGAAGATGG - Intronic
1192248672 X:69393077-69393099 CAGTTTTCAGTGATGGACAAAGG + Intergenic
1192731276 X:73804794-73804816 CTGTTTTAAGAAATGGAAAAAGG + Intergenic
1193378764 X:80793875-80793897 CAGTTTTAAAATATGGAATCAGG + Intronic
1193414275 X:81202505-81202527 AAGTTTTGGGAGATGGGAGATGG + Intronic
1193825027 X:86214428-86214450 CAGTTTGATGTGATAGAAGAAGG + Intronic
1194702719 X:97134115-97134137 CAGTTTTAGGTGAAGGATGAAGG + Intronic
1195659324 X:107362629-107362651 AAATTTTAAGAGAGGGAAGCGGG - Intergenic
1196118799 X:112026122-112026144 GAGTTTCAAGAGTTGGAAGGAGG - Intronic
1196199352 X:112867965-112867987 CAGTGTTAAGAGATGGAGCTAGG + Intergenic
1196373157 X:115001153-115001175 CAGTTTTAGGGGCAGGAAGATGG + Intergenic
1197692051 X:129512619-129512641 CAGTTTTAAGAGGCCGAAAAAGG - Intronic
1198379535 X:136070849-136070871 CTATTTAAAGAGATGGCAGAAGG + Intergenic
1198380321 X:136077628-136077650 CAGTTCTTAGAGAGGGAAGTGGG - Intergenic
1198465878 X:136904471-136904493 CACTTTTAAGAGCTGTAACACGG + Intergenic
1199334441 X:146601427-146601449 CACTGCTGAGAGATGGAAGAGGG + Intergenic