ID: 1085570966

View in Genome Browser
Species Human (GRCh38)
Location 11:77557723-77557745
Sequence GTTAAGATGCTGCCATCTTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 209
Summary {0: 1, 1: 0, 2: 2, 3: 18, 4: 188}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085570965_1085570966 -10 Left 1085570965 11:77557710-77557732 CCAAACAAATGAGGTTAAGATGC 0: 1
1: 0
2: 0
3: 19
4: 110
Right 1085570966 11:77557723-77557745 GTTAAGATGCTGCCATCTTGTGG 0: 1
1: 0
2: 2
3: 18
4: 188
1085570964_1085570966 -7 Left 1085570964 11:77557707-77557729 CCACCAAACAAATGAGGTTAAGA 0: 1
1: 0
2: 1
3: 14
4: 199
Right 1085570966 11:77557723-77557745 GTTAAGATGCTGCCATCTTGTGG 0: 1
1: 0
2: 2
3: 18
4: 188

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085570966 Original CRISPR GTTAAGATGCTGCCATCTTG TGG Intronic
900505227 1:3027013-3027035 ATTTGGATGCTGCCATCTGGGGG + Intergenic
900870628 1:5299801-5299823 GTTAGGTTGCTTCCAGCTTGGGG - Intergenic
901181177 1:7342769-7342791 CTGAAGATGGAGCCATCTTGAGG + Intronic
902213260 1:14918824-14918846 GTGGAGCTGCTGCCAACTTGAGG - Intronic
903227561 1:21902302-21902324 GTGAAGTTCCTGCCACCTTGGGG - Intronic
904764039 1:32828558-32828580 GTAAAGATACTGCCATCTCCTGG - Intronic
907914262 1:58854090-58854112 GGTGGGATGCTGCCATCCTGGGG + Intergenic
907918599 1:58893132-58893154 GTGCAGATTCTACCATCTTGTGG - Intergenic
908123419 1:61006989-61007011 GGTAAGATTCCACCATCTTGGGG + Intronic
908179353 1:61588836-61588858 GTTAATCTGCTGCCACCTAGTGG + Intergenic
908197775 1:61762003-61762025 ATTAAGATGCTGCTATCTTCTGG + Intronic
909062505 1:70895337-70895359 GTTAGTATTCTGCCAGCTTGAGG + Intronic
909394756 1:75157031-75157053 GTTAACATCGTTCCATCTTGGGG - Exonic
911529446 1:99026785-99026807 ATCAAAATGCTGTCATCTTGAGG - Intergenic
911742770 1:101405045-101405067 ATTAGGATGTTGACATCTTGGGG + Intergenic
913793651 1:122574424-122574446 GTTGATATTCTGACATCTTGTGG + Intergenic
913836695 1:123345882-123345904 GTGGATATGCTGACATCTTGTGG + Intergenic
913837059 1:123352339-123352361 GTGGAGATTCTGACATCTTGTGG + Intergenic
913842001 1:123440346-123440368 GTGAATATTCTGACATCTTGTGG + Intergenic
913895774 1:124405383-124405405 GTTGATATTCTGACATCTTGTGG + Intergenic
914854453 1:151341033-151341055 GACAAGATGCTGCCACCTGGTGG + Exonic
915818768 1:158998854-158998876 GTGAAGTTACTGCCACCTTGTGG + Intergenic
916419686 1:164625245-164625267 GTCAAGAAGCTGCAAACTTGGGG - Intronic
917611321 1:176691812-176691834 GTTGAAACACTGCCATCTTGTGG + Intronic
918580911 1:186127738-186127760 GTCAAGATGCTGTCAGCTTTTGG + Intronic
920511046 1:206552271-206552293 CTTAAGATGCTGCCATCCCTAGG - Intronic
920750193 1:208667094-208667116 GTTTATATGCTCCCATCATGAGG + Intergenic
924167326 1:241297859-241297881 GTGGACATGCTGCCATTTTGAGG - Intronic
924816244 1:247444575-247444597 GCTAAGATGCTAAAATCTTGGGG + Intronic
1062769065 10:85518-85540 GTGTAGCTGCTGCCATCCTGGGG + Intergenic
1069427548 10:68302372-68302394 TTTAAAATACTCCCATCTTGTGG + Intronic
1069612369 10:69783043-69783065 GTAAAGGGGCTCCCATCTTGGGG + Intergenic
1070449571 10:76544287-76544309 GTTAACATGCTTCCATATTGGGG - Intronic
1071130596 10:82388761-82388783 AGAAAGATGATGCCATCTTGGGG - Intronic
1072223822 10:93349494-93349516 GTTAATATTCTGCCTTCATGGGG + Intronic
1075151144 10:119933326-119933348 GATGACATACTGCCATCTTGTGG - Intronic
1075192092 10:120318956-120318978 TTTAGGAAGCTTCCATCTTGTGG + Intergenic
1075560365 10:123463820-123463842 CTTAAGATCCTGCCCTCTGGAGG + Intergenic
1078360174 11:10661846-10661868 GTTAGGATGTAGACATCTTGGGG + Intronic
1078421506 11:11216579-11216601 TTCAAGATGCTCCCATCTTCTGG + Intergenic
1078972827 11:16434414-16434436 ATAAAGATGCTGCCATTATGGGG + Intronic
1079946844 11:26754059-26754081 ATGAAGAGGCTGCCATCTGGTGG - Intergenic
1081718643 11:45269385-45269407 GGTAGGATCTTGCCATCTTGGGG - Intronic
1085151503 11:74255962-74255984 GTGATCATGCTGCCCTCTTGTGG - Intronic
1085570966 11:77557723-77557745 GTTAAGATGCTGCCATCTTGTGG + Intronic
1090114172 11:123949202-123949224 GTTAAGAAGCTTCCAGCTTTTGG - Intergenic
1090705418 11:129331982-129332004 GTTGACATACTGCCATCTGGTGG + Intergenic
1098295879 12:69003792-69003814 GTTAAGATGAGGTCATATTGGGG + Intergenic
1100236010 12:92661759-92661781 GTTAAGATGCTGAGATCTGGGGG - Intergenic
1106545631 13:30728605-30728627 TTTAAGAAACTGCCAACTTGGGG + Intronic
1109700553 13:66019291-66019313 GTCAACATGTTGGCATCTTGGGG + Intergenic
1109717715 13:66237909-66237931 CTTAAACTACTGCCATCTTGAGG - Intergenic
1112958295 13:105088797-105088819 GTTAGGATGTAGACATCTTGAGG + Intergenic
1113492081 13:110700096-110700118 GTTAAGGTGATCACATCTTGAGG - Intronic
1113542418 13:111119224-111119246 GTTAAGATGAGGCCATACTGGGG - Intronic
1114360321 14:21965204-21965226 GAGAAGACACTGCCATCTTGAGG - Intergenic
1115108651 14:29792860-29792882 GTTAAAGTGCTGCCAATTTGAGG + Intronic
1117812328 14:59560892-59560914 TTAAAGATGCTGTCAGCTTGGGG - Intronic
1117864876 14:60136730-60136752 GATAAGATGCTCCCATGATGAGG + Exonic
1118377896 14:65192720-65192742 ATTAAGATGTGGACATCTTGGGG - Intergenic
1119921627 14:78451742-78451764 CATAAAATGCTGCCATCTTTGGG - Intronic
1125291580 15:38154362-38154384 GATAAAATGCTGCTATTTTGAGG - Intergenic
1126161112 15:45614402-45614424 GGGATAATGCTGCCATCTTGTGG + Intronic
1126990231 15:54366284-54366306 GTAAAGAAGCTGGCAGCTTGGGG + Intronic
1128836377 15:70812227-70812249 CTTGAAATGTTGCCATCTTGTGG + Intergenic
1129076252 15:72998823-72998845 GTCAAGATGCTGCCATCCTGAGG - Intergenic
1130207566 15:81891542-81891564 GTGTAGATGCTGCCATGTAGAGG - Intergenic
1137345588 16:47655465-47655487 TTTAATATTCTGCCATGTTGTGG + Intronic
1138297033 16:55895825-55895847 CTTCAAATGCTGCCATATTGGGG - Intronic
1138588698 16:57987622-57987644 GGTAAGATACTGTCATCCTGTGG - Intronic
1140408523 16:74726911-74726933 GGTCAGATGCTGACCTCTTGTGG + Intronic
1140869081 16:79090230-79090252 GTTAAGATGCTAGCCTCGTGGGG + Intronic
1140926945 16:79592237-79592259 GTAAAGATGCTCCCAATTTGTGG + Intronic
1141161906 16:81634908-81634930 GTTGAGATGCTACCGTCTTGAGG + Intronic
1141238254 16:82240921-82240943 AGTACGAGGCTGCCATCTTGGGG - Intergenic
1143426489 17:6843437-6843459 GTTACCATACTGCCCTCTTGTGG - Intergenic
1144356322 17:14449903-14449925 ATTTTTATGCTGCCATCTTGAGG - Intergenic
1145765417 17:27455985-27456007 GTTTAGGGGCTGCCATCTAGTGG - Intergenic
1149218688 17:54389384-54389406 GTTAACATGCCGCCATCTGTTGG + Intergenic
1151358792 17:73576153-73576175 GTTAAGATGATGAAATCATGAGG + Intronic
1152503716 17:80731608-80731630 ATTAAGAGGCCTCCATCTTGTGG + Intronic
1153667856 18:7382292-7382314 GTTAAGATTCTGACCTATTGGGG - Intergenic
1155890823 18:31266685-31266707 CTTAGGATGCTGCCACCTTCAGG - Intergenic
1156024435 18:32635524-32635546 GTAAAGCTGCTGACATTTTGTGG + Intergenic
1157712469 18:49859395-49859417 GTTAAGAACCTGCCTTCCTGGGG + Intronic
1158214470 18:55085549-55085571 GTTAGGATGCAGCCTTCATGTGG + Intergenic
1158687548 18:59628470-59628492 GGTAAAAAGCTGCCATCTTTAGG - Intronic
1159434206 18:68394962-68394984 GTTAAGATGCTGACATCCTTGGG + Intergenic
1159474042 18:68895037-68895059 GCTAAGTTGCTGCCTTCTTGTGG + Intronic
1165372387 19:35417368-35417390 AATAAGATGCTGGGATCTTGAGG + Intergenic
1165385768 19:35510018-35510040 GTTAAAATGCTGCCATTTTGGGG - Intronic
1165985531 19:39765654-39765676 CTTAGGATGCTGCCCTCTAGCGG - Intergenic
1166207552 19:41281641-41281663 GATAAGATGATGCCAACATGGGG - Intronic
926890906 2:17638076-17638098 ATTGAGATGTTGCCCTCTTGGGG + Intronic
927322638 2:21765363-21765385 TTTAACATGCTGCCTTCTGGGGG + Intergenic
928058643 2:28086411-28086433 GTAAACATGCTCCCATCTTGGGG + Intronic
930231935 2:48852008-48852030 GTTAAGATGTAGACATTTTGGGG + Intergenic
931191920 2:60009953-60009975 ATTAAGATGTGGGCATCTTGGGG - Intergenic
931507008 2:62939811-62939833 ATTAATATGATGCCATTTTGAGG + Intronic
932112355 2:69013023-69013045 GTTCAAAGGCTGCCACCTTGTGG - Intergenic
932512762 2:72311673-72311695 ATTAAGATGTTGACACCTTGTGG + Intronic
935432741 2:102993744-102993766 GAGCAGATGCTGCCATGTTGTGG - Intergenic
935518920 2:104079074-104079096 GAGAAGCTGCTGCCATCATGTGG - Intergenic
936096342 2:109532998-109533020 GATAAGGTCCTGCCCTCTTGGGG + Intergenic
936764542 2:115830999-115831021 ATTAAGATCCTGCCTCCTTGAGG + Intronic
936902268 2:117495013-117495035 GTTTATATGCTGCTCTCTTGTGG + Intergenic
937544933 2:123005038-123005060 GTTATGATGCTGCAGTCCTGCGG - Intergenic
939170052 2:138685189-138685211 GAGTTGATGCTGCCATCTTGAGG - Intronic
941928383 2:170917556-170917578 GTTAACATGCCGCCATCTGTTGG - Intergenic
943266551 2:185739101-185739123 GTCAGGAGGCTGCCCTCTTGCGG + Intronic
943356596 2:186864020-186864042 GTTCAGATTCTGCCATTTTGAGG + Intergenic
943989692 2:194671695-194671717 ATTAGGATGCTGACATCTTCAGG + Intergenic
944553385 2:200865511-200865533 GTTAAGATGTTCCCATAATGAGG + Intergenic
945174004 2:207023407-207023429 GATAATGTGCTGCCATTTTGAGG - Intergenic
946653453 2:221919162-221919184 GTTTAGCTGCTGGCACCTTGAGG - Intergenic
947683321 2:232056872-232056894 CTAAAGCTGCTGCTATCTTGTGG + Intronic
948130104 2:235594222-235594244 TTTAAGATGCTGCCCCCTTCTGG + Intronic
948256197 2:236569748-236569770 GTTACAAAGCTGCCATCTAGAGG + Exonic
948524394 2:238561244-238561266 GTTAAGATCCTGGCCTCTTTAGG - Intergenic
1168985681 20:2046736-2046758 TTTAAGAAGCTGCCATGTCGTGG + Intergenic
1169430140 20:5529068-5529090 GTGCATGTGCTGCCATCTTGTGG - Intergenic
1169808683 20:9586047-9586069 CTTCAGATGCTACCATCTTTGGG + Intronic
1170433925 20:16304366-16304388 CTGAAGATGCTGCAATCCTGAGG - Intronic
1171771881 20:29327944-29327966 GGTGGGATGCTGCCATCTGGCGG + Intergenic
1183877069 22:40791962-40791984 CTTAAGTTGCTTCCATCTTTTGG - Intronic
1184885921 22:47344479-47344501 GTGAAGATTCTGGCATCCTGTGG - Intergenic
1185036116 22:48477772-48477794 GTTAAGAAGCTGCTCTCTGGGGG + Intergenic
950326762 3:12117785-12117807 GGGAAGATGCTGCCAACTTCAGG - Intronic
952702100 3:36338630-36338652 GTTTAGAAGCTGCCATTGTGAGG + Intergenic
952756099 3:36869034-36869056 GTGGACATGCTGCCATCTGGTGG + Intronic
952801239 3:37294167-37294189 GTTAAAATGCTGCTTTCTTTAGG - Intronic
954453490 3:50584354-50584376 ATTAAGACACTGCCATTTTGGGG - Exonic
956046636 3:65202671-65202693 ATTAAGTTGCTGTCACCTTGGGG - Intergenic
956047776 3:65214824-65214846 GGAAAAATGCTGCCATCTTGGGG - Intergenic
963278175 3:143353687-143353709 ATTAGGATGCTGGCATCTTAAGG + Intronic
963809917 3:149765934-149765956 GTTAGGTTGTTGCCACCTTGTGG - Intronic
968937765 4:3621632-3621654 GTTAAGATGAGGTCATATTGGGG + Intergenic
970938820 4:21607077-21607099 ATTAAGATGTGGCCACCTTGGGG + Intronic
971665338 4:29476405-29476427 GTTAACATGATGCTATCATGAGG + Intergenic
972892053 4:43569051-43569073 GTTCAGATGCTGACATGTTAAGG - Intergenic
972967046 4:44523632-44523654 ATTAAGATGCAGACATCTTTGGG - Intergenic
973550162 4:52026187-52026209 GTTCCAATGCTGCCATCTTGTGG + Intronic
975288920 4:72653265-72653287 CTTAATATTCTGCCACCTTGGGG + Intergenic
975894991 4:79078463-79078485 GATAAGATGTTCCCATGTTGAGG + Intergenic
976522427 4:86044178-86044200 ATTGTGATGCTGCCACCTTGTGG + Intronic
977217898 4:94304560-94304582 GCTACATTGCTGCCATCTTGTGG - Intronic
977698843 4:99998162-99998184 TTTAACATGCTGCCATCATGTGG - Intergenic
978146429 4:105377834-105377856 TTTAAGATTCAGCCATGTTGTGG + Intronic
979190256 4:117848452-117848474 GTTAAGCTGCTGCCAAATTTTGG + Intergenic
979624890 4:122833565-122833587 CTTAAGATGCTGGCACCTTAAGG + Intronic
980421183 4:132563643-132563665 GTTAAGATGAGGCCATACTGGGG - Intergenic
984725085 4:183013062-183013084 GTTCAGATTCTGCCATCTTCAGG - Intergenic
987989770 5:25195291-25195313 GTTCAGATAATGCCATCATGAGG - Intergenic
989585486 5:43071288-43071310 GTTAACACGCTGACATCTTTCGG + Intronic
989909488 5:49610713-49610735 GTTGATATTCTGACATCTTGTGG - Intergenic
989910119 5:49625019-49625041 GTTGATATTCTGACATCTTGTGG - Intergenic
994177669 5:96729329-96729351 GCTAAAATGGTGCCATCCTGTGG + Intronic
994649373 5:102507079-102507101 TTTAATTTGCTGCCATCTAGAGG + Intergenic
995116101 5:108481528-108481550 AGTAAAATGCTGCCATCTGGAGG - Intergenic
995921874 5:117324422-117324444 GCTAATATGAAGCCATCTTGGGG - Intergenic
997588403 5:135058133-135058155 GTTAAGATGAGGTCATCCTGGGG - Intronic
999167723 5:149564923-149564945 TATACAATGCTGCCATCTTGAGG + Intronic
1001477319 5:172059813-172059835 GGTATGCTACTGCCATCTTGTGG + Intronic
1004607873 6:17210867-17210889 GTTAAGCTGCTGAGAACTTGAGG + Intergenic
1005479686 6:26243639-26243661 ATTAAGATGCGGGCATCTGGGGG - Intergenic
1010309519 6:74367952-74367974 GGCAAGATGATGGCATCTTGTGG + Intergenic
1012097450 6:94980261-94980283 ATTAAGTTGCTGCCAACTTAAGG - Intergenic
1012371657 6:98514518-98514540 GGTAAAATGCTGCCATCTTTTGG + Intergenic
1012461548 6:99467700-99467722 GTTGAGATAGTGCCATCTCGTGG - Intronic
1013204299 6:107932926-107932948 ATTAAGATGTGGACATCTTGGGG - Intronic
1013541768 6:111117535-111117557 GTTAAGATGCTGCCATTTCAGGG - Intronic
1014645565 6:123968342-123968364 GTCCAGATGATTCCATCTTGGGG + Intronic
1015005023 6:128269471-128269493 GTTAAGATGCCACCCTCTTTTGG - Intronic
1015102608 6:129499206-129499228 GTTACAATTCTGCCACCTTGTGG - Intronic
1018321335 6:162612488-162612510 GTTAAGATGCTGACTTGCTGAGG + Intronic
1021822010 7:24507633-24507655 TTTAGGATGCTTCCATCTTTCGG - Intergenic
1022331404 7:29382740-29382762 GCTGAAATGCTGCCATCCTGGGG - Intronic
1023617979 7:42040330-42040352 GATAAGAAGCTGGCAACTTGCGG + Intronic
1023762448 7:43479215-43479237 GATTAGATGCTGCCATCTGGGGG + Intronic
1024199177 7:47088982-47089004 GCTCAGATGTTGCCATCTAGTGG + Intergenic
1028348471 7:89813770-89813792 TTTAAGAAGCTGGCATTTTGAGG + Intergenic
1028807850 7:95049476-95049498 GTTAAGATCCTGCCTTACTGTGG + Intronic
1031404385 7:121367023-121367045 GATAAGCTGCTGCCCTCTTGTGG - Intronic
1032070897 7:128806138-128806160 TTTCAGATGCAGACATCTTGAGG - Intronic
1034454538 7:151159976-151159998 GGTAAGATGCATGCATCTTGAGG - Intronic
1035718221 8:1770214-1770236 GGTAAGATGATGCCAACTTGGGG + Intronic
1035982396 8:4387161-4387183 GTTAACACAATGCCATCTTGTGG + Intronic
1036621193 8:10425332-10425354 GTGAAGTGTCTGCCATCTTGTGG + Intronic
1039997955 8:42550756-42550778 GTTAAGATGTGGACATCTTTGGG + Intronic
1041628108 8:60054780-60054802 CTTAAGATGTTGCCAATTTGGGG + Intergenic
1042328166 8:67549897-67549919 TTTAAGTTGCTTCCATGTTGTGG + Intronic
1047700892 8:127448387-127448409 GTTAAGATGTGGACATCTTTGGG - Intergenic
1048232021 8:132651622-132651644 GTGACGATGCTGCCCTCTAGTGG + Intronic
1049458032 8:142704078-142704100 GTTAAGATGCAGCCATCCATGGG + Exonic
1052243839 9:26309297-26309319 GATAAAATGCTGCCATGTTCAGG + Intergenic
1052612499 9:30793729-30793751 GTTAAGATACTGCAACCTGGAGG - Intergenic
1052801046 9:32968578-32968600 GTTCAAATGCTGCCATCTGGTGG + Intergenic
1058287713 9:103200946-103200968 GTTCAGATGCTGACATTTTAAGG + Intergenic
1060149440 9:121278893-121278915 GTGCAGATGCTGCCATCTATGGG - Intronic
1061164769 9:128915996-128916018 GAAAAGATGCTGAGATCTTGGGG + Intronic
1061551546 9:131337601-131337623 GTTAAGATGCGGTCATCGGGGGG + Intergenic
1203340360 Un_KI270315v1:926-948 GTGGATATGCTGACATCTTGTGG + Intergenic
1186730799 X:12407230-12407252 GTTAAAATGCAGACATCTTTGGG + Intronic
1188460366 X:30419045-30419067 GTCAACATGCTGCCAGCTTTGGG - Intergenic
1188805092 X:34578419-34578441 GGTAAAATGCTGCCATCTATGGG - Intergenic
1195871028 X:109485961-109485983 GTTAAAATATTGACATCTTGCGG - Intergenic
1196632647 X:117961457-117961479 GTTAAGATGTGGACATCTTTAGG - Intronic
1198585675 X:138118066-138118088 TTTAAGATGTTTCCATATTGTGG + Intergenic
1198662626 X:138986542-138986564 TTTAAAATGTTGCCATTTTGTGG - Intronic