ID: 1085572244

View in Genome Browser
Species Human (GRCh38)
Location 11:77569531-77569553
Sequence AGGGAGAGTGCAGTGATTAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 595
Summary {0: 2, 1: 28, 2: 62, 3: 138, 4: 365}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085572244_1085572250 21 Left 1085572244 11:77569531-77569553 CCCATAATCACTGCACTCTCCCT 0: 2
1: 28
2: 62
3: 138
4: 365
Right 1085572250 11:77569575-77569597 TGTGCTATGCAGCCACAGCTAGG 0: 1
1: 0
2: 2
3: 25
4: 219

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085572244 Original CRISPR AGGGAGAGTGCAGTGATTAT GGG (reversed) Intronic
904030745 1:27532147-27532169 AGGGAGAGGGAAGTGATGGTAGG - Intergenic
905739816 1:40360692-40360714 AAGGAGAGCACAGTGATTGTGGG + Intronic
905740222 1:40363792-40363814 AAGGAGAGTGCAGTGATTGTGGG + Intronic
905768065 1:40619762-40619784 GGGGAGGGTGCAGTTGTTATTGG + Intergenic
906827172 1:48993804-48993826 AGGGAGAGTGCAGTGATTGTGGG - Intronic
907023635 1:51094212-51094234 AGGAAAAGTGTAGTGATTTTGGG + Intergenic
908093020 1:60706648-60706670 AGGGAAAGTGAAGTGACTGTGGG + Intergenic
908363273 1:63390800-63390822 AGGGAGAGTGCAGTGACTATGGG - Intronic
909266742 1:73569490-73569512 GGCTAGAGTGCAGTGAATATTGG + Intergenic
909582462 1:77253467-77253489 AGGGAGAGTGAAGTGATTGTGGG + Intergenic
910384225 1:86664350-86664372 AGGCAGAGCACAGTGATTACAGG + Intergenic
910384430 1:86665570-86665592 AGGCAGAGCACAGTGATTACAGG - Intergenic
910470525 1:87547745-87547767 AGGGAGAGGACAGTGACTGTGGG - Intergenic
910476836 1:87616518-87616540 TGGGAGAGCAGAGTGATTATAGG + Intergenic
910724845 1:90327793-90327815 AGGGAGAATGCAGTGATTGTGGG + Intergenic
910801255 1:91149060-91149082 AGGGGGAGCACAGTGATTGTGGG - Intergenic
911011608 1:93287184-93287206 AAGGAGAATGCAGTGATTCTGGG + Intergenic
911012600 1:93297057-93297079 AGTAAGAGCGCAGTGATTTTGGG - Intergenic
911019729 1:93374634-93374656 GGGGAGAGCACAGTTATTATGGG + Intergenic
911960846 1:104300915-104300937 AGGGAGGGTGCAGTGACTGAAGG + Intergenic
912018548 1:105072980-105073002 AGGAAGAGTGCAGTGACTGAGGG - Intergenic
912643821 1:111372275-111372297 AGGGAGAGCACAGTGATTGTGGG + Intergenic
912871407 1:113310480-113310502 AGGGAGAGCACAGGGATTGTGGG + Intergenic
912873241 1:113328863-113328885 AGGGAGAATGCAGTAATTGTGGG - Intergenic
913379657 1:118195483-118195505 AGGGAGGGAGAAGAGATTATGGG - Intergenic
915005229 1:152629471-152629493 AAAGAGAGTGCAGTGATTGTGGG + Intergenic
915752662 1:158226761-158226783 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
915931710 1:160064829-160064851 AGGGAGAATGCAGTGCTAAGAGG + Intronic
917306127 1:173627467-173627489 AGGGAGAGCACAGTGACTGTGGG + Intronic
917397037 1:174604346-174604368 AGGGAGAGGACAGTGATTGTGGG - Intronic
917405039 1:174696678-174696700 AGGGAGAGAGCAGGGATTGTGGG - Intronic
917916666 1:179709089-179709111 TGGGGGAGTGCAGTGAATAAGGG - Intergenic
918357892 1:183723505-183723527 AGGGAGAGTACAGTGACTGTGGG + Intronic
919047384 1:192470421-192470443 AGGGAAAGTGAAGTGATTGTGGG - Intergenic
919067665 1:192713886-192713908 AGGGAGAATGCATTGAGTGTGGG + Intergenic
919169705 1:193938553-193938575 GGGGAGAGTGCAGCAATTGTGGG + Intergenic
919365285 1:196651893-196651915 AGTGGGAGTGCAGTGAGAATTGG + Exonic
919835372 1:201569621-201569643 AGGGAAGGTACAGTGATTCTGGG + Intergenic
919857840 1:201717781-201717803 AAGTAGAGTGCAGAGAGTATAGG - Intronic
921032910 1:211349717-211349739 AGGGAGAGTGCAGAGTGTAGTGG + Intronic
921746123 1:218742679-218742701 AGAGAGAGTGCAGTGATTGTGGG + Intergenic
922377032 1:224979326-224979348 AGGGAGAGTGCAGTGCTTGTGGG + Intronic
923405982 1:233660906-233660928 TGGTAGAGTGCAAAGATTATGGG + Intronic
924481583 1:244439954-244439976 CAGGAGAATGCAGTGATCATAGG - Intronic
924490926 1:244536562-244536584 AGACAGAGTGCAGTGATTGTGGG - Intronic
924516319 1:244769011-244769033 AGGGAGAGCGCAGTGACTGGGGG - Intergenic
1063056348 10:2509088-2509110 AGGGAGAGTGGAGTGAATCTTGG + Intergenic
1063469021 10:6269553-6269575 GGGGAAAATGCAGTGAATATAGG + Intergenic
1064846015 10:19654151-19654173 AGGTAGATGGCAGTGCTTATGGG - Intronic
1064987630 10:21226675-21226697 AGGGAGAGTAAAGTGATTGTGGG - Intergenic
1065224174 10:23525895-23525917 AGGAAGATTGCAATGATTTTTGG + Intergenic
1065431559 10:25662055-25662077 AAGGAGAGTGTAGTGACTGTGGG - Intergenic
1065921716 10:30398959-30398981 AGGGAGAGTGCAGCAATTGTGGG + Intergenic
1066303737 10:34119115-34119137 TGGGTGAGAGCAGTGATGATGGG + Intronic
1066649838 10:37643670-37643692 AAGGAGAGTGCAGTGATTATGGG - Intergenic
1067032728 10:42889217-42889239 AAGGAGAGTGCAGTGATTATGGG - Intergenic
1068840861 10:61612430-61612452 AGGGAGAGTGTTGTTATTAGAGG - Intergenic
1069076441 10:64042319-64042341 AGGGAGAGTGGAGTGAGTGCAGG - Intergenic
1069193570 10:65520302-65520324 AGGGAGAGAGCAGTGATAGTGGG - Intergenic
1070464134 10:76702878-76702900 AAGGAGAGTGCAGTGATCATGGG + Intergenic
1071586948 10:86832571-86832593 AGGTAGAAGGCAGTGATTGTGGG - Intronic
1071697543 10:87892724-87892746 AGTGAGTGGGCAGAGATTATTGG + Intronic
1071761969 10:88617954-88617976 AGGGAGAGTGCTGTTATCTTTGG - Intergenic
1072492500 10:95921317-95921339 AGGGAGAGTTAAGTGATTGGGGG - Intronic
1072844398 10:98813484-98813506 ATGGAGAAGGCAGTGATTTTGGG - Intronic
1074183981 10:111085619-111085641 AGGGAGATTGCAGAGAGAATCGG + Intergenic
1074670051 10:115780154-115780176 AGGGAGAGCACAGTGATTGTGGG + Intronic
1075496261 10:122922166-122922188 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
1076777668 10:132707042-132707064 ACGGAGAGCGCAGTGATCAGAGG - Intronic
1078690783 11:13578735-13578757 AGGGAGAGTGCAGGGATTGCGGG + Intergenic
1079532894 11:21476796-21476818 AGGGAGAGCACAATGATTGTGGG + Intronic
1079760146 11:24319148-24319170 AGAGAGAGTGCAAGGATTGTGGG - Intergenic
1080096879 11:28418775-28418797 AGGCAAAGTGCAGTGAATGTGGG + Intergenic
1080268738 11:30427777-30427799 AGGGAGAGGGGAAAGATTATGGG + Intronic
1080489963 11:32751588-32751610 AAGGAGAGTGCAGCAATTGTGGG - Intronic
1080700650 11:34641284-34641306 GGGGAGAGAGCAGTAATTAAAGG - Intronic
1080966640 11:37220567-37220589 AGAGAGAATGCAGTGATCGTGGG - Intergenic
1081245653 11:40763653-40763675 AGGGAAAGCACAGTGATTGTGGG + Intronic
1081930927 11:46870678-46870700 AGCCAGAGTGCTGTGATTACAGG + Intronic
1082626569 11:55494611-55494633 GGGGAGTGTACAGTGTTTATTGG - Intergenic
1082835153 11:57646077-57646099 AAGGAGAAAGCAGTGATTGTAGG + Intronic
1083934387 11:65862702-65862724 TGGGAGGGTGCGGTGGTTATTGG + Intronic
1084010603 11:66346458-66346480 AGGGAGAGGGCAGGGGTAATGGG - Intronic
1084045785 11:66567109-66567131 AGGGAGAGCTCAGGAATTATGGG + Intronic
1084552469 11:69854119-69854141 TGGGAGAGTGCTGGGATTACAGG - Intergenic
1084763960 11:71295401-71295423 AGGTATAATGCAGTGATTGTGGG - Intergenic
1085194851 11:74662957-74662979 AGGGAGAGTGCAGCAACTGTGGG - Intronic
1085572244 11:77569531-77569553 AGGGAGAGTGCAGTGATTATGGG - Intronic
1085980404 11:81717867-81717889 AGGAAAACTGCAGTGATTGTGGG + Intergenic
1086847921 11:91774415-91774437 AGGGAGAGCACAGCGATTTTAGG - Intergenic
1087370595 11:97279249-97279271 AGGGACAGTGCAGGGATTGGAGG + Intergenic
1087902026 11:103651603-103651625 CAGTAGAGTGCAGTGATTAAAGG + Intergenic
1088944582 11:114496313-114496335 AGGGAGAGCACAGTGATTGTGGG - Intergenic
1088946990 11:114524293-114524315 AAGGAGAAGGCAGTGAGTATTGG + Intronic
1089503584 11:118947904-118947926 AGACAGACTGCAGTGATTTTAGG - Intronic
1090210492 11:124917566-124917588 AGGGAGAGTGCAGTCATTGTGGG - Intergenic
1092497512 12:9011815-9011837 AGGAAGAGTGCTGTGATTATGGG + Intergenic
1093531900 12:20175252-20175274 AGAGAGAGTCCAGTGACTGTGGG - Intergenic
1094226251 12:28049423-28049445 CTGGAGAGTGGAGTGATTTTTGG + Intergenic
1094270385 12:28608164-28608186 AGGTTGAGTGCTGTGATTTTGGG + Intergenic
1094419680 12:30257476-30257498 AGGGAGAGCACAGTAACTATAGG + Intergenic
1094642989 12:32294684-32294706 AGTGAGAGACCAGTGATTGTAGG - Intronic
1095860141 12:46907802-46907824 AGGGAGAGTGCAGTGACTGTGGG + Intergenic
1096108652 12:49015063-49015085 GGGGAGAGTGCAGGGAGTAAGGG + Intronic
1096112004 12:49034399-49034421 AGGGAGTGATCAGTGAGTATGGG - Exonic
1096548948 12:52359732-52359754 AGGGTGAGAGCAGTGAGTTTGGG + Intergenic
1096668362 12:53181771-53181793 AGGCAGAGTCCAGGGATTCTTGG + Exonic
1097714859 12:62955206-62955228 ATGTAGAGTGCAGTGACTAAGGG - Intergenic
1097899388 12:64857899-64857921 TGGGAGAGTGCAGTGACTAGAGG - Intronic
1098060201 12:66553750-66553772 AGGAAAAGTGCTGTGATTTTGGG + Intronic
1098405573 12:70122901-70122923 AGAGAGAGTGCAGTGACTAGAGG + Intergenic
1098419114 12:70272740-70272762 AGGGAGAGTGAAGGGATTAGAGG - Intronic
1099491305 12:83292060-83292082 AGGGAGAGTGTAGTGATTGTGGG + Intergenic
1099757785 12:86876891-86876913 AGGGAGAGCGCAGTGACTGTGGG - Intergenic
1099935864 12:89124577-89124599 AGGGAGAATGAAGTGTGTATTGG - Intergenic
1100904808 12:99285756-99285778 AGGAAGAGAGCAGTAATTGTGGG + Intronic
1100909295 12:99339328-99339350 AGGAAGAATGCAGTGATTGCTGG - Intronic
1101474350 12:105029943-105029965 AGAAAGAGTGCTGTTATTATAGG - Intronic
1102480765 12:113221660-113221682 AGGGAGAGGGCAGGGATCAGGGG + Intronic
1103063215 12:117875608-117875630 AGGGAGAAGGCAGCGATTATGGG - Intronic
1105977878 13:25489289-25489311 AGGGAAAGTGCCGTGATTAAAGG - Intronic
1107753947 13:43599324-43599346 AGGGAGAGTGCAGCGATGGTGGG - Intronic
1107753960 13:43599367-43599389 AGGGAGAGTGCAGTGATAGTGGG + Intronic
1107808346 13:44175547-44175569 AGGGAGAGTGCAGTGATTGTGGG - Intergenic
1110448876 13:75618612-75618634 AGGGAGAGTAGAGTGATTATGGG - Intergenic
1110474815 13:75901679-75901701 AGGCAGAGTGAAGGGATTAAAGG - Intergenic
1110665874 13:78116770-78116792 AGGGAGAATGCAGTGACTGTGGG - Intergenic
1111296012 13:86278664-86278686 AAGGAGATTAGAGTGATTATAGG + Intergenic
1111335459 13:86815765-86815787 AGGGAGAGTGCTGTGATTGTGGG + Intergenic
1111639193 13:90946625-90946647 AGGGAGAGCATAGTGATTGTGGG + Intergenic
1113217495 13:108060162-108060184 ACCGAGAGTGCAGTGATTGTAGG + Intergenic
1113834287 13:113318744-113318766 AGGGAGAAGGCAGTGAGTGTGGG - Intronic
1114994289 14:28328467-28328489 AGAGAGAGTGAAGTGATCCTGGG - Intergenic
1116114876 14:40635389-40635411 AGAGAGAATGTAGTGATTGTGGG + Intergenic
1116354700 14:43914009-43914031 AGGGACAGCACAGTGATTGTGGG + Intergenic
1116413091 14:44648980-44649002 AGGGAGAGTTCAGTGATTATGGG + Intergenic
1117161617 14:52995341-52995363 AGGGAGAGCACAGTGACTATGGG - Intergenic
1117208572 14:53470823-53470845 AGAGAGAGCACAGTGATTGTGGG - Intergenic
1117384369 14:55195809-55195831 AGGGAGAGCGCAGTGACTGATGG - Intergenic
1117499315 14:56336533-56336555 AAAGAGAATGAAGTGATTATAGG - Intergenic
1117795546 14:59389370-59389392 AGAAAGAGTGCAGTGGTTGTGGG - Intergenic
1118034282 14:61849623-61849645 AGGGAGAGCATAGTGATTGTGGG - Intergenic
1118431284 14:65720949-65720971 AGGGGGAGCACAGTGATTGTGGG - Intronic
1118654231 14:67930089-67930111 AGGTAAAGTGCACTGATTGTAGG + Intronic
1121836512 14:97097272-97097294 AGAAAGAGTGCAATGAGTATCGG - Intergenic
1126486648 15:49188430-49188452 TGGAGGAGTACAGTGATTATGGG - Intronic
1126489145 15:49216808-49216830 AGGGAGGGTGAAGTGAGTGTGGG - Intronic
1126660829 15:51031470-51031492 AGAGGGACTGCAGTGATTGTGGG - Intergenic
1126706749 15:51413490-51413512 AGGGAGAGGACAGTAATTGTGGG + Intergenic
1127493203 15:59484558-59484580 AGGGAGAGTGCAGTGTTTATGGG + Intronic
1127971646 15:63966733-63966755 AGGGAGAGTGCAGCAATTGTGGG - Intronic
1128077907 15:64839853-64839875 AGGGAGAGAGCAGTGAGGACAGG - Intergenic
1128561019 15:68667712-68667734 TGGGAGAGTGCACTGAAGATGGG + Intronic
1130367452 15:83253236-83253258 AACAAGAGTGCAGTGATTAGGGG + Intergenic
1131944800 15:97608397-97608419 AAGGAAAGTGCAGTGATTGTGGG + Intergenic
1132014051 15:98300360-98300382 CGGGAGTGTGCAGAGATTCTGGG - Intergenic
1133834304 16:9352328-9352350 AGACAGAGTGCAGTGATTGTGGG - Intergenic
1137656696 16:50165566-50165588 AGGGAGTGGGGAGTGATAATGGG - Intronic
1138890836 16:61142466-61142488 AGGGAGAGTGCAGAGATTGTGGG - Intergenic
1139005041 16:62559487-62559509 AGGGAGAGTGCAGTGACTGTGGG - Intergenic
1140317274 16:73911308-73911330 AGGTAGAGTGCAGTCAATGTGGG + Intergenic
1140625296 16:76787035-76787057 AAGGTGGGTGCAGGGATTATGGG - Intergenic
1142919139 17:3169345-3169367 AGAGAGAATGCAGTGAGTGTGGG + Intergenic
1143413585 17:6728429-6728451 AGGGAGAGTAGAGTGATTGTGGG + Intergenic
1144319240 17:14097719-14097741 ATTGACAGTTCAGTGATTATGGG + Intronic
1145069085 17:19787910-19787932 AGGGAGAGTGCAGCAATTTGGGG + Intronic
1145201016 17:20944751-20944773 AGGGAGAGCTCAGTGATTGTGGG - Intergenic
1145797068 17:27661809-27661831 AGGGAAAGTGCAGGGCTTCTCGG - Intergenic
1146098965 17:29960133-29960155 AGGGAGAGCACAGTGACTGTGGG - Intronic
1146242678 17:31244616-31244638 ACGGACAGCACAGTGATTATGGG - Intronic
1146686552 17:34845168-34845190 ATGCAGAGTGCAGTGATGCTAGG - Intergenic
1149188436 17:54029953-54029975 AGAGAGAGCACAGTGATTGTGGG + Intergenic
1149249345 17:54750033-54750055 TGGGAGAGTGCAGTGATTGTGGG - Intergenic
1149370054 17:55985034-55985056 AGGGAGAAAGGAGTGATCATGGG + Intergenic
1149437272 17:56643960-56643982 AGGGACAGTGCAGTCATCAAGGG + Intergenic
1150180911 17:63119966-63119988 AGTGATAGTGGAGTGATCATGGG - Intronic
1150507341 17:65712850-65712872 AGGCAGAGAGCTGTGCTTATCGG + Intronic
1150541391 17:66103824-66103846 AGGAAGAGCACAGTGATTGTGGG + Intronic
1150555740 17:66252614-66252636 ACGGAGATTGCAGTGAGTAGAGG + Intronic
1150870897 17:68910321-68910343 AGGGAGAGGACAGTCATTGTGGG + Intronic
1151094997 17:71486791-71486813 TGGCAGAGTGCAGAGATTAGAGG + Intergenic
1153088511 18:1317650-1317672 AGGAAGAGTGAAGTGATCATGGG + Intergenic
1153356707 18:4144413-4144435 AGGGAGAACACAGTGATTGTGGG - Intronic
1153765370 18:8369556-8369578 AGGAAGAGCGCAGTGACTGTGGG + Intronic
1153971572 18:10231880-10231902 AGGCAGGGGGCAGTGATTATAGG - Intergenic
1155443292 18:25884416-25884438 AGGGAGAGCACAGTGATTGTGGG + Intergenic
1155679311 18:28470198-28470220 AGGGAGAGTGCTGAGATGAGTGG - Intergenic
1155767349 18:29652369-29652391 AGGGAGAATGCAGTGAATGTGGG + Intergenic
1155975245 18:32121770-32121792 ATGGAGAGTGCACTTATTAAGGG - Intronic
1157275461 18:46308146-46308168 AAGGAGAGTGCAATGGATATTGG - Intergenic
1157879197 18:51304113-51304135 AAGGAGAGTGCAGTGATTGTGGG + Intergenic
1158942548 18:62418941-62418963 AGGGAGAATGCAAAGATTAGTGG - Intergenic
1159446200 18:68544532-68544554 CAGGAGAGTGCAGTGATTGTGGG + Intergenic
1159775443 18:72598856-72598878 AGAGAGAGTGCAGCAATTTTGGG - Intronic
1159802680 18:72920395-72920417 AGGGAGAGCACAGTCATTATGGG - Intergenic
1163600742 19:18247815-18247837 AGGGAGGGTGCAGAGAGTGTGGG - Intronic
1165692813 19:37876765-37876787 AGGGAAAGTGCTGGGATTACAGG + Intergenic
1166347966 19:42178060-42178082 AGGGAGAGGGCAGGAAGTATAGG + Intronic
925588470 2:5486942-5486964 AGAGAGAGTGCAGTGATTATGGG + Intergenic
925699059 2:6614370-6614392 ACGGAGAGTGCTGTGAGTGTGGG - Intergenic
926320042 2:11743345-11743367 AGGGAGAGGACAGTGATCCTCGG - Intronic
926518750 2:13883412-13883434 AGGGAGAGCACAGTGATTGCGGG + Intergenic
927243736 2:20940464-20940486 AGGGAAAATGCAGGGATTACGGG + Intergenic
928124472 2:28606190-28606212 AGGGAAAGTGGAATGAATATGGG - Intronic
928468050 2:31541776-31541798 ATGGACAGTACAGTGATTGTGGG + Intronic
928483956 2:31710992-31711014 AGGGAGAGCAAAGTGATTGTGGG + Intergenic
928715648 2:34056696-34056718 AGGAAGAGTGCCATGATTGTGGG - Intergenic
929281837 2:40088203-40088225 AAGGAAAGTGCAGTGACTGTGGG - Intergenic
930288943 2:49468769-49468791 AGGGAGAGCACAGTGATTGTGGG - Intergenic
930439784 2:51391220-51391242 AGGGAGAGTACAGTGACTGGGGG - Intergenic
930469157 2:51791842-51791864 AGAGAGAGTGTAGTGATTGTGGG + Intergenic
930778157 2:55196028-55196050 AGGAAGAGTGCAGTGATTGTAGG + Intronic
930895546 2:56441412-56441434 AGGTAGAGCACAGTGATTGTGGG - Intergenic
930981271 2:57528779-57528801 AGGGAGAGTTAAGTGATTGTGGG - Intergenic
931407012 2:61988945-61988967 AGGGAGAGTGCAGCAATTGTGGG - Intronic
931773839 2:65523045-65523067 AGGGAGCGTACAGTAAGTATGGG - Intergenic
932889379 2:75579003-75579025 AGAGAAAGTGCAGTGATTGTGGG + Intergenic
932933672 2:76075708-76075730 AGGGAGAGTGGAGTTGTAATTGG + Intergenic
932957222 2:76366548-76366570 AGTGAAAGTGCTGGGATTATGGG + Intergenic
934855858 2:97729485-97729507 GTGGGGAGTGCTGTGATTATAGG + Intronic
934928862 2:98404045-98404067 GGGGAGAGTGCAGTGATTGTGGG + Intergenic
935018945 2:99212132-99212154 AGGGAGAATGAAGTGATCATGGG - Intronic
935437954 2:103056898-103056920 AGGGAGAGTGCCGTGACTAGGGG - Intergenic
935507413 2:103922743-103922765 ATGGAGATTGCAGTCAATATGGG + Intergenic
935690949 2:105732125-105732147 TGGGAGAGTGCACTGGTTCTGGG + Intergenic
936511403 2:113150406-113150428 AGGGATAGTGCAGTGATTGCCGG - Intergenic
936703805 2:115045580-115045602 AGGGTGAGTGCAGTGATTGCGGG - Intronic
936940504 2:117879297-117879319 AGGGAAAGTGCAGTGATTGTGGG - Intergenic
937121838 2:119445707-119445729 CGGGAGAAGCCAGTGATTATAGG - Intronic
937361503 2:121233057-121233079 ACGCAGAGTGCTGGGATTATAGG - Intronic
938587636 2:132707207-132707229 GGGGAAAGTGCAGTGACTGTGGG + Intronic
939144423 2:138395703-138395725 AGAGAGACTGCAGTGACTGTGGG + Intergenic
939708027 2:145479185-145479207 AGGAAGACTGCAGTGACTAAGGG - Intergenic
940468568 2:154064074-154064096 ATGGAGAGGCCAGTGATTATAGG + Intronic
940559959 2:155282274-155282296 AGGAGAAGTGCAGTGATTATGGG - Intergenic
940795252 2:158070867-158070889 AGGGAGAGCACAGTGACTGTAGG + Intronic
940864935 2:158808360-158808382 AGGAAGAGTGCACAGCTTATAGG + Intronic
941047642 2:160694739-160694761 AGGGAGAGTGCAGTGACTGGTGG - Intergenic
941742138 2:169046599-169046621 AGGGAGAGCACAGTGACTGTGGG + Intergenic
941746094 2:169088292-169088314 AGGGAGAGCACAGTGATTGTGGG - Intronic
942577134 2:177375587-177375609 AGAGACAGTGCCCTGATTATGGG + Intronic
942881796 2:180870665-180870687 AGGGAGAGTGCAGTGACTGTGGG + Intergenic
943099656 2:183472223-183472245 AGGGAGAGTGCAGTGACTATGGG - Intergenic
943844982 2:192634470-192634492 AGGGAGAGTACAGTGATTCTGGG + Intergenic
943867047 2:192938491-192938513 AGGGAGAGTGCAGTGACTGAGGG - Intergenic
944133379 2:196370828-196370850 AGGGAGAATGCAGTGATTGTGGG - Intronic
944616548 2:201465909-201465931 AGGGAGAGTGCAGTGATTGTGGG - Intronic
944660450 2:201917213-201917235 AGGGAGAGTGCAGACATTAGTGG + Intergenic
944760240 2:202807310-202807332 AGGGAGAGTGCAGTGATTGTGGG + Intronic
944855209 2:203760514-203760536 AGAAAGAGTGCAGTGATTGCAGG - Intergenic
945334323 2:208573491-208573513 AGGTAGAGTGAAGTGATTGTGGG + Intronic
946029787 2:216694817-216694839 AGCGAGAGTGCAGGGATAAAGGG + Exonic
946059319 2:216928085-216928107 AAGGAGAGTGGAGTGGTTAAGGG - Intergenic
946291177 2:218746597-218746619 ATGGAATGTGCAGTGATCATAGG - Intronic
947009273 2:225547616-225547638 AAGGAGAGTATAGTGATTGTGGG - Intronic
947126818 2:226877849-226877871 GTGAAGAGTGCAGTGACTATTGG + Intronic
947195910 2:227567566-227567588 AGAGAAAGTCCAGTGTTTATAGG + Intergenic
947505344 2:230704243-230704265 AGGGAGAGCACAGTGATTGCAGG - Intergenic
948774555 2:240277081-240277103 AGGGAGAGAGCAGTGACTGTGGG + Intergenic
1168748203 20:263170-263192 AGGGAGAGCACAGTGATTGTGGG + Intergenic
1169815753 20:9654458-9654480 ATGGAGAGAGCAGTGACAATGGG - Intronic
1169988613 20:11474248-11474270 AGGGAGAGCACAGTGATTGTGGG + Intergenic
1170142006 20:13133775-13133797 AGGGATGGTCCAGTGATTGTAGG + Intronic
1170311409 20:14996693-14996715 AAGGAGAGTGCAGTGATTGTAGG + Intronic
1170864221 20:20138508-20138530 AGAGAAAGTGCAGTGACTGTGGG - Intronic
1173709696 20:45143786-45143808 AGGGAGAGCTCAGTGCTTGTGGG - Intergenic
1174695409 20:52551828-52551850 AGGCAGAGTGCAGTGATGATGGG - Intergenic
1175118646 20:56701878-56701900 ATGTAGAGTGCTGGGATTATGGG + Intergenic
1175632274 20:60551207-60551229 AGAGAGAGTGCAGTGATTGTAGG - Intergenic
1176411746 21:6452856-6452878 AGGGAGAGCCCAACGATTATGGG + Intergenic
1176940060 21:14912637-14912659 AGGGAGAATGCATTGATTGTGGG - Intergenic
1177222330 21:18210291-18210313 AGGGGAAGTGCCGTGATTGTGGG - Intronic
1177295141 21:19163560-19163582 AGAAAGAGTGCAGTGATTGTGGG - Intergenic
1177539734 21:22477109-22477131 AGGGAGAGTGCAGTAATTGTAGG + Intergenic
1177849725 21:26332458-26332480 AGAGAGAGTGTAGTGATTCTGGG + Intergenic
1178330360 21:31685322-31685344 AGGGAGAGTGAAGCGGTAATAGG - Intronic
1179063387 21:38001205-38001227 AGGGATAGTGGAGAGAGTATTGG - Intronic
1179652382 21:42820035-42820057 AGGGAAGGTGCAGTGATTGTGGG + Intergenic
1179687240 21:43061178-43061200 AGGGAGAGCCCAACGATTATGGG + Intronic
1180998049 22:19975246-19975268 AGGGACAGGGCAGTGCCTATTGG - Intronic
1181519169 22:23435481-23435503 AGGGAGTGTGCAGTGACATTGGG + Intergenic
1181669319 22:24418813-24418835 AGGGAGAGTGGAGAGATTCCAGG + Intronic
1182722040 22:32410988-32411010 AGGGAGAGCGCAGTGGTTCATGG - Intronic
1182761964 22:32729634-32729656 AGTGAGAGTGATGTCATTATGGG - Intronic
1182785672 22:32905729-32905751 AGGCAGAGTGCAGGGAATACAGG - Intronic
1203294488 22_KI270736v1_random:28551-28573 AGGGATAGTGCAGAGTTGATGGG + Intergenic
949709291 3:6855908-6855930 AGGGAGACTGAAAGGATTATAGG + Intronic
950801197 3:15552974-15552996 AGGGAGAGTGCCGTAACTGTGGG - Intergenic
951029399 3:17864124-17864146 AGGGAGAGCACAGTGACTGTGGG - Intronic
951129822 3:19029372-19029394 AGGGAGAGCAAAGTGATTGTGGG + Intergenic
951279667 3:20732346-20732368 AGGGAGAGTGCAGAGATTGTGGG - Intergenic
951437096 3:22677188-22677210 AGGGATAGCACAGTGATTGTGGG - Intergenic
952052862 3:29407161-29407183 AGCAAGTGTGCAGTGATTGTTGG - Intronic
952688486 3:36176245-36176267 AGGAAAAGTGCAGTGATTGTGGG - Intergenic
952725639 3:36581816-36581838 AGGGAGAGTACAGTAATTGTGGG + Intergenic
952815733 3:37445989-37446011 GGGGGGAGTGCAGTGTTCATGGG + Intergenic
952967914 3:38632442-38632464 ATGGAGAGGGCAGTGATCACTGG - Intronic
954473363 3:50719371-50719393 AGCAAGAGCACAGTGATTATAGG + Intronic
955585332 3:60471512-60471534 AAGGAGAGTGCAGTGATTGTGGG - Intronic
957485589 3:80858413-80858435 AGGGAGAGCACAGTGATTGAGGG + Intergenic
957965724 3:87320984-87321006 AGGGAGAGTACAGTGATTGTGGG + Intergenic
957976229 3:87448189-87448211 AGGAAGAGTAGAGTGATTTTGGG - Intergenic
958670522 3:97197976-97197998 AGGGAGAGCACGGTGATTGTAGG - Intronic
958682691 3:97352489-97352511 AGAGAGAATGCAGTGACTGTGGG + Intronic
958760055 3:98296223-98296245 AGGGAGAGAACACTGATTGTGGG + Intergenic
959126059 3:102291325-102291347 AAGGAGAGCACAGTGATTGTGGG - Intronic
959191072 3:103112399-103112421 AGGGAGACTGCAGTGACTGGGGG + Intergenic
959306834 3:104677980-104678002 AGGGAGAGTGAAGAGATAGTGGG + Intergenic
959714600 3:109418511-109418533 AGGCTGGGTGCAGTGATTACAGG - Intergenic
959716769 3:109442442-109442464 AGGGAGACTGCAGCAATTGTGGG + Intergenic
959806710 3:110562855-110562877 AAGGAGAATGCAGTGATTGTGGG - Intergenic
959868576 3:111300352-111300374 AAGGAGAGCACAGTGATTGTGGG - Intronic
960404029 3:117238062-117238084 AGGGACAGCACAGTGATTGTGGG + Intergenic
960471947 3:118076375-118076397 AGGGAGAGCATAGTGATTATGGG - Intergenic
960837333 3:121920157-121920179 AGTGACAGTGGAGTGATAATAGG - Intronic
960862915 3:122169500-122169522 AGGGAGAGTGCAGCAATTATGGG - Intergenic
961964544 3:130888635-130888657 AGGGAGAGTGCAGTGGCTAGTGG - Intronic
962483214 3:135815812-135815834 AGGGAGAATGCAGTGATCATGGG + Intergenic
962997976 3:140650720-140650742 AGGGAGAGCAAAGTGATTGTGGG + Intergenic
963154023 3:142077043-142077065 AGGGAGAGCTCAGTGACTGTGGG + Intronic
963430573 3:145196965-145196987 AGGGAGAGTGTGGTGATTGTGGG + Intergenic
963528851 3:146447985-146448007 AGGGAGAACACAGTGATTGTGGG - Intronic
964253588 3:154749446-154749468 AAGGAGAATGCAATGATTATGGG + Intergenic
964259037 3:154812391-154812413 AGGGAGAGCACAGTGATTGTGGG - Intergenic
964349690 3:155790661-155790683 GGGGAGAGTACATTGATTATGGG + Intronic
964583008 3:158260866-158260888 AGGGAAAGTACAGTGATTGTGGG - Intronic
964686664 3:159403487-159403509 AGAGAGAGTGCAGTGATTGAGGG + Intronic
965014673 3:163141148-163141170 AGAGAGAGAGCAGTTATTATTGG - Intergenic
965264052 3:166518184-166518206 AGGGAAAGTGCAGTTACTGTGGG + Intergenic
965379141 3:167966775-167966797 AGGGAAAGCACAGTGATTTTAGG + Intergenic
965844395 3:172945580-172945602 AGGGAGAATACAGTAATTGTGGG + Intronic
966141830 3:176766299-176766321 AAGAAGAGTGCAGGGATTGTGGG + Intergenic
967231685 3:187343554-187343576 TGGGAGAGGGCTGTGATTACAGG + Intergenic
967677360 3:192316458-192316480 AAGGAGAGTACAGTGGTTGTGGG + Intronic
967697061 3:192544177-192544199 AGGGAGAGCACAGTGATTGTGGG - Intronic
968096043 3:195931515-195931537 AGGTAGAGCACAGTGATGATGGG + Intergenic
968096053 3:195931577-195931599 AGGCAGAGCACAGTGATGATGGG + Intergenic
968096064 3:195931639-195931661 AGGTAGAGCACAGTGATGATGGG + Intergenic
968096075 3:195931701-195931723 AGGTAGAGCACAGTGATGATGGG + Intergenic
968096083 3:195931763-195931785 AGGCAGAGCACAGTGATGATAGG + Intergenic
970924604 4:21436505-21436527 AGGGAATGTGTAGTGATTTTTGG - Intronic
970963233 4:21897959-21897981 AGGGAAAGTGCAGTGATTATGGG + Intronic
972125399 4:35758931-35758953 AGGGAGATTGCAGTGATTGTGGG - Intergenic
972253678 4:37331879-37331901 AGGGAGAGTACAGTGATTGTGGG + Intronic
972271200 4:37512035-37512057 AGGGAGAGCACAGTGATTGTGGG - Intronic
972278568 4:37582066-37582088 AGGGAGAGTACAGTGATTTGGGG - Intronic
972579054 4:40379169-40379191 GAGGACAGTGCAGTGATTATGGG + Intergenic
972621467 4:40751263-40751285 AGGGAGAGGGAAATGATCATTGG - Intronic
973006944 4:45020353-45020375 AGGAACAGTGCAGTGAAAATTGG + Intergenic
973287945 4:48440428-48440450 AGGGAGAGCACAGTGACTGTGGG - Intergenic
973348443 4:49082258-49082280 AGGGAAAGTGCAGTGATTGTGGG + Intergenic
973919938 4:55674326-55674348 AAGGAGAGTACAGTGATTGTGGG - Intergenic
975295139 4:72726123-72726145 AGGGAGAGCACAGTGATTGTGGG + Intergenic
976721951 4:88177769-88177791 AGGGAGAGCACAGCGATTATGGG + Intronic
976762888 4:88569267-88569289 AAGGAGAGTGCCGGGATTGTGGG - Intronic
977153275 4:93541413-93541435 AGTGAGAGTTAAGTGATTCTTGG + Intronic
977644389 4:99395645-99395667 AGGGAGAGTGCAGTGATAGTGGG + Intergenic
977913956 4:102570090-102570112 AGAGAGAGTGTGGTGATTACTGG - Intronic
978654252 4:111048211-111048233 AGGGAGAGCACAGTGATTGTGGG + Intergenic
978733686 4:112061326-112061348 AGGGACAGCACAGTGATCATGGG + Intergenic
979184522 4:117772046-117772068 AGGGAGAGTGCAGACATTAAGGG + Intergenic
979565189 4:122146462-122146484 AAGGAGAGTGCAGTGATTGTGGG - Intergenic
979675328 4:123403068-123403090 AAGGAGAGGGCAGTGGTTAAAGG - Exonic
979913240 4:126396966-126396988 AGGGATAGTGCAATGAATATGGG - Intergenic
980646581 4:135651331-135651353 ACAGAGGGTGCAGTGATTGTGGG + Intergenic
980956505 4:139434025-139434047 AGGGAGATCGCAGTGATTGTGGG - Intergenic
981140122 4:141258677-141258699 AGGGAGAACACAGTGATTGTGGG + Intergenic
981286401 4:143024183-143024205 AGGAAGAGTGTAGTGATTGTGGG + Intergenic
981394597 4:144233255-144233277 AGGGACAGTGCATTGATTGAGGG + Intergenic
981871197 4:149487737-149487759 AAGGAGAGTGCAGTGACTAGGGG - Intergenic
981996046 4:150976809-150976831 TGGGAGAGTGCAGCGACTGTGGG + Intronic
982932570 4:161428075-161428097 AAGGAGAGTGCAGTGGTTTTAGG + Intronic
983338182 4:166422024-166422046 AGGGAGAGCACAGTGACTGTGGG - Intergenic
983657851 4:170101030-170101052 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
983772338 4:171567142-171567164 AGGGAGATTGAAGTGGTTTTAGG - Intergenic
984496283 4:180501678-180501700 AGGAAGAATGCAGTGATAGTTGG - Intergenic
986085203 5:4437945-4437967 AGGGAGAGTGCAGTGATTGTGGG - Intergenic
986155912 5:5175813-5175835 AGGGAGAGAACAGCGATCATGGG - Intronic
986548242 5:8923625-8923647 AGGAAGAGTGCAGGGACTGTGGG + Intergenic
986631304 5:9776246-9776268 AGGGAGAGTGCAGTGACTACAGG - Intergenic
987616003 5:20275877-20275899 AGGGAGAGTGCAGTGATTTGGGG + Intronic
987645777 5:20671244-20671266 AGGGAGAGTGAAGTGACTGTGGG + Intergenic
987886184 5:23815904-23815926 AGGGAGAGTAAAGTGAGTGTGGG + Intergenic
987903779 5:24050028-24050050 AGGGAGAGTGGGGTGATTGTGGG + Intronic
989127926 5:38074874-38074896 AAGAAGAGTTCAGTGAATATTGG - Intergenic
989244714 5:39241561-39241583 AGGGGGAGTGCAGTCAACATAGG + Intronic
990827817 5:59922044-59922066 AGGGAGAGTGCAGCGACTGGGGG + Intronic
990982008 5:61610534-61610556 AGTGTCAGTGCAGTGTTTATGGG + Intergenic
991209249 5:64085212-64085234 AGGGAGAGTGCAGTGACTGTGGG - Intergenic
991395410 5:66199280-66199302 AGGGAGAGTACAGCAATTGTGGG - Intergenic
992531913 5:77660116-77660138 AGGGAAAGTGCAGTGATTGTGGG - Intergenic
992934418 5:81687191-81687213 AGGGAGAGCACAGTGACTGTGGG + Intronic
993060168 5:83029486-83029508 GGGGAGAGTGCAGTGATTGTGGG + Intergenic
993138253 5:83997828-83997850 AGGGAGAATGAAGTGATTGTGGG + Intronic
993230273 5:85226568-85226590 AGGGAGAGTGAAGTGAATGTGGG - Intergenic
993279264 5:85904750-85904772 AGGGAAAGTGCAGTGACTGAGGG + Intergenic
993932315 5:93954957-93954979 AGGGAGAGCACAGTGACTGTGGG - Intronic
994213159 5:97108543-97108565 AGGGACAGTCCAGTACTTATGGG - Intronic
994217974 5:97159917-97159939 ATGAAGAGTGCAGTGACTGTGGG - Intronic
994320334 5:98387314-98387336 AGGGGAAGTGCAGTGATTGTGGG - Intergenic
994533644 5:100999667-100999689 AGGGAGAGTGAAGTGAGTGTGGG + Intergenic
995015964 5:107309270-107309292 ACGGTGAGAGCAGTGATGATGGG - Intergenic
995241122 5:109885984-109886006 AGGGAGAGTGGAGAGACGATGGG + Intergenic
995268742 5:110195729-110195751 AGGAAGAGTGCAGTGATTGTGGG - Intergenic
995310695 5:110707348-110707370 AGGGAGAGTGCAGTAACTGCAGG + Intronic
995573286 5:113503636-113503658 AGGGAGAGTGCAGTGATAGTGGG - Intergenic
995697908 5:114900389-114900411 AGGAAGAGTGTTGTGATTGTGGG - Intergenic
995720489 5:115127133-115127155 AGGGAGCGGGCAGTGATAACTGG + Intronic
996375527 5:122802684-122802706 AGGGACACTGCAATGATTAAAGG + Intronic
996653715 5:125913992-125914014 AGGAAGAGCTCAGTGATTGTGGG - Intergenic
997437824 5:133887703-133887725 AGGGACAGTCCAGTGACTGTGGG + Intergenic
997508752 5:134438662-134438684 AGGGAAAGTGATGTGATTAGAGG + Intergenic
999253281 5:150195234-150195256 ACTGAAAGTGCAGTGATCATCGG - Intronic
999559448 5:152785117-152785139 AGGGAGAGTGCACTGACTGTGGG + Intergenic
1000063371 5:157675247-157675269 AGGGAGAATGAAATGAATATGGG - Intronic
1001278311 5:170366865-170366887 GGGGAGAGTGCAGAGATGAAGGG - Intronic
1002022265 5:176371440-176371462 AGGGAGAGAGCATTGAGTTTAGG + Intronic
1002097218 5:176838673-176838695 AGGGAGAGTGTAGAGATGTTAGG - Intronic
1006126512 6:31842220-31842242 AGTGAAAGTGCTGTGATTCTAGG + Intergenic
1006938840 6:37738012-37738034 AGGGAGAGGGGAGTGAGTACAGG + Intergenic
1007001767 6:38320078-38320100 GGGGAGAGTGCTGCGATTGTGGG - Intronic
1007021743 6:38528117-38528139 AGGCAGAGTGTAGTGACTGTGGG + Intronic
1007267166 6:40605378-40605400 AGGGAGAGTGCAGCTATTGATGG - Intergenic
1007299390 6:40855455-40855477 AGGAAGAGTGCTGTGGTGATGGG + Intergenic
1008238792 6:49083692-49083714 ATGAAGAGTGCAGTGATGGTGGG + Intergenic
1008304633 6:49886448-49886470 AGAGAGAGTGCATTGATCACGGG - Intergenic
1009039463 6:58159102-58159124 AGGCAGAATGCAGTGATTATGGG - Intergenic
1009215355 6:60913942-60913964 AGGCAGAATGCAGTGATTATGGG - Intergenic
1009728137 6:67560547-67560569 AGGGAGAGCAAAGTGATTGTGGG - Intergenic
1009781674 6:68279682-68279704 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
1009823750 6:68839901-68839923 AGGGAGAGCACAGTGATTGTGGG + Intronic
1009978786 6:70701664-70701686 AGGGAGAACGCAGTGATTGTGGG - Intronic
1010062272 6:71636478-71636500 AGGGAGAGCACAGTGATTGTGGG - Intergenic
1010088792 6:71953617-71953639 AGGGAAAGTACAGTGGTAATGGG - Intronic
1010557815 6:77306526-77306548 AGTGAGAGTGCAGGAATTGTGGG - Intergenic
1011018857 6:82788606-82788628 AGGGAGAGTGCAGAGCTTGTCGG + Intergenic
1011479046 6:87776128-87776150 AGGGAAAGTGCAGTGTGTTTAGG + Intergenic
1011970912 6:93221334-93221356 AGGGAGATGGCAGTGAGTGTAGG - Intergenic
1012047724 6:94300403-94300425 AGGGAAAGTGCAGTTATTGTGGG + Intergenic
1012827233 6:104162173-104162195 AGGGAGAACGCAGTGACCATGGG + Intergenic
1013908450 6:115245936-115245958 AGGAAGAGTACAGCGATTGTGGG + Intergenic
1014378651 6:120711156-120711178 ACGGAGAGTCCACTGATTGTGGG + Intergenic
1015392788 6:132701848-132701870 AAGGAAAGTACAGTGATTGTGGG + Intronic
1015460595 6:133487086-133487108 AGGGAGAGCTCAGTGAGTGTAGG + Intronic
1015578934 6:134702470-134702492 AGAGAGAGTGCAGTGACTGTGGG - Intergenic
1015907173 6:138129277-138129299 AGGGAGAGCGCAGTAGTTTTGGG + Intergenic
1016054843 6:139567520-139567542 AGGAAGAGCACAGTGATTGTGGG - Intergenic
1016457463 6:144245762-144245784 AGGGAGAGCACAGTGATTGTGGG - Intergenic
1017650389 6:156576169-156576191 GGGGAGAGTGAAGTGAGTGTGGG + Intergenic
1017823728 6:158066633-158066655 AGGGTGAGGGCAGTGACTTTGGG + Exonic
1019381342 7:725953-725975 AGGGAGAGGGCAGTGCTTATTGG - Intronic
1019592112 7:1840845-1840867 AGGGAGTGTGCAGTGACATTGGG - Intronic
1020574935 7:9913997-9914019 AGGGAGAGTGTAGTGATTGTGGG - Intergenic
1021022889 7:15625667-15625689 ATGGACAGTGCAGTTATGATTGG - Intronic
1021045028 7:15912301-15912323 AGGGAAAATGCATTGATTAATGG + Intergenic
1021123629 7:16825635-16825657 AGGGAGAATGCAGTGATTATGGG + Intronic
1021214740 7:17901609-17901631 AGGGAGAGCACAGTGATTATGGG - Intronic
1021884984 7:25129436-25129458 AGGGACAGGGCAGTGATTGCAGG - Intergenic
1022223700 7:28340921-28340943 AGAGACAGCACAGTGATTATGGG - Intronic
1022482453 7:30752860-30752882 ATGGGGAGGGCAGTGATCATCGG - Intronic
1022542094 7:31146833-31146855 AGGGAGAGCACAGTGATTGTGGG - Intergenic
1023646163 7:42318271-42318293 AGGGAGAGTGCAGTGGTTGTGGG + Intergenic
1023998149 7:45174560-45174582 AGGGATGGTGCAGTGGCTATAGG - Intronic
1025061536 7:55812848-55812870 AGGGAGAGTGAAGTGATTGTGGG + Intronic
1025185760 7:56857029-56857051 TGGGAAAGTGCTGGGATTATTGG - Intergenic
1025686169 7:63719915-63719937 TGGGAAAGTGCTGGGATTATTGG + Intergenic
1025767486 7:64469059-64469081 TCCGAGAGTGCTGTGATTATAGG + Intergenic
1026189520 7:68112133-68112155 AGAGAGGGAGCTGTGATTATGGG - Intergenic
1027523955 7:79244451-79244473 AGGGAGAGTGCAGTGATTGTGGG + Intronic
1027826101 7:83118544-83118566 AGGGAGAGCAAAGTGATTGTAGG + Intronic
1027934456 7:84585552-84585574 TGGAAGAGTGCAGGGATTAAGGG + Intergenic
1028266700 7:88734305-88734327 AGGAAGACTGTAGTGATTATGGG - Intergenic
1028341616 7:89728732-89728754 AGGGCGACTGCAGTAACTATAGG - Intergenic
1028929664 7:96398414-96398436 AGGGAGAATGCAGTGATTGTGGG - Intergenic
1028972468 7:96874792-96874814 AGAGAGAGTGCAGTGATTGTGGG + Intergenic
1029042610 7:97593395-97593417 AGGGAGAGTGCAGTGGCTGTGGG - Intergenic
1029367311 7:100124933-100124955 AGGGAGAGTGCAGGCTTTAGAGG - Exonic
1030662620 7:112238247-112238269 AGGGAGAGCGCAGTAATTGTGGG + Intronic
1031009409 7:116509910-116509932 AGAAAGATGGCAGTGATTATGGG - Intergenic
1031272164 7:119665715-119665737 AGGGAAGGTGCAGTGATTGTGGG + Intergenic
1031306148 7:120130320-120130342 AAGGAGAGTGCAGTAATTTTGGG + Intergenic
1031412599 7:121457440-121457462 AGGGAGAATGCTGTGACTGTGGG - Intergenic
1031565838 7:123296173-123296195 AGGGAGAGTAAAGTGATGATGGG + Intergenic
1031721809 7:125186645-125186667 AGAGAGAGCACAGTGATTGTGGG + Intergenic
1031732541 7:125316384-125316406 AGGGAGAGTACAGAGATTTTGGG + Intergenic
1031753665 7:125611459-125611481 AGAGAGAGTGCAGTGATTATGGG + Intergenic
1032716691 7:134514768-134514790 GGGGAGTGTGGACTGATTATGGG + Intergenic
1033502514 7:141966088-141966110 AAGGAGAGTGCAGTGATTGAGGG - Intronic
1033542474 7:142369605-142369627 AGGGAGAGTGCAGTGACTGTGGG - Intergenic
1033877773 7:145843225-145843247 AGGGAGAGTGCAGTGATTGTGGG - Intergenic
1034126286 7:148674826-148674848 AGGGAGAGCACAGTGATTGTGGG + Intergenic
1034581920 7:152050925-152050947 AGGGAGAGGGCAGGGATTGTAGG - Intronic
1034847914 7:154464261-154464283 AGGGAGAATGCAGTGACTGTGGG - Intronic
1035147372 7:156833024-156833046 AGGTAGAATGCACTGTTTATTGG + Intronic
1036522561 8:9505496-9505518 AGGGAGAGGCCAGTAATTTTAGG - Intergenic
1038754546 8:30328392-30328414 AGGGAAAGTGCAGAGATCCTAGG - Intergenic
1039211605 8:35222202-35222224 AGGGAGAGCACAGTGAATAAAGG - Intergenic
1041744881 8:61197878-61197900 AGGGAGAGAACAGTGACTATAGG - Intronic
1041852353 8:62405565-62405587 ACGGAGAGAGCAGTGATTATGGG - Intronic
1041979915 8:63845896-63845918 AGGGAAAGTCCAGTGATAACGGG + Intergenic
1043079972 8:75754838-75754860 AGGGAGAGTGCAGTGACTATGGG + Intergenic
1043847474 8:85178595-85178617 AGGGGATTTGCAGTGATTATTGG - Intronic
1044124165 8:88437342-88437364 AGGGAGAGCCCAGCGATTCTGGG + Intergenic
1044497327 8:92902383-92902405 AGGGAGAGTGCAGTGATTGTGGG - Intronic
1044635550 8:94320205-94320227 AGGGAGAGCACAGTGATTGCAGG - Intergenic
1044639448 8:94363153-94363175 AGGCAGGGTGCAGTGATTTTTGG + Intergenic
1044949830 8:97424964-97424986 AGGGTCAGTGCAGTGATTAAGGG + Intergenic
1044987900 8:97771157-97771179 AAGGAGAGTTCAGAGATTAGAGG + Intergenic
1045172659 8:99687634-99687656 CGGGAGAGAGTAGTGATTGTGGG - Intronic
1045599095 8:103693185-103693207 AGGGAGAGTTTAGTAATTGTGGG - Intronic
1045724774 8:105159609-105159631 AGGGAGATTTCAGTGATGAAAGG - Intronic
1046215617 8:111141604-111141626 AGAGAGAGTGAAGTGATTATAGG - Intergenic
1046811542 8:118538558-118538580 AGGGAGAGCACAGTGATTGTGGG - Intronic
1047883358 8:129220516-129220538 TGTGGGGGTGCAGTGATTATGGG + Intergenic
1048118673 8:131554819-131554841 AGGGAGAGCACAGTGACTGTGGG + Intergenic
1049279561 8:141737405-141737427 AGGGAGAGTGCAGGAATGAAAGG - Intergenic
1050760980 9:9070707-9070729 TGCCAAAGTGCAGTGATTATAGG - Intronic
1051039219 9:12785665-12785687 AGGGAGAATACAGTGATTATGGG - Intronic
1051229920 9:14945379-14945401 AAAGAGAAAGCAGTGATTATGGG + Intergenic
1051306618 9:15717181-15717203 AGGGAGAGCACAGTGATTGTGGG + Intronic
1051345609 9:16148094-16148116 AGGGAGAGTGCAGTGGGTGGGGG + Intergenic
1051464941 9:17367190-17367212 AGGGAGAATGCAGTGACTGTTGG + Intronic
1052093881 9:24361733-24361755 AGGGAGAGCACAGTGATTGTGGG + Intergenic
1052642915 9:31192433-31192455 AGGAAAAGTGCAGGTATTATGGG + Intergenic
1052938801 9:34115634-34115656 GGGGAGACTGCAGAGACTATAGG - Intronic
1054982462 9:71222757-71222779 AGGCAGAGCACAGTGATTGTGGG + Intronic
1056230693 9:84539728-84539750 AGGGAGAACACAGTGATTGTGGG - Intergenic
1056278960 9:85021099-85021121 AGGAAGAGAGCAATTATTATAGG - Intronic
1056516665 9:87358799-87358821 AGAGAAAGTGCAGTGACTGTGGG + Intergenic
1057241226 9:93411776-93411798 AGAGAAAGTGCAGTGATTGTGGG - Intergenic
1057289186 9:93789614-93789636 AGAGAGAGTTCAGTGATTATGGG - Intergenic
1058285363 9:103170065-103170087 AGGGAGAGGGCAGTGACTGTGGG - Intergenic
1058754960 9:108075711-108075733 AGGGAGACAGCATTGATTCTGGG + Intergenic
1059555600 9:115277131-115277153 AGGGAGAGTGCAGTGATTGTGGG - Intronic
1059838968 9:118191200-118191222 AGAGAGAGTACAGTGATTGTGGG + Intergenic
1059886566 9:118751080-118751102 AGGGACAGCACAGTGATTGTGGG + Intergenic
1060304380 9:122397773-122397795 AGGGAGAGTGTAGTGGTTGTAGG + Intergenic
1061570625 9:131475641-131475663 AGGGCGACTGCAGAGATTCTTGG + Exonic
1186985654 X:15011097-15011119 AGGGAAAGAGAAGTAATTATGGG + Intergenic
1187208262 X:17203511-17203533 AGGGAGAGTGCACTATTTATTGG + Intergenic
1187723890 X:22182388-22182410 AAGGAGAGTACGGTGATTGTGGG - Intronic
1188162001 X:26815412-26815434 AGGGAGAGTGCAGTGATTGTAGG - Intergenic
1188651420 X:32635146-32635168 AGGGAGATTGCAGTGATTATAGG - Intronic
1188715521 X:33455711-33455733 AGGGAGAGTGCAGCAATTCTGGG + Intergenic
1188864549 X:35299450-35299472 ACGGAGAGCACAGTGATTGTAGG + Intergenic
1188972404 X:36633562-36633584 AGGGAGAGCACAGTGATTATGGG - Intergenic
1189271008 X:39751939-39751961 AGGGAGAGAGCTTTGATTCTTGG - Intergenic
1189628051 X:42920737-42920759 AGGGAGAGCACAGTGATCGTGGG + Intergenic
1189640650 X:43067449-43067471 AAGGAAAGTGTAGTGATTGTGGG + Intergenic
1189928962 X:45987563-45987585 AGGGAGAGTGGACTGATTTAAGG - Intergenic
1190224236 X:48533335-48533357 AGAGTGAGTGAAGTGATTAGGGG - Intergenic
1190498451 X:51051566-51051588 AAAGAGAGTAAAGTGATTATGGG + Intergenic
1190894937 X:54608139-54608161 AGGGGGAGTGCTGTGTGTATTGG + Intergenic
1192046107 X:67675597-67675619 AGGAAGATTGCAGTGACTGTGGG - Intronic
1192069528 X:67922544-67922566 AGAGAGAGTGTAGTGGTTGTGGG + Intergenic
1192374756 X:70548603-70548625 AGGGAGAGCACAGTGATTGTGGG + Intronic
1192793302 X:74405735-74405757 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
1192843385 X:74880829-74880851 AAGGAGAGAGCAGTGTATATGGG - Intronic
1192875348 X:75223645-75223667 AGGGAAACTGCAGTGATTGTGGG - Intergenic
1193052535 X:77116265-77116287 AGGGAGAGTGCAGCAATTGTGGG - Intergenic
1193098221 X:77578040-77578062 AAGGAGAGTGCAGTGATCATAGG + Intronic
1193675981 X:84453416-84453438 AAGGAGAGTACAGTGATTGTGGG + Intronic
1193896935 X:87126496-87126518 AGGGAGAGTGCAGTGATTATGGG + Intergenic
1194251820 X:91585354-91585376 AGGGAGAGTGCAGAAATTGTGGG + Intergenic
1194388930 X:93292459-93292481 AGGGAGAATGCAGTGACTGGGGG + Intergenic
1194526369 X:94982843-94982865 TGGGAAAGTGCAGTGACTGTGGG + Intergenic
1194665539 X:96673699-96673721 AAGGAGAGTGTAGAGTTTATGGG - Intergenic
1195037259 X:100981373-100981395 AGAGAGAGTGCAGTGATTGTAGG - Intronic
1195039590 X:101002008-101002030 AGGGAGACTCCAGTGGTGATGGG + Intergenic
1195290155 X:103424428-103424450 AGGGAGAGCACAGTGATTGTGGG - Intergenic
1195396040 X:104411667-104411689 GGAGAGAGTGCAGTCATCATTGG + Intergenic
1195489469 X:105450215-105450237 AGGGCGAGTGCAGTGACTTGGGG - Intronic
1195595331 X:106682705-106682727 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
1195601225 X:106751277-106751299 AAGGAGAGCACAGTGATTGTGGG + Intronic
1196215746 X:113050049-113050071 AGGGAGAATGCAGCAATTGTGGG + Intergenic
1196217702 X:113072668-113072690 AGGGAGAGCTCAGTGATTGTGGG - Intergenic
1196357470 X:114810559-114810581 AGGGAGAATGCAGTGACTGTGGG - Intronic
1196368742 X:114951974-114951996 AGGGAGAGCAAAGTGATTGTGGG + Intergenic
1197011478 X:121569974-121569996 AGGGAAAGTACAATGATTGTGGG + Intergenic
1197024871 X:121737159-121737181 AGAGAGAGTGTAGTGATTGTGGG + Intergenic
1197030595 X:121809192-121809214 AGGGACAGTGAAGTGAATGTGGG - Intergenic
1197099676 X:122637407-122637429 AGGGAGAGCGCAGTGACTGTGGG - Intergenic
1197177965 X:123504780-123504802 AGGGAGAGCACAGTGATTTGGGG + Intergenic
1197670702 X:129273798-129273820 AGGGAAAGCACAGTGATTGTGGG - Intergenic
1197953034 X:131918400-131918422 AGGGAGAGTGCAGCAACTGTGGG + Intergenic
1198274123 X:135085525-135085547 AGGGAGAGTGTAGTTATAGTGGG - Intergenic
1198435020 X:136608803-136608825 AGGAAGAGTGGTGTGAATATGGG + Intergenic
1198770683 X:140126903-140126925 AGGGAGAGTGTAGTGACTAGGGG - Intergenic
1198947674 X:142032232-142032254 AGGGAGAATGCAGTGATTGTAGG - Intergenic
1198964946 X:142217431-142217453 AGGGAGATTCCAGTGATGGTAGG + Intergenic
1199325091 X:146489933-146489955 AGGGAGAGTACAGTGACTGAGGG + Intergenic
1199457509 X:148045030-148045052 AGGGAGAGCACAGTGGTTGTGGG - Intergenic
1199464453 X:148120315-148120337 AGGGAGAGCAAAGTGATTGTGGG + Intergenic
1199962820 X:152791773-152791795 AGAGAGAGGGCAGTGATTGTGGG + Intergenic
1200570754 Y:4826585-4826607 AGGGAGAGTGCAGAAATTGTGGG + Intergenic