ID: 1085572868

View in Genome Browser
Species Human (GRCh38)
Location 11:77574348-77574370
Sequence GCCTCCGGAGTGACCAGAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 152
Summary {0: 1, 1: 3, 2: 12, 3: 24, 4: 112}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085572868_1085572873 8 Left 1085572868 11:77574348-77574370 CCTGTTCTGGTCACTCCGGAGGC 0: 1
1: 3
2: 12
3: 24
4: 112
Right 1085572873 11:77574379-77574401 CTACGCATGGCTGAAGTTTGAGG 0: 1
1: 1
2: 15
3: 50
4: 123
1085572868_1085572870 -5 Left 1085572868 11:77574348-77574370 CCTGTTCTGGTCACTCCGGAGGC 0: 1
1: 3
2: 12
3: 24
4: 112
Right 1085572870 11:77574366-77574388 GAGGCTAACCAGCCTACGCATGG 0: 1
1: 0
2: 1
3: 13
4: 100

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085572868 Original CRISPR GCCTCCGGAGTGACCAGAAC AGG (reversed) Intronic
900289607 1:1918352-1918374 GCTTCCGGAGGCAGCAGAACCGG + Exonic
901987766 1:13089755-13089777 GCTTCTGGAGTGACCAGAGCAGG - Intergenic
901994046 1:13137012-13137034 GCTTCTGGAGTGACCAGAGCAGG + Intergenic
902990812 1:20186033-20186055 GCTTCCGGCGTGACCGGAACCGG - Intergenic
904005774 1:27362469-27362491 GGCTCCTGAGGGCCCAGAACAGG + Intronic
904710213 1:32424674-32424696 GCCTCCAGAGTCATCAGAAGAGG - Intergenic
905046519 1:35007682-35007704 GCCTCCCGAGTAACCAGGAGAGG - Intronic
905061419 1:35142874-35142896 GCCTCCGGAGTGACCAGAGCAGG + Intergenic
905462414 1:38130310-38130332 GCCCCTGGAGGGCCCAGAACAGG + Intergenic
906201473 1:43963298-43963320 GCCTCAGGAATGATCAGAACTGG + Intronic
907326344 1:53640956-53640978 GCCTCTGGAGGGAACAGAACCGG + Intronic
910592317 1:88939457-88939479 GCCTCCAGAGGGGCCAGAAGAGG - Intronic
914690419 1:150020931-150020953 GCCCCAGCAGAGACCAGAACAGG - Intergenic
916166908 1:161972905-161972927 TCCTTCTGTGTGACCAGAACTGG + Intergenic
918735278 1:188054071-188054093 GACACCGGAGTGGGCAGAACAGG - Intergenic
918753711 1:188308082-188308104 GCCACCGGGGAGAGCAGAACAGG - Intergenic
921045186 1:211471483-211471505 TCCTCTGGAGTGTCCAGACCTGG - Intergenic
921433691 1:215091733-215091755 GCCTCCTTAGTGACCATATCTGG - Intronic
1064735103 10:18374218-18374240 GCCTCTGAAGTTTCCAGAACAGG + Intronic
1067133240 10:43585268-43585290 GCTTCCGGAGTGACCACAGCAGG + Intergenic
1070599104 10:77853501-77853523 GGCTCCTGAGTGACCAGACTCGG - Exonic
1072059933 10:91799418-91799440 GTTTCTGGAGTGACTAGAACGGG + Intronic
1073069753 10:100785839-100785861 GCCTCTGGAGTGAGCACAGCAGG + Intronic
1074308335 10:112299511-112299533 GCCTCCTGCGAGACCAGACCGGG + Exonic
1075304805 10:121358416-121358438 GCCTGAGCAGTGACCATAACAGG - Intergenic
1082960992 11:58918766-58918788 GCTTCCAGAGTGACTAGAGCAGG + Intronic
1084390363 11:68871674-68871696 GCCTCCAGAGTGACTAGAGCAGG - Intergenic
1085010506 11:73137784-73137806 ACGTCCCGAGTGACCAGAGCAGG + Intronic
1085572868 11:77574348-77574370 GCCTCCGGAGTGACCAGAACAGG - Intronic
1089577992 11:119460272-119460294 CCTTCGGGAGTGACCAGACCTGG - Intergenic
1104981991 12:132577293-132577315 GCCTCTGGTGGGGCCAGAACAGG - Intronic
1105957987 13:25301825-25301847 GCCGCCGGCGGGACCAGCACAGG + Exonic
1112367496 13:98767831-98767853 GCTTCCAGAGTGACCAGAGCAGG - Intergenic
1113560161 13:111272404-111272426 GGCTCCTGTGAGACCAGAACCGG + Intronic
1114574136 14:23696994-23697016 GCCTCTGGAGTGACCAGAGCAGG - Intergenic
1118951388 14:70439439-70439461 GCTTCTGGAGTGACCAGAGCAGG + Intergenic
1122983769 14:105203047-105203069 GCCTCCGGATTCACCAGATGGGG + Intergenic
1128600652 15:68992877-68992899 GCTTTCGGAGTGACCAGAGCAGG + Intronic
1128976239 15:72155876-72155898 GCCTTCCGAGTGGCCAGAGCTGG + Intergenic
1129061871 15:72866955-72866977 TCCTCCAGAGTGGCCAGCACTGG - Intergenic
1132617450 16:848781-848803 GTCTCTGGAATGTCCAGAACAGG - Intergenic
1132807812 16:1783127-1783149 GCCTCCGGTGCGACCATCACCGG + Intronic
1134809532 16:17155536-17155558 CCCTCCCAAGTGACCAGAGCTGG - Intronic
1137614788 16:49839672-49839694 GCCTCCAGAGAGAACAGAGCCGG + Intronic
1141731854 16:85828316-85828338 GCCTCGGGAGTGACCTGCACAGG + Intergenic
1143148034 17:4789320-4789342 GCTCCAGGAGGGACCAGAACAGG + Intronic
1145902125 17:28496086-28496108 ACCTCAGGAATGACCAGAACAGG - Intronic
1146223836 17:31049311-31049333 GCCTCCAGAGTCATCAGAAGAGG - Intergenic
1148446253 17:47739368-47739390 GCCTCCCGAGTCACCCGAGCGGG - Intronic
1149655369 17:58306994-58307016 GCATAGGGAGTGAGCAGAACTGG - Intronic
1150217003 17:63476679-63476701 GCCTCCGGAGTGACAAGGCCGGG - Intergenic
1151882956 17:76905864-76905886 GGCACCAGAGTGACCAGATCGGG - Intronic
1152666052 17:81570302-81570324 GCCTCCTGGGTGCCCAGCACGGG + Intronic
1152836778 17:82538362-82538384 GCCTCCCAAGTGTCCAGGACTGG - Intronic
1152858461 17:82680108-82680130 GCCTCCGGTCTGAGCAGGACGGG - Intronic
1154108590 18:11546994-11547016 GCCTCCTGATTGGCCAGAGCAGG + Intergenic
1160714061 19:567493-567515 GCTTCCGGGGTGACTAGAGCAGG + Intergenic
1161260604 19:3335781-3335803 GCCACCGGTGTGACCAGACCAGG + Intergenic
1163953795 19:20615196-20615218 GCCTCTGGAGTGACCAGAGCAGG - Intronic
1164017081 19:21262678-21262700 GCCTCCAGAGTGGTCAGAGCAGG - Intronic
1164033596 19:21433819-21433841 GCTTCCAGAATGACCAGAGCAGG + Intronic
1164142573 19:22486311-22486333 GCTTCCGAAGTGACCAGAGCAGG + Intronic
1164148598 19:22529186-22529208 GCCTCCGGAGTGACCAGGGCAGG - Intronic
1164286101 19:23819219-23819241 GCTTCTGGGGTGACTAGAACAGG + Intronic
1164286107 19:23819283-23819305 GCTTCTGAAGTGACCAGAGCAGG + Intronic
1167904622 19:52648801-52648823 GACTCCGTAGTGACTAGAGCAGG - Intronic
1167999802 19:53436020-53436042 GCCTCCAGAGTGACCAGAGCAGG + Intronic
1168004236 19:53473397-53473419 GCCTCCAGAGTGACCAGAGCAGG + Intronic
930316010 2:49797766-49797788 TCTTCCAGAGTGCCCAGAACTGG - Intergenic
931756409 2:65378590-65378612 ACCTCACTAGTGACCAGAACAGG + Intronic
933978769 2:87533607-87533629 ACAGCCAGAGTGACCAGAACTGG + Intergenic
934474918 2:94587445-94587467 GCCTCCTCAGTGCCCAGATCTGG + Intergenic
934767659 2:96889053-96889075 GCCCCCGCAGGGACCATAACAGG + Intronic
935414359 2:102799890-102799912 GCCTCGGGAGAGAACAGGACTGG + Intronic
936315061 2:111417199-111417221 ACAGCCAGAGTGACCAGAACTGG - Intergenic
937662527 2:124446804-124446826 GCCTCCTGGATGACCAGCACTGG + Exonic
940109076 2:150130667-150130689 GCTTCCAGAGCGACAAGAACTGG + Intergenic
946713860 2:222533215-222533237 GCCTCAGGAGGGACCAGAAGAGG + Intronic
1168781499 20:495161-495183 GCCTCCCCAGAGACCACAACAGG + Intronic
1169758573 20:9068281-9068303 GGCTCAGGACTGGCCAGAACGGG - Intergenic
1171003201 20:21435747-21435769 GTCTCCGGAGAGAGCAGAGCAGG + Intergenic
1172614048 20:36271936-36271958 GTCTCCTGATTGACCAGCACAGG + Intergenic
1172802292 20:37584671-37584693 GCTTCCGGAATGACCAGGATGGG + Intergenic
1174397093 20:50253425-50253447 AACTCCGGTGTGAGCAGAACGGG + Intergenic
1176024018 20:62976754-62976776 GCCTCCGGAGGAACCAGTCCTGG - Intergenic
1179086823 21:38225723-38225745 GCTTCTGGAGTGACCAGAGCAGG + Intronic
1182473864 22:30565171-30565193 GCCTGCAGAGAGCCCAGAACAGG + Intronic
1182829769 22:33295574-33295596 GCCTCCAGAGTGAGCAGCACAGG - Intronic
1184733107 22:46381791-46381813 GCCTCAGGAGCCTCCAGAACGGG + Intronic
1185408466 22:50671033-50671055 GCCTGCGGGGTGAGCAGCACAGG + Intergenic
950189704 3:10968117-10968139 GCCCCCAGGGTGTCCAGAACAGG + Intergenic
956444163 3:69309249-69309271 GCCTCCTGAGTGGCTAGGACTGG + Intronic
959871669 3:111335761-111335783 GCCTCCAAAGTTACCAGAATAGG - Intronic
959961921 3:112307054-112307076 GCCTCCGGAGTGGCCACAGCAGG - Intergenic
961715654 3:128855752-128855774 GCTTCTGGAGTCACCAGAGCAGG + Intergenic
963752862 3:149201242-149201264 GCCTCCAGAGTAACTAGGACAGG + Intronic
965923272 3:173945371-173945393 GCCTCTGGAGTGTGCAGAGCTGG + Intronic
967217126 3:187220227-187220249 GCCTCCAGAGTCACCCGCACAGG + Intronic
969385618 4:6844935-6844957 GCCTCACGAGAGACCTGAACTGG + Intronic
969647242 4:8438909-8438931 GCCTCCGGAGTGACCAGAGCAGG - Intronic
972105695 4:35482975-35482997 GACTCTGGAGTCACCAGACCAGG + Intergenic
972480185 4:39489304-39489326 GCTTCTGGAGTGACTAGAGCAGG - Intergenic
974976549 4:68901219-68901241 GCTTCCGGAGTGACCAGAATAGG + Intergenic
977945227 4:102905339-102905361 GCCTCCTGAGTAGCCAGGACTGG + Intronic
979058031 4:116018946-116018968 GCTTCCAGAGTTACCAGAGCAGG - Intergenic
979058036 4:116019010-116019032 GCTTCCGGGGTGACTAGAGCAGG - Intergenic
980333647 4:131440997-131441019 TCCTCCCCAGTGACCAGAAATGG + Intergenic
998135385 5:139671602-139671624 GCCTCCGCAGGAAGCAGAACGGG - Intronic
1003986029 6:11436168-11436190 GCCCCTGGAGTGAGCAGAAGGGG - Intergenic
1004503311 6:16227755-16227777 GCCTCCGGAGTGAGCAGAGCAGG + Intergenic
1006037773 6:31227315-31227337 GCCTCTGGAGTGACCAGAGCAGG + Intergenic
1008583346 6:52926068-52926090 GCCTCCAGAGTGACCAGAGCAGG - Intergenic
1008813075 6:55528840-55528862 GTCTCAAGAGTGACCAAAACAGG + Intronic
1011299977 6:85863760-85863782 GCCTCCGGAGTGACCAGAGCAGG + Intergenic
1018888618 6:167963980-167964002 GGCTCCGGCGTGGCCAGGACTGG - Exonic
1019811685 7:3169588-3169610 GCCTCCTGAGTACCTAGAACAGG - Intronic
1022896778 7:34758001-34758023 TCCTCTGGAATGACCATAACTGG + Intronic
1023871708 7:44266763-44266785 GCCTCCTGAGTGGCCAGCCCTGG + Intronic
1025823542 7:64993250-64993272 GCTTCCGGAGTGACCAGAGCAGG + Exonic
1032783168 7:135180336-135180358 GCCTCCAGAGTGATCACAGCAGG - Intergenic
1033365065 7:140666710-140666732 GCTTCCGGAGTGACCAGAGCAGG - Intronic
1040545176 8:48393372-48393394 GCTTCCCGTGTGCCCAGAACTGG + Intergenic
1041008753 8:53521221-53521243 GCCTCCAGAGTAACCAGAGCAGG + Intergenic
1042117746 8:65450602-65450624 GACTCCTGACTGACCAGAAATGG + Intergenic
1043284364 8:78511381-78511403 CCCTACGGAGTGACGAGAACAGG + Intergenic
1049010441 8:139883817-139883839 GGCTCCAGAGTGAGCAGAGCCGG - Intronic
1049606694 8:143532900-143532922 GCCGCCTGAGTGACCAGGCCAGG + Intronic
1052654243 9:31335061-31335083 GCCTCAGGAGGGCCCAGAAAAGG + Intergenic
1053683155 9:40498656-40498678 GCCTCCTCAGTGCCCAGATCTGG - Intergenic
1053933133 9:43126972-43126994 GCCTCCTCAGTGCCCAGATCTGG - Intergenic
1054280559 9:63126272-63126294 GCCTCCTCAGTGCCCAGATCTGG + Intergenic
1054296256 9:63334154-63334176 GCCTCCTCAGTGCCCAGATCTGG - Intergenic
1054394272 9:64638659-64638681 GCCTCCTCAGTGCCCAGATCTGG - Intergenic
1054428922 9:65143858-65143880 GCCTCCTCAGTGCCCAGATCTGG - Intergenic
1054501458 9:65877677-65877699 GCCTCCTCAGTGCCCAGATCTGG + Intronic
1061068198 9:128292288-128292310 GCCACCAGAGTGACCACAGCAGG + Intergenic
1061794602 9:133078649-133078671 GCCTCACGAGTGACCAGAGCAGG + Intronic
1062392827 9:136340751-136340773 ACCTTCTGAGTGACCTGAACTGG - Intronic
1062721409 9:138046182-138046204 GACACAGGGGTGACCAGAACAGG - Intronic
1191755514 X:64588340-64588362 GCCTTCGGAGAGACCAGTCCTGG - Intergenic
1192636402 X:72823720-72823742 GCCACCAGAGGGAACAGAACAGG - Intronic
1192645312 X:72897094-72897116 GCCACCAGAGGGAACAGAACAGG + Intronic
1194090813 X:89580751-89580773 GCTTCCGGACTGACCAGAGCAGG + Intergenic
1195368546 X:104150371-104150393 TCCTCCAGAGTGATCAGCACTGG - Intronic
1196867399 X:120082805-120082827 GCCTCCGGTGTGGTCAGAGCAGG + Intergenic
1196875700 X:120153477-120153499 GCCTCCGGTGTGGTCAGAGCAGG - Intergenic
1198469416 X:136932367-136932389 GCCTCTGGAGTGACCAGAGCAGG + Intergenic
1200443465 Y:3236811-3236833 GCTTCCGGACTGACCAGAGCAGG + Intergenic
1200779559 Y:7201958-7201980 GCCTCCAGAGTGGTCAGAGCAGG - Intergenic
1201858325 Y:18569472-18569494 GCTTTTGGAGTGACCAGAGCAGG + Intronic
1201874996 Y:18750909-18750931 GCTTTTGGAGTGACCAGAGCAGG - Intronic
1202051952 Y:20790811-20790833 GCCTCCGGTGTGGTCAGAGCAGG + Intergenic