ID: 1085582522

View in Genome Browser
Species Human (GRCh38)
Location 11:77667256-77667278
Sequence GACCCTAGGCTGGCTGTCAC GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 144
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 129}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085582515_1085582522 16 Left 1085582515 11:77667217-77667239 CCGGTAGGGCTTCTTGGTGCTCT 0: 1
1: 0
2: 0
3: 15
4: 117
Right 1085582522 11:77667256-77667278 GACCCTAGGCTGGCTGTCACGGG 0: 1
1: 0
2: 0
3: 14
4: 129

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085582522 Original CRISPR GACCCTAGGCTGGCTGTCAC GGG Exonic
900188470 1:1343604-1343626 GACCCTGGGCAGGCAGGCACAGG - Intronic
900427752 1:2588181-2588203 GACCCTCGGCTAGCAGCCACTGG + Intronic
900569105 1:3349650-3349672 CATCCAAGGCTGGCTTTCACGGG - Intronic
901773781 1:11545190-11545212 GACGCTCTGCTGGCTGTCCCTGG - Intergenic
902337437 1:15761596-15761618 ATGCTTAGGCTGGCTGTCACGGG - Intronic
902408346 1:16198730-16198752 GTCCCTAGGCTGGCTGGAAGGGG - Exonic
902815407 1:18913658-18913680 GACCCTAGCCAGGCTGCCCCTGG - Intronic
903809172 1:26025173-26025195 GTCCCTAGGCTGTCTGGCCCAGG - Intronic
904149994 1:28430516-28430538 TACTCTAGGCTGGCTGGCACTGG - Intronic
906251309 1:44312884-44312906 GGCCCTATGCTGGCTGACTCTGG - Intronic
906382576 1:45342165-45342187 TACCCTAGGCTGGATGTCTGGGG + Intronic
908269011 1:62404866-62404888 CACCCTGGGCTGCCTCTCACAGG + Intergenic
908422409 1:63971913-63971935 GACCCTAGCCTGGCATTCATGGG + Intronic
912214315 1:107590078-107590100 GAGCCTAGGCTGTCTCTCCCTGG - Intronic
912449324 1:109759636-109759658 CAGCCCAGGCTGGCTATCACTGG + Intronic
915861229 1:159446765-159446787 GACTCTAGGCTTTCTGTTACTGG + Intergenic
916071467 1:161172529-161172551 GGCCCTAGGGTGACTGGCACTGG - Intronic
916559287 1:165919130-165919152 GCCCCAAGCCTGGCTGACACAGG - Intergenic
919945793 1:202318370-202318392 GGTCCTAGGCTGCCTGGCACTGG + Exonic
920209197 1:204315761-204315783 CATCCCAGGCTGCCTGTCACGGG - Intronic
1070580543 10:77715879-77715901 AACCCTATGCTGGATGTCACAGG + Intergenic
1070918905 10:80171867-80171889 CACCCCAGGTTGGCTGGCACTGG - Intronic
1074998871 10:118780440-118780462 AACCCTAGGCTGCCTGCCTCTGG + Intergenic
1075317299 10:121463101-121463123 GATCCTTGCCTGGCAGTCACAGG - Intergenic
1075589735 10:123682919-123682941 GACCCTGGGCTGGCTGTCCAAGG + Intronic
1076013128 10:127006455-127006477 GACCCTGGGCTGGCTGGCTGGGG + Intronic
1077917158 11:6618890-6618912 GCCCCCAGGCTGGGTGTCCCTGG - Exonic
1079335122 11:19564384-19564406 GACCCTGCGCTGGCTGACACTGG + Intronic
1083868403 11:65471407-65471429 GAGCCAGGGCTGGCTGTCTCAGG + Intergenic
1084557443 11:69883459-69883481 CACCCCAGGCTGACTGTCTCAGG + Intergenic
1085350552 11:75795617-75795639 TACCCCAGGCTGGCTGGCACAGG + Intronic
1085582522 11:77667256-77667278 GACCCTAGGCTGGCTGTCACGGG + Exonic
1090225978 11:125072531-125072553 GGCCCCAGGGTGGCTGTGACGGG - Intronic
1091108165 11:132942561-132942583 GCCCCTTGGATGGCTGTCACAGG - Intronic
1096438899 12:51621720-51621742 GACCCTAGACTGCCTGTAAGAGG - Intronic
1103513953 12:121494616-121494638 GACCCTAGTCTGGCCATCACTGG - Exonic
1103876406 12:124130942-124130964 CCCCCTGGGCTGGCTTTCACAGG - Intronic
1104622251 12:130325410-130325432 GACCTGAGGCTGGCCCTCACTGG + Intergenic
1104668674 12:130666042-130666064 GACCCAAGGCTGGCAGTGAGTGG + Intronic
1104864038 12:131942187-131942209 GACCCTGGGAGGGCTGTCCCAGG + Intronic
1105821847 13:24087181-24087203 GACCCTGGGCTGGCAGGCTCTGG - Intronic
1112988959 13:105487108-105487130 TACCCTCTGCTGGCTTTCACGGG - Intronic
1113078735 13:106493721-106493743 TGCCCCAGGCTGGCTGACACGGG - Intronic
1115455722 14:33600023-33600045 GTGCCTGGGCTGGATGTCACAGG - Intronic
1121127415 14:91417337-91417359 GGCTCTAGGCTGGCTGCCTCGGG - Intronic
1122028005 14:98891731-98891753 GGGCCTAGGGTGGATGTCACAGG - Intergenic
1122900288 14:104779589-104779611 GTCCCAAGGCTGGCTGACCCTGG - Intronic
1124141319 15:27079651-27079673 GGCCCGAGGCTGGGTCTCACTGG - Intronic
1124926660 15:34076618-34076640 GACCTGAAGCTGGCTGTGACTGG - Intergenic
1125745053 15:41992288-41992310 CAGCCAAAGCTGGCTGTCACAGG - Intronic
1130082867 15:80749801-80749823 GACCCTGTGCTGGGTGCCACAGG + Intronic
1132590704 16:725175-725197 GACCCTAGGCTTGGGGTCTCTGG + Intronic
1133215688 16:4290992-4291014 GGCCCCAGGCTGGGTGTCAGGGG - Intergenic
1134409060 16:13988138-13988160 GACACTAGGATGGCTGTAATAGG - Intergenic
1136588584 16:31203028-31203050 AAACCTGGGCTGGCTCTCACTGG + Exonic
1142187991 16:88703573-88703595 AACACCAGGCTGGCAGTCACTGG - Intronic
1142517728 17:443608-443630 GACCCTATGCTGCTTCTCACTGG - Intronic
1143216594 17:5229787-5229809 GGCCCTAGGCTGGCCATCAAGGG + Intronic
1148455628 17:47809571-47809593 GACCCCAGGGTTCCTGTCACAGG - Intronic
1149923072 17:60677308-60677330 GAGCCTAGGCTGGCTCGCGCCGG - Intergenic
1151602815 17:75116812-75116834 GCCCCTCGTCTGGCTGTCGCAGG + Intronic
1152820865 17:82437045-82437067 GACCCGGGCCTGGCTGTCTCAGG + Intronic
1153666591 18:7371972-7371994 GTCCCTAGGGTGACAGTCACAGG + Intergenic
1154215853 18:12415662-12415684 GACCCTGGACTGGCTGCCAGAGG - Intronic
1157586288 18:48803525-48803547 GACCATCGGGTGGCTGTCACAGG - Intronic
1158396672 18:57084419-57084441 GGACCTAGGCTGGCTGTGACAGG - Intergenic
1159725349 18:71951167-71951189 GCCACTCGGCTGGCAGTCACTGG - Intergenic
1161914576 19:7218961-7218983 GACCCTTGGCTGGAGCTCACTGG - Intronic
1164455977 19:28407151-28407173 CACCCTACGCAGGCTGTGACAGG + Intergenic
1166212949 19:41318923-41318945 GGCCCTAGTCTGGCTGGCAGTGG - Intronic
1167441133 19:49509616-49509638 GACCTTGGGATGGGTGTCACTGG + Intronic
925059720 2:881532-881554 TACCCTAGCCTGGGTGTGACAGG + Intergenic
927600233 2:24434520-24434542 GACCATAGACTGGCTGTCAAGGG - Intergenic
929441293 2:41967450-41967472 GCCACTGGGCTGTCTGTCACAGG - Intergenic
929575560 2:43049733-43049755 GTCCCTATGCTGGCTTTTACTGG + Intergenic
931222928 2:60304551-60304573 GACACTAGTCTGGCTGTTAGGGG + Intergenic
932594680 2:73086662-73086684 TACCTCTGGCTGGCTGTCACAGG + Intronic
935581424 2:104758915-104758937 AAACCAAGGCTGGCTGTCAGAGG - Intergenic
935729851 2:106056281-106056303 GACCCATGGGTGGCTGTCAGCGG + Intergenic
942948298 2:181694301-181694323 GACTCTAGGCTGGCAGCCACAGG + Intergenic
948600634 2:239105844-239105866 GACCCCTGGCAGGCTGGCACTGG + Intronic
1171399086 20:24860068-24860090 GAGCCAAGGCAGGCAGTCACTGG - Intergenic
1173253085 20:41374896-41374918 GGCACTAGGCAGGCTGGCACTGG + Intergenic
1176271079 20:64235723-64235745 GACCCTTGGCTGGCTGTGGTGGG + Intronic
1176271208 20:64236107-64236129 GACCCTGGGCTGGCTGTGGTGGG + Intronic
1176271242 20:64236203-64236225 GACCCTGGGCTGGCTGTGGTGGG + Intronic
1176297224 21:5080577-5080599 GACCCTAGGCCAGCTGGCCCCGG + Intergenic
1177897303 21:26869097-26869119 GACCCTAGACAGGTTGTCCCAGG - Intergenic
1179859805 21:44181371-44181393 GACCCTAGGCCAGCTGGCCCCGG - Intergenic
1179931710 21:44575040-44575062 GACCTGAGCCTGGCTGGCACTGG - Exonic
1182749401 22:32629499-32629521 AAGCCTGGGCTGGCTGTCCCAGG - Intronic
1185194267 22:49458945-49458967 GACCCCAGGCTGACTGTCCGCGG + Intronic
950419210 3:12887019-12887041 GTCCCGAGGCTCGCTCTCACTGG - Intergenic
952965379 3:38617818-38617840 GTCCTGAGGCTGGGTGTCACAGG - Intronic
959874919 3:111371817-111371839 GGCCCTAGTCTGGCTTTCAGGGG + Intronic
961588389 3:127955026-127955048 GGCCCTGGGCTGGCTTTCAGAGG - Intronic
961652345 3:128422798-128422820 CAGCCTGGGCTGGCTGTCCCTGG - Intergenic
967068695 3:185943146-185943168 GCCCCTGGCCTGGCTGCCACTGG - Intergenic
969298933 4:6285848-6285870 CACCCAAGGCTGGCTGACAACGG - Intronic
969539581 4:7778663-7778685 GACCCCAAGCTGGCACTCACGGG + Intronic
982603038 4:157475469-157475491 AGGCCTAGGCTGGGTGTCACTGG + Intergenic
989175506 5:38521536-38521558 GACCCCAGGATGGCATTCACTGG + Intronic
991939832 5:71839847-71839869 GACAATAGGCTGACTATCACTGG - Intergenic
994184233 5:96800774-96800796 GACCCAATGTTGACTGTCACTGG + Intronic
1001405488 5:171474090-171474112 AACCCTAGACTGTATGTCACAGG + Intergenic
1002621387 5:180491073-180491095 GACCCAGGGCAGGCTCTCACTGG - Intergenic
1004172336 6:13305356-13305378 GAACCCAGGCAGGCTGACACTGG - Intronic
1007757708 6:44111071-44111093 GACCCTGGGTTGGAAGTCACAGG + Intergenic
1010740515 6:79497641-79497663 GACCCTAGACTGGGTCCCACTGG + Intronic
1013455966 6:110330028-110330050 TACTCTAGGCTGCCTGGCACCGG + Intronic
1018034092 6:159866904-159866926 GAGCCCGGGCTGGCTGTCAGCGG - Intergenic
1018726858 6:166619520-166619542 GGCCCTGGGCTCTCTGTCACAGG - Intronic
1019397726 7:831226-831248 GACGCTGGGCTGGGTGTCCCTGG + Intronic
1022892959 7:34719852-34719874 GACATTAGACTGTCTGTCACTGG - Intronic
1025256466 7:57386847-57386869 GCCCCCAGACTGGCTCTCACGGG - Intergenic
1025853877 7:65262281-65262303 GACCCTGGTCTGGGTGTCTCAGG - Intergenic
1027969575 7:85061602-85061624 GACCATAGGCTGACTGTATCTGG + Intronic
1029557241 7:101278906-101278928 GACCCAAGGGGGGCTGTCAGGGG + Intergenic
1032082771 7:128868394-128868416 CACCCTAGCCTGCTTGTCACAGG - Intronic
1033410212 7:141110753-141110775 GACCCTAGTGTGGCTGTATCTGG + Intronic
1035549014 8:505929-505951 GACCCTGTCCTGGCTGGCACTGG - Intronic
1038246475 8:25861083-25861105 GACCCCAAGCTGGCTGCCATAGG + Exonic
1040599947 8:48872899-48872921 GTCCCTAGGCTGGAAATCACAGG - Intergenic
1042031462 8:64480374-64480396 GACCCTAGGCTGGCAGGCAGTGG - Intergenic
1044810958 8:96061364-96061386 GCCCCAAGGCTGGATGTGACTGG - Intergenic
1045815884 8:106275393-106275415 GACAATGGGCTGGCTGGCACTGG + Intronic
1048351730 8:133621974-133621996 GACCCCAGGCTGTCTGGCTCAGG - Intergenic
1048533123 8:135268793-135268815 GCCCCTTGCTTGGCTGTCACTGG + Intergenic
1050085304 9:1959127-1959149 AATCCTAGGCTGGCTCTCAGAGG + Intergenic
1051626215 9:19102356-19102378 GCCCCTAGGCTGGCAGCAACTGG + Intronic
1052172336 9:25415329-25415351 GATCCTTCCCTGGCTGTCACTGG + Intergenic
1052748686 9:32466772-32466794 CACCTTAGGCTGGCTTTCTCAGG + Intronic
1052880619 9:33599187-33599209 GCCCCTCTGCTGGCTGACACTGG - Intergenic
1052903650 9:33816706-33816728 GACCGCAGACTGGGTGTCACGGG + Intergenic
1055470749 9:76607964-76607986 GACCCAGGGCTGCATGTCACTGG - Intergenic
1056792573 9:89635627-89635649 CACCCTGGGCTGGCTGCCAGGGG - Intergenic
1060519581 9:124286781-124286803 CACCCTAGGCTGGCAGCCTCTGG - Intronic
1061290736 9:129649174-129649196 CACCCTTACCTGGCTGTCACAGG - Intergenic
1061875038 9:133539449-133539471 GACCCTAGGATGGCTGGCAAGGG - Intronic
1061973650 9:134057698-134057720 GACCCTGGGCTTCCTGTCCCAGG + Intronic
1062034530 9:134377040-134377062 GCCCCTAGGCCAGCAGTCACAGG - Intronic
1186770351 X:12811989-12812011 GACCCTAGGTGGGCAGTCACGGG + Intronic
1190830996 X:54059358-54059380 GACCCTAAGATGGCTGCCAGTGG - Intergenic
1196212348 X:113010165-113010187 GAGTTTAGGCTGGCTGTAACTGG + Intergenic