ID: 1085584339

View in Genome Browser
Species Human (GRCh38)
Location 11:77687459-77687481
Sequence TACCCAAGGTTACCCAAGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 92
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 83}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085584339_1085584345 12 Left 1085584339 11:77687459-77687481 CCCACCTTGGGTAACCTTGGGTA 0: 1
1: 0
2: 1
3: 7
4: 83
Right 1085584345 11:77687494-77687516 CTAGGCATTTGAGACCAAGCTGG 0: 1
1: 3
2: 53
3: 723
4: 7323
1085584339_1085584344 -6 Left 1085584339 11:77687459-77687481 CCCACCTTGGGTAACCTTGGGTA 0: 1
1: 0
2: 1
3: 7
4: 83
Right 1085584344 11:77687476-77687498 TGGGTAGATCACTTGAGGCTAGG 0: 13
1: 342
2: 5806
3: 34326
4: 101492
1085584339_1085584346 21 Left 1085584339 11:77687459-77687481 CCCACCTTGGGTAACCTTGGGTA 0: 1
1: 0
2: 1
3: 7
4: 83
Right 1085584346 11:77687503-77687525 TGAGACCAAGCTGGCCAACATGG 0: 14
1: 1799
2: 46323
3: 133506
4: 214031

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085584339 Original CRISPR TACCCAAGGTTACCCAAGGT GGG (reversed) Intronic
900696048 1:4011004-4011026 ATCCCAGGGTCACCCAAGGTGGG - Intergenic
902575065 1:17372474-17372496 GACCCAAGGCTTCCCAAGATGGG - Intronic
906945900 1:50293934-50293956 TCCCCAAGGTTACCCAATGGTGG - Intergenic
913471928 1:119196748-119196770 TTAACAAGGTTACCCAAGGGGGG - Intergenic
915748345 1:158182168-158182190 TGGCCAAGTTTACCCAAAGTGGG - Exonic
919779631 1:201213604-201213626 TCTCCAAGGATGCCCAAGGTAGG + Exonic
919821443 1:201475511-201475533 TTCCCAGGATTCCCCAAGGTGGG + Intergenic
920429887 1:205911704-205911726 TTCCCAAGGTGACCCATGCTAGG - Intergenic
1067729768 10:48801934-48801956 TACCCATGGGTACCCAGTGTGGG + Intronic
1069437917 10:68402420-68402442 TACCCAAGGACACCCAAGATAGG + Intronic
1075849208 10:125573796-125573818 CCCCCAAGTTTCCCCAAGGTGGG + Intergenic
1076374882 10:129976623-129976645 AACCCCAAGTTCCCCAAGGTGGG + Intergenic
1077989339 11:7389329-7389351 TACAGAAGGTCACACAAGGTGGG - Intronic
1084031757 11:66485255-66485277 TGCCCAAGGTGAGCCAAGGGAGG + Exonic
1085584339 11:77687459-77687481 TACCCAAGGTTACCCAAGGTGGG - Intronic
1087642052 11:100765426-100765448 TCCCCAAGGTCACACAAGCTAGG - Intronic
1092048738 12:5452740-5452762 TTCCCAAGGCTGCCCTAGGTGGG - Intronic
1098486363 12:71026172-71026194 GACTCAAGGTAACTCAAGGTAGG + Intergenic
1107692241 13:42965501-42965523 TAGTTAAGGTTCCCCAAGGTAGG - Intronic
1109677525 13:65698253-65698275 TACCACAGGTTACCACAGGTTGG + Intergenic
1110892211 13:80706909-80706931 TACCCAAGGTTTCTAAAGGATGG + Intergenic
1116991997 14:51286505-51286527 TACCCAGGGCTACCAAAAGTGGG - Intergenic
1117165120 14:53025392-53025414 TACCCCAGGTTACACAAGGGTGG - Intergenic
1120372898 14:83660776-83660798 TATCCAAAGTCACCCAAAGTTGG - Intergenic
1124372089 15:29109829-29109851 TACCCCAAGCTATCCAAGGTGGG + Intronic
1125732670 15:41902218-41902240 TAACCAAGGAGAACCAAGGTAGG - Intronic
1128142317 15:65310834-65310856 TTCACCAGGTTACCCAAGCTGGG - Intergenic
1128836692 15:70814567-70814589 TATCCAACTTTACTCAAGGTGGG - Intergenic
1132390272 15:101433632-101433654 GCCCCAAGGTGACCCAAGGCTGG + Intronic
1133406056 16:5525421-5525443 TATCCAAGGTCACACAGGGTGGG + Intergenic
1135276108 16:21114153-21114175 TACCCGAGGTCAACTAAGGTTGG - Intronic
1139701651 16:68711478-68711500 TACCCAAGGTTACACAGGTGAGG + Intronic
1143432245 17:6895600-6895622 CACCCAAGGTTTCTCAACGTTGG + Intronic
1151277302 17:73045116-73045138 TACCCAAGGCTACCCCAGAGAGG - Intronic
1156879114 18:42054710-42054732 TACCCAAAGTCACCCAATGGGGG - Intronic
1158402146 18:57130897-57130919 TTCACAATGTTACCCAAGATGGG - Intergenic
1159608414 18:70499110-70499132 TACCAAAGATTCCTCAAGGTGGG + Intergenic
1159883086 18:73878237-73878259 TATCCAAGGTTACCCTCTGTGGG - Intergenic
1162418948 19:10554921-10554943 TGCCCAAGGTCACACAACGTTGG + Intronic
1166463902 19:43015615-43015637 TACCCAAGTTTTCCCAGGGCAGG + Intronic
1166595246 19:44042085-44042107 TACTCAAGTTTAAGCAAGGTTGG - Intergenic
925043495 2:752479-752501 TACCCAGGGTTACCCAGGGTCGG - Intergenic
925982444 2:9188084-9188106 TATCCAAGCATACACAAGGTAGG - Intergenic
927222714 2:20728782-20728804 TACCCAAGGTTACACACACTGGG + Intronic
930013801 2:46957238-46957260 TGCCCAAGGGTACACAAAGTAGG - Intronic
930762491 2:55050766-55050788 AACTCACGGTTACCCAAAGTGGG - Intronic
934042162 2:88136612-88136634 TGCCCATGGTCACCCAAGGTGGG - Intergenic
936604901 2:113941198-113941220 TACCAAAAGTTACCCCAAGTTGG + Intronic
942556215 2:177175010-177175032 TAACCAAGCTAACCAAAGGTGGG + Intergenic
945403659 2:209420694-209420716 TACCCAAGGTCACACAAGCAGGG + Intergenic
954033683 3:47838460-47838482 TACCTAAGGTGAACTAAGGTGGG - Intronic
962414246 3:135168016-135168038 TCTCTAAGGTTACCCAAGGCGGG + Intronic
963087123 3:141447641-141447663 AACCCAAGGTTATCGAAGATTGG + Exonic
965500685 3:169452757-169452779 TACCCAGGGTTAGCCAAATTAGG - Intronic
969201632 4:5611023-5611045 TACACAAGGATTCCCAAGGCAGG + Intronic
970263445 4:14254439-14254461 TACCCAAGGTGACCACAGGAGGG - Intergenic
972635102 4:40877279-40877301 TAGCCTAGGTTAGCCAAGGTTGG + Intronic
974081895 4:57222448-57222470 TACCTAATATTACCCAAGGAGGG - Intergenic
975309942 4:72892538-72892560 TTCACAAGGATACACAAGGTGGG - Intergenic
980674211 4:136053520-136053542 AAGCCAGGGTTATCCAAGGTAGG + Intergenic
980915592 4:139030521-139030543 TATCCAAGGGTACCCTAAGTAGG + Intronic
984571110 4:181395472-181395494 TACCCCAGGTCACCTAATGTAGG + Intergenic
987042192 5:14073294-14073316 TACCCAAGGTTACACTTGTTGGG - Intergenic
990951972 5:61307220-61307242 TAGCAAAGGTTTCCCAAGGCTGG + Intergenic
992769535 5:80034903-80034925 TTCGCAAGGGAACCCAAGGTGGG + Intronic
996226886 5:121010295-121010317 TAGCCAAGTATACCCAATGTGGG + Intergenic
997476115 5:134143502-134143524 ATCCCAGGGTTACCCAAGCTAGG + Intronic
1001884692 5:175278726-175278748 TCCCCACAGTTACTCAAGGTAGG + Intergenic
1007226259 6:40317138-40317160 TACCCAAGGTTACACAGTGTTGG + Intergenic
1009815136 6:68723344-68723366 CAGCCAAGGTTAGCCAATGTGGG + Intronic
1014291001 6:119558768-119558790 TAGCCAAGGTCAGCCAAGTTTGG - Intergenic
1020043759 7:5024183-5024205 TAGACAAGGTTTCCCAAGGCTGG - Intronic
1020751977 7:12152895-12152917 TACCCAAGATTAGACAAGGAAGG + Intergenic
1022332934 7:29397427-29397449 TATCCAAAGTTCTCCAAGGTTGG + Intronic
1028813156 7:95112105-95112127 TACCCAAGGATACTCAAGCATGG + Intronic
1032465993 7:132145396-132145418 TACCCAATTTTACCCAAGTAGGG - Intronic
1032514359 7:132495755-132495777 TTCCCAAGCTCACCCATGGTGGG + Intronic
1036498074 8:9287725-9287747 TACCATAGGTTACCAGAGGTAGG - Intergenic
1037609608 8:20465060-20465082 TGCCCAAGGGTATCCAAGTTAGG - Intergenic
1037816490 8:22115362-22115384 TTCCCAAGTTTCCCCAAGGAAGG + Exonic
1039163132 8:34644943-34644965 TACCAATGGTTGCCAAAGGTGGG - Intergenic
1039229464 8:35427348-35427370 CACCCAAGGTAGCCCCAGGTGGG - Intronic
1039615306 8:38950842-38950864 CACCCCAGGTTCCCAAAGGTGGG + Exonic
1041483874 8:58352853-58352875 TACCCAAGGTTACACCAAGTAGG + Intergenic
1041775390 8:61517025-61517047 TAGCCAAGGTTACACAGGTTAGG + Intronic
1043050496 8:75379246-75379268 TACCCAAAGTTGAACAAGGTTGG + Intergenic
1048371208 8:133777966-133777988 TACCAAAGGTTATACAAGGAGGG - Intergenic
1053418016 9:37958923-37958945 TGCCCAAGGTCACCCATGGAGGG - Intronic
1053729508 9:41038828-41038850 TAACATAGGTAACCCAAGGTAGG + Intergenic
1054698999 9:68393234-68393256 TAACATAGGTAACCCAAGGTAGG - Intronic
1061671481 9:132190981-132191003 TCCCCAAGATTCCTCAAGGTTGG + Intronic
1197911844 X:131491432-131491454 TAGCGAAGGTCACACAAGGTTGG + Intergenic