ID: 1085584573

View in Genome Browser
Species Human (GRCh38)
Location 11:77689816-77689838
Sequence TGAATCCCCTTTTAAAGAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 470
Summary {0: 1, 1: 0, 2: 1, 3: 40, 4: 428}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085584573 Original CRISPR TGAATCCCCTTTTAAAGAGG AGG Intronic
901113668 1:6820671-6820693 TTACTCCCATTTTACAGAGGAGG - Intronic
901283541 1:8058362-8058384 TGAATCCCCTGTTTAAGAAAAGG - Intergenic
901866886 1:12112245-12112267 TCATTCCCCTTTTACAGAGGAGG + Intronic
902106969 1:14045732-14045754 TTAATCCCATTTTACAGATGAGG - Intergenic
902375161 1:16027049-16027071 TGATCCCCATTTTACAGAGGAGG - Intronic
902521516 1:17020366-17020388 TTAATCCCCTTATACAGATGGGG - Intronic
902566428 1:17314607-17314629 TGATTCCCATTTTACAGAGAAGG + Intronic
902673361 1:17991553-17991575 TTATTCCCATTTTACAGAGGAGG + Intergenic
903301978 1:22385716-22385738 TGAGTCCCATTTTACAGATGGGG + Intergenic
903326780 1:22573388-22573410 TGAGTCCCATTTTACAGATGTGG + Intronic
903355384 1:22743396-22743418 ACCATCCCATTTTAAAGAGGAGG - Intronic
903872306 1:26445130-26445152 TTATTCCCCTTTTACAGATGAGG - Intronic
904161508 1:28525459-28525481 TGCATCCCCTTTTATAGATGAGG + Intronic
904271553 1:29353612-29353634 TAAAGCCCATTTTAAAGATGAGG + Intergenic
904356502 1:29943543-29943565 TCATTCCCATTTTACAGAGGAGG - Intergenic
904380282 1:30106144-30106166 TCACTCCCGTTTTACAGAGGAGG + Intergenic
905515985 1:38562430-38562452 TTATTCCCATTTTAAAGATGAGG + Intergenic
905839147 1:41159501-41159523 TTACTCCCATTTTAAAGATGAGG + Intronic
907489032 1:54797088-54797110 AGAATCCCATTTTACAGAGGAGG + Intronic
907516850 1:54998260-54998282 TTATTCCCATTTTACAGAGGAGG + Intergenic
910185428 1:84534457-84534479 TCATTCCCCTTTTACAGATGAGG + Intergenic
910369107 1:86497138-86497160 AGTATCCCTTTTTAAAGATGGGG + Intronic
910485397 1:87707934-87707956 TTACTCCCATTTTACAGAGGAGG + Intergenic
911335713 1:96577695-96577717 GGAATCCCATCTTAAAGAGAGGG + Intergenic
914878804 1:151532143-151532165 TTAATCCCATTTTACAGATGGGG + Intronic
916168015 1:161980704-161980726 TTACTCGCTTTTTAAAGAGGAGG + Intergenic
916505730 1:165426655-165426677 TGAATACAGTTTTAGAGAGGAGG - Intronic
916710002 1:167396392-167396414 TGAAGCCACTTTTAGAGAAGTGG + Exonic
916873787 1:168946654-168946676 TTAATCCCATTTTACAGATGAGG + Intergenic
918576332 1:186065167-186065189 TGAATAAACTTTGAAAGAGGAGG - Intronic
920347313 1:205314502-205314524 TGAATCCTCCTTTAACTAGGAGG + Intronic
921055574 1:211540106-211540128 TAACTCCTATTTTAAAGAGGAGG + Intergenic
921281053 1:213568663-213568685 TCATGCCCATTTTAAAGAGGAGG + Intergenic
922136076 1:222828102-222828124 TTATTCCTCTTTTAAAGATGAGG + Intergenic
922778142 1:228226965-228226987 TGAATCCCATGTTACAGATGAGG - Intronic
924733775 1:246736389-246736411 TGAATTCCCTTTTAAAAATCAGG + Intronic
1064939343 10:20715119-20715141 AGAAACCTCTTTTAAGGAGGGGG + Intergenic
1067493449 10:46737929-46737951 TGAATCCAGTTTTTAAGAGTGGG - Intergenic
1067601211 10:47602475-47602497 TGAATCCAGTTTTTAAGAGTGGG + Intergenic
1071757342 10:88558306-88558328 TTATTCCCATTTTATAGAGGAGG - Intronic
1072308383 10:94130479-94130501 TTATTCCCATTTTACAGAGGAGG + Intronic
1072716110 10:97753610-97753632 TGATCCCCCTTTTACAGAAGGGG - Intronic
1072793582 10:98337274-98337296 TGTATCCCATTTTACAGATGAGG + Intergenic
1073045049 10:100632092-100632114 TGACTTCCCTTTTAAAGGAGGGG - Intergenic
1073204005 10:101759046-101759068 TGAATCCCATTTTACACATGAGG + Intergenic
1074382765 10:112993669-112993691 TGAATCCCCTCTACAAGAGAGGG + Intronic
1074421450 10:113312604-113312626 TGAATCCCATTTTGGAGATGAGG - Intergenic
1074821675 10:117184086-117184108 TTATTCCCATTTTAGAGAGGAGG - Intergenic
1074846489 10:117403408-117403430 TGGATCCCTTTCTTAAGAGGAGG + Intergenic
1075428520 10:122361843-122361865 TGTGTCCCATTTTACAGAGGAGG - Intergenic
1075550611 10:123390161-123390183 TGATTCCCATTTTACAGATGAGG - Intergenic
1076161671 10:128248337-128248359 ATTATCCCCTTTTAAAGATGAGG - Intergenic
1077372674 11:2190819-2190841 TCAATCCGCTTTTAACAAGGAGG + Intergenic
1077474783 11:2781222-2781244 TAAATCCTCTTTTACAGATGGGG + Intronic
1077905641 11:6530732-6530754 TGAACCCCCTGTACAAGAGGAGG - Intronic
1077979114 11:7281518-7281540 TGAATACCCTTTTACAGAACAGG - Intronic
1078133729 11:8635256-8635278 TTATTCCCCTTTGAAAGATGTGG - Intronic
1078579670 11:12528362-12528384 TCATTCCCCTTTTACAGATGAGG + Exonic
1078738493 11:14044051-14044073 CGACTCCCATTTTACAGAGGAGG + Intronic
1079149673 11:17886131-17886153 TGAATTCCGTTTTACAGATGAGG - Intronic
1079566774 11:21892024-21892046 TTAATCCCCATTTACAGATGAGG - Intergenic
1079574289 11:21984248-21984270 TATATCCCCTTAAAAAGAGGTGG + Intergenic
1080696474 11:34606960-34606982 TGATTCCCATTTTACAGATGAGG - Intergenic
1080764757 11:35285294-35285316 TTATTCCCATTTTACAGAGGAGG - Intronic
1080877693 11:36291516-36291538 TGAACACCATTTTACAGAGGTGG - Intergenic
1081537899 11:44008522-44008544 TCAATCCCCTTTTACAGATTAGG - Intergenic
1081742950 11:45453749-45453771 TGGATCCCCTTTTCCAGATGAGG + Intergenic
1082079037 11:47997577-47997599 TTACTCCCATTTTACAGAGGAGG - Intronic
1082269593 11:50155593-50155615 TGAATACTCTTTTCCAGAGGAGG - Intergenic
1083478987 11:62931477-62931499 TGATTCCCATTTTACAGATGAGG - Intergenic
1084000737 11:66294206-66294228 TGAGCCCCATTTTACAGAGGAGG - Intronic
1084727656 11:70952439-70952461 TCTATCCACTTTAAAAGAGGAGG - Intronic
1085465880 11:76723011-76723033 TTTACCCCCTTTTACAGAGGAGG + Intergenic
1085584573 11:77689816-77689838 TGAATCCCCTTTTAAAGAGGAGG + Intronic
1085620122 11:78031689-78031711 GTAATCCCTTTTTAGAGAGGAGG + Intronic
1085676778 11:78528307-78528329 TCAATCCCGTTTTAAAGAAAAGG + Intronic
1086124486 11:83336254-83336276 TGTATCCCACTTTAAAGATGAGG - Intergenic
1086146062 11:83553197-83553219 TTAATCCCATTTTACAGATGGGG - Intronic
1086238903 11:84665295-84665317 TTAATCCCATTTTACAGATGAGG + Intronic
1087230581 11:95657271-95657293 TAATTCTCCTTTTACAGAGGTGG + Intergenic
1088821210 11:113459121-113459143 TTACTCCCATTTTACAGAGGAGG - Intronic
1089053912 11:115569167-115569189 TGATTACCATTTTAAAGATGAGG + Intergenic
1089615803 11:119694132-119694154 TGACTCCCCATTCACAGAGGGGG + Intronic
1089771767 11:120808272-120808294 TTATTCCCATTTTACAGAGGAGG - Intronic
1090026688 11:123173643-123173665 TAACTCCCATTTTACAGAGGAGG - Intronic
1090991560 11:131821545-131821567 TCATTCCCATTTTAAAGATGAGG - Intronic
1091728134 12:2859436-2859458 TGATTCCTCTTTGAAAGATGGGG + Exonic
1093223697 12:16454497-16454519 TTATTCCCATTTTAAAGATGAGG + Intronic
1094195832 12:27748981-27749003 TCAATTCCTTTTCAAAGAGGTGG - Intronic
1094529385 12:31259576-31259598 TGAATGCGCCTTTAAAGAAGGGG - Intergenic
1095934837 12:47666725-47666747 TCACTCTCCTTTTACAGAGGAGG - Intronic
1096330240 12:50705475-50705497 GGAATCTTCCTTTAAAGAGGAGG - Intronic
1097354466 12:58586080-58586102 TGAATCCCATTTTGAAGATGAGG + Intronic
1097996995 12:65898739-65898761 TTATTCCCATTTTAAAGATGAGG + Intronic
1098242132 12:68478950-68478972 TGAAACCCATTTTACAGATGAGG + Intergenic
1101059863 12:100959560-100959582 AGAAACCCCTTTTATAAAGGTGG + Intronic
1101408118 12:104446713-104446735 TGATTCCCATTTTACAGATGAGG + Intergenic
1101771746 12:107758481-107758503 TTAATCCCACTTTAAAGATGAGG + Intronic
1101822768 12:108196632-108196654 TTATTCCCATTTTAAAGATGAGG + Intronic
1101845877 12:108362666-108362688 TGACTCCCATTTTACAGATGTGG - Intergenic
1101864085 12:108507211-108507233 TGAATCCCCATAAAAAGAGAGGG + Intergenic
1101962429 12:109259936-109259958 TTAACCCCCTTTTACAAAGGAGG - Intronic
1102025196 12:109710573-109710595 TTAATCCCATTTCAAAGATGGGG + Intergenic
1102279765 12:111609643-111609665 TTATTCCCCTTTTACAGATGGGG + Intergenic
1102462483 12:113108517-113108539 TGAGTCCCATTTTACAGATGAGG + Intronic
1103034327 12:117644098-117644120 TGAATCCACATTTGCAGAGGTGG - Intronic
1103605039 12:122079713-122079735 TCATTCCCCTTTTATAAAGGAGG - Intronic
1103707601 12:122886842-122886864 TAACTCCCATTTTAAAGAGGAGG + Intronic
1103822488 12:123710220-123710242 TGAGTCCACTTTCAAATAGGGGG + Intergenic
1106041644 13:26099107-26099129 TGGATCCCCATTTACAGAGAAGG - Intergenic
1106140303 13:27006106-27006128 TGGTTCCCCTTCTATAGAGGAGG + Intergenic
1106791248 13:33156639-33156661 TCATTCCCCCTTTACAGAGGAGG - Intronic
1109096225 13:58120362-58120384 TGAATGCCTTTATTAAGAGGGGG + Intergenic
1112695428 13:101943073-101943095 TTAATCCCATTTTAGAGATGAGG + Intronic
1113730277 13:112636753-112636775 TGACTCCCGTGTTACAGAGGAGG + Intergenic
1114558194 14:23574071-23574093 TGAATTTTCTTTTAAAGGGGTGG - Intronic
1115038886 14:28896202-28896224 TGAAAACCCTTTTAAATAGTGGG - Intergenic
1116040109 14:39676166-39676188 TCACTCCCATTTTAAAGATGAGG + Intergenic
1116284267 14:42951511-42951533 AGAATCCCCTATTCAAGAAGTGG - Intergenic
1116802126 14:49453925-49453947 TGATTCCCATTTTATAGATGAGG - Intergenic
1116956029 14:50924303-50924325 TTAATCCTCTTTTAAAGATGAGG + Intronic
1117220813 14:53603651-53603673 TTAATCCCATTTTACAGATGAGG + Intergenic
1117686882 14:58262502-58262524 TGCCTTCCCTTTTAAAGAGAAGG + Intronic
1118142144 14:63095758-63095780 TGATTCCCATTTTACAGATGAGG + Intronic
1119005693 14:70925786-70925808 TAAATCCCCTTTTGCAGAGGAGG + Intronic
1119484546 14:74979255-74979277 TCACTCCCATTTTAAAGATGAGG + Intergenic
1119515910 14:75248114-75248136 TGATTCCCATTTTACAGATGAGG + Intronic
1119639965 14:76307541-76307563 GGAATCACCTTTGAAGGAGGAGG + Intergenic
1119663670 14:76468688-76468710 TGATTCCCATTTTATGGAGGAGG - Intronic
1120264389 14:82231147-82231169 TGACTCTCCTTTTACAGGGGTGG - Intergenic
1120927221 14:89809820-89809842 TTTATCCTCTTTTAAAGAGGTGG - Intronic
1121495241 14:94387786-94387808 TGATTCCCATTTTACAGATGAGG - Intronic
1121712191 14:96046756-96046778 TAATTCCCCTTCTAAAGAGAAGG + Intronic
1125013883 15:34911109-34911131 TGATTCACCTTTTAAAAAGAAGG - Intronic
1125539747 15:40463444-40463466 TTAATCCCATTTTACAGATGTGG + Intronic
1126492610 15:49255704-49255726 TGAATTCCCCTTTATAAAGGTGG + Intronic
1126725926 15:51632355-51632377 TGAACCCCTTTTTATAGATGAGG + Intergenic
1127537726 15:59905959-59905981 TAAATAACCTTTTAAAGAGTTGG - Intergenic
1127962311 15:63898932-63898954 TTATTCCCCTTTTAAGGAGAAGG + Intergenic
1127962881 15:63902921-63902943 TTATTCCCCTTTTAAAGAGAAGG - Intergenic
1128360839 15:66960667-66960689 TTACTCCCATTTTACAGAGGAGG + Intergenic
1128438243 15:67677315-67677337 TTAACCCCATTTTACAGAGGAGG - Intronic
1128732909 15:70033222-70033244 TTACTCCCATTTTACAGAGGAGG - Intergenic
1130207495 15:81890464-81890486 TGATTCCCATTTTATAGATGAGG - Intergenic
1130866955 15:87941319-87941341 TTAATCCCATTTTACAGATGAGG - Intronic
1130959221 15:88648732-88648754 TTAATTCCATTTTACAGAGGAGG - Intronic
1133669148 16:8000420-8000442 TGAATCCCATTTTACAAATGTGG - Intergenic
1133808019 16:9139949-9139971 TTAATCCCCTTTTACAAACGAGG - Intergenic
1134012640 16:10866635-10866657 TGACTTCCCTTTCAGAGAGGAGG - Intergenic
1134853918 16:17504206-17504228 TTAATCCCATTTTACAGATGAGG + Intergenic
1135041988 16:19124592-19124614 TTAATCCCATTTTACAGATGAGG - Intronic
1135163288 16:20116356-20116378 TGACACCCATTTTCAAGAGGTGG + Intergenic
1135163648 16:20119380-20119402 TTTATCCCATTTTACAGAGGAGG + Intergenic
1136058849 16:27710858-27710880 TTATTCCCATTTTAAAGAAGAGG + Intronic
1136114600 16:28086900-28086922 TGACTCCCATTTTACAGATGAGG + Intergenic
1136549569 16:30975744-30975766 TGATTCCCATTTTATAGATGAGG + Intronic
1137540602 16:49359124-49359146 TTTATCCCATTTTACAGAGGAGG + Intergenic
1138519577 16:57563393-57563415 TGAGCCCCATTTTACAGAGGAGG - Intronic
1138578450 16:57923705-57923727 TTAATCCCATTTTACAGAGGGGG - Intronic
1138731123 16:59196259-59196281 TGAACTCCCTATTAAACAGGTGG + Intergenic
1138731231 16:59197215-59197237 TGAACTCCCTATTAAACAGGTGG + Intergenic
1138833636 16:60406949-60406971 GCAATTTCCTTTTAAAGAGGAGG + Intergenic
1139491336 16:67287698-67287720 ATATTCCCCTTTTAAAGATGAGG - Intronic
1140034280 16:71360780-71360802 TGACTCCCCTTATACAGATGAGG + Intronic
1140159298 16:72470088-72470110 TGAATGCCCTTTAACAGAGAAGG - Intergenic
1140981031 16:80109529-80109551 TGAGTCCCCATAGAAAGAGGAGG - Intergenic
1141014302 16:80433995-80434017 TGCATCCCCTTTTGAATATGTGG + Intergenic
1141307924 16:82883969-82883991 TCAAGCCCATTTTACAGAGGAGG - Intronic
1141327971 16:83080558-83080580 TTAGTCCCGTTTTAAAGATGAGG + Intronic
1141492882 16:84386756-84386778 TCATTCCCATTTTAAAGAGGAGG + Intronic
1141656804 16:85421013-85421035 TGATTCCCATTTTACAGAGGGGG - Intergenic
1142490712 17:277574-277596 AGAGTACCCTTTAAAAGAGGGGG + Intronic
1143067156 17:4259155-4259177 TGATCCCCCTTTTAAAGCTGAGG + Intronic
1144178593 17:12731639-12731661 TGATTCCCATTTTATAGATGGGG + Intronic
1144640736 17:16935235-16935257 TGAGTCCCCTGCTAAAGAGGGGG - Intronic
1146938416 17:36826682-36826704 TGGGTCCCCTTTTACAGATGAGG + Intergenic
1147568942 17:41555352-41555374 TGAAGCCCATTTTATAGATGAGG - Intergenic
1147815866 17:43209939-43209961 AGAATCCCATTTCAAAGAGATGG - Exonic
1148199623 17:45741237-45741259 TTATTCCCATTTTACAGAGGAGG - Intergenic
1148859658 17:50597364-50597386 TGATCCCCATTTTACAGAGGGGG + Intronic
1149373938 17:56024527-56024549 TAAATCCCATTTTAAACATGAGG - Intergenic
1149423300 17:56531298-56531320 TGAAACCCATTTTACAGATGAGG + Intergenic
1149666424 17:58367980-58368002 TTATTCCCCTTTTACAGATGAGG + Intronic
1150563359 17:66315234-66315256 TGATTCCCGTTTTACAGATGAGG + Intronic
1150626267 17:66843136-66843158 TGATTCCCATTTTACAGATGAGG + Intronic
1151863832 17:76786447-76786469 TGAATCCCCAAGTTAAGAGGTGG - Intergenic
1152271380 17:79326916-79326938 TTAACCCCATTTTAAAGATGAGG + Intronic
1152850538 17:82631774-82631796 TGAATTCACATTTCAAGAGGTGG + Intronic
1153402028 18:4691792-4691814 TGCATCCACCTTTAAACAGGGGG + Intergenic
1153829580 18:8910203-8910225 AGAGTCCCCTTTTAAAAGGGAGG + Intergenic
1155208753 18:23583258-23583280 TTAATCCAATTTTACAGAGGAGG + Intronic
1156212505 18:34960523-34960545 TGCATCGCCTGATAAAGAGGAGG + Intergenic
1156667285 18:39423845-39423867 TGAATCTCCTTCTAAAGATAAGG + Intergenic
1157083882 18:44557167-44557189 TTAATCCCATTTTACAGATGAGG - Intergenic
1158470760 18:57734889-57734911 TGCATCCACCTTTAAACAGGAGG + Intronic
1158698088 18:59720340-59720362 TCATTCCCATTTTAAAGATGAGG - Intergenic
1158877806 18:61749830-61749852 GGAATCCTATTTTATAGAGGAGG + Intergenic
1159391430 18:67797581-67797603 TGAAACCTTTTTGAAAGAGGAGG + Intergenic
1160283397 18:77515461-77515483 TTTGTCCCCTTTTAAATAGGTGG + Intergenic
1161192419 19:2965690-2965712 TAAATCCCATTTTACATAGGAGG - Intergenic
1161314554 19:3611747-3611769 TGACCCCCCTTTTATATAGGAGG + Exonic
1161424758 19:4197117-4197139 TGAAACCCATTTTACGGAGGAGG + Intronic
1161656728 19:5520726-5520748 TGAACCCCATTTTATAGATGAGG + Intergenic
1161827792 19:6580566-6580588 TGAATTTCCTTTTGAGGAGGTGG + Intergenic
1161855723 19:6763811-6763833 TTATTCCCCTTTTACAGATGTGG - Exonic
1162139578 19:8577671-8577693 TGAATCGCCCTGAAAAGAGGTGG - Intergenic
1162364081 19:10237413-10237435 CCAATCCCATTTTAAAGAAGAGG + Intergenic
1162409344 19:10495814-10495836 ATAATCCCATTTTACAGAGGAGG - Intronic
1162844655 19:13382875-13382897 TGAGGCCCATTTTACAGAGGAGG + Intronic
1163535814 19:17875834-17875856 TTAATCCCACTTTAGAGAGGAGG + Intronic
1166124358 19:40704965-40704987 TGATTCCCATTTTACAGATGGGG + Intronic
1166833716 19:45653964-45653986 TGACTCCCGTTTTGCAGAGGAGG - Intergenic
1166857366 19:45789504-45789526 GGAATCCCATTTTGCAGAGGAGG + Intronic
925197340 2:1937001-1937023 TGAATTCCCTTTAAAAAAGAAGG + Intronic
926716375 2:15927525-15927547 CGATTCCCATTTTAAAGAGGAGG + Intergenic
926746890 2:16166302-16166324 TTAGTCCCATTTTACAGAGGGGG - Intergenic
927042892 2:19247142-19247164 TGACTCTCATTTTACAGAGGAGG - Intergenic
927844752 2:26465603-26465625 TGAATCTCATTTTAGAGTGGAGG + Intronic
927874148 2:26643378-26643400 TCATTCCCCTTTTACAGATGAGG - Intergenic
929739189 2:44585109-44585131 TTACTCCCCTTTTAAAAAGCTGG - Intronic
929856150 2:45640082-45640104 TTATTCCCATTTTAAAGACGGGG - Intergenic
930027437 2:47037742-47037764 TGATTCCCCTTTTACAGATGAGG + Intronic
930413916 2:51065148-51065170 TTATTCCCTTTTTACAGAGGAGG + Intergenic
931246558 2:60497265-60497287 TGCATCCTTTTGTAAAGAGGGGG + Intronic
931913527 2:66928147-66928169 TGTATTGCCTTTTAAAAAGGTGG - Intergenic
932837946 2:75054947-75054969 TGAATCCCATTTTGTAGACGAGG + Intronic
933137303 2:78754051-78754073 TTATTCCCATTTTAAAGATGAGG + Intergenic
934715919 2:96543272-96543294 GGAATTCCATTTTAAAGAGGGGG - Intronic
934915099 2:98295227-98295249 TGAAAGCCTTTTTGAAGAGGTGG + Intronic
935147074 2:100402974-100402996 TGAAAGCCCATTTGAAGAGGAGG + Intronic
935178400 2:100669501-100669523 TTAATCCCATTTTATAGATGAGG + Intergenic
935585271 2:104795328-104795350 TGAATCCTCTTTTCAAAAGGAGG + Intergenic
937574871 2:123407892-123407914 TGAATCCCCTTTAAAAAATATGG + Intergenic
937941782 2:127291732-127291754 TGAATGCCATTTAAAAGAGATGG - Intronic
938224452 2:129603701-129603723 AGAATCCACCTTCAAAGAGGTGG - Intergenic
939368620 2:141267903-141267925 TGGATCCCCTTTTACAAAGGAGG - Intronic
939929585 2:148216672-148216694 TTAATCTCCTTTTACAGATGAGG + Intronic
940117101 2:150220768-150220790 TTAATGCCCTTATAAAGAGGAGG + Intergenic
941198443 2:162478874-162478896 TGCATCCCGTTTTAGAGAGCAGG + Intronic
942191411 2:173474075-173474097 TTATTCCCATTTTATAGAGGAGG - Intergenic
942686774 2:178541006-178541028 TGAATCTCATCTTAAAGAAGTGG + Intronic
943354325 2:186832845-186832867 TTATTCCCATTTTAAAGATGAGG + Intronic
944405511 2:199379480-199379502 TGCATCCACTTTGAAACAGGGGG + Intronic
944664258 2:201946513-201946535 TTATCCCCCTTTTACAGAGGAGG - Intergenic
945197524 2:207251250-207251272 TGATCCCCATTTTACAGAGGAGG + Intergenic
945633496 2:212316325-212316347 TGTATTTCCTTTTACAGAGGTGG + Intronic
945807251 2:214504799-214504821 TGATTCCCATTTTACACAGGAGG + Intronic
946071875 2:217041003-217041025 TCATTCCCATTTTGAAGAGGAGG - Intergenic
946181437 2:217951467-217951489 TGAATCCCATTTTACAGAGGAGG + Intronic
946463700 2:219892612-219892634 TGATTCCCATTTTACAGATGAGG - Intergenic
1168890912 20:1294909-1294931 TTAGTCCCCTTTTACAGATGAGG - Intronic
1168949848 20:1789709-1789731 TGATTCCCATTTTAAAGATGAGG - Intergenic
1168966862 20:1904043-1904065 AAATCCCCCTTTTAAAGAGGAGG + Intronic
1169397444 20:5245318-5245340 AGAATCCCAATTTAAAGATGAGG - Intergenic
1172058118 20:32168299-32168321 TTAGCCCCCTTTTACAGAGGTGG + Intergenic
1172288273 20:33756834-33756856 TGAGTCCCATTTTACAGATGTGG + Intronic
1172573562 20:35989100-35989122 TTATTCCCATTTTACAGAGGAGG + Intronic
1172583111 20:36064180-36064202 TGATTCCCTTTTTACAGATGAGG - Intergenic
1172692618 20:36800604-36800626 TGAAACCCCTTTTTCAGATGAGG - Intronic
1172742183 20:37178020-37178042 CTAATCCCATTTTAAAGAGAAGG - Intronic
1172884868 20:38224117-38224139 TGATCTCCATTTTAAAGAGGAGG - Intronic
1173194182 20:40900375-40900397 TGAATCCCGTTTTACAGATGAGG - Intergenic
1173306395 20:41854714-41854736 TTGCTCCCCTTTTAAAGATGAGG + Intergenic
1173616524 20:44406832-44406854 TTATTCCCATTTTATAGAGGAGG + Intronic
1173667099 20:44770984-44771006 TTAATCCCATTTTACAGATGAGG + Intronic
1174173677 20:48632075-48632097 TGGATCCCACTTTACAGAGGAGG - Intronic
1174268037 20:49345999-49346021 TGAATCCCATTTTCCAGATGAGG - Intergenic
1174719270 20:52794007-52794029 TGTATCCCCTTTGGATGAGGAGG - Intergenic
1175174468 20:57102621-57102643 TGAATCTCCTTTTCCAGAAGGGG - Intergenic
1175930214 20:62490308-62490330 TGAATCCCACTTTACAGACGAGG - Intergenic
1175945598 20:62557163-62557185 GGCACCCCCTTCTAAAGAGGGGG + Intronic
1177005216 21:15664196-15664218 TTATTCCCATTTTACAGAGGAGG + Intergenic
1177384332 21:20389275-20389297 TCGATCACCTTTTAAATAGGCGG - Intergenic
1178185235 21:30211139-30211161 TGACTCCCATTTTACAGATGAGG + Intergenic
1181860819 22:25816682-25816704 TCATTCCCATTTTACAGAGGAGG + Intronic
1182087632 22:27572338-27572360 TGATTTCCATTTTACAGAGGCGG - Intergenic
1182128275 22:27832379-27832401 TTATTCCCATTTTAGAGAGGAGG + Intergenic
1184147573 22:42620257-42620279 TGAATCCCATTTTACAGATGTGG + Intronic
1184290021 22:43493606-43493628 TTATTCCCCTTTTACAGATGAGG - Intronic
1184389323 22:44194185-44194207 TGAGTGCCCTTTTATAGATGAGG - Intronic
1184654447 22:45934111-45934133 TGATTCCCGGTTTACAGAGGAGG + Intronic
1184660514 22:45963527-45963549 TCATTCCCATTTTACAGAGGCGG + Intronic
1184891856 22:47384649-47384671 TGATTCCTCTTTTACAGATGAGG + Intergenic
949211441 3:1507716-1507738 TTAATTCCATTTTAAAGAGAAGG - Intergenic
949493444 3:4610517-4610539 TGAATGCCCTTTTGTAGATGTGG + Intronic
949826909 3:8175268-8175290 TCATTCCCATTTTATAGAGGGGG + Intergenic
950641607 3:14352019-14352041 TGATCCCCATTTTACAGAGGAGG + Intergenic
950791646 3:15477015-15477037 GGAATCCCTTCTTCAAGAGGGGG - Intronic
950936438 3:16843903-16843925 TCAATCCCATTTTACAGATGAGG - Intronic
950944056 3:16926362-16926384 TTAATCCCACTTTACAGAGGAGG - Intronic
953046705 3:39299083-39299105 TGAATTTCCTTTTATAGGGGAGG - Intergenic
955218572 3:57005289-57005311 TTTATCCCCTTTTACAGATGAGG + Intronic
955979092 3:64506735-64506757 TTATTCCCATTTTAAAGATGAGG - Intergenic
956527304 3:70179109-70179131 TTAGTCCCATTTTAAAGATGTGG + Intergenic
959524366 3:107360086-107360108 TGAAACCCCTTGCAAGGAGGAGG + Intergenic
959902235 3:111674129-111674151 TTATTCCCATTTTACAGAGGAGG - Intergenic
960121852 3:113955182-113955204 TGCATCCCCTTCTGAGGAGGAGG - Intronic
960848294 3:122024696-122024718 TCAATCCCATTTTATAGATGTGG + Intergenic
961158184 3:124698561-124698583 TCAATCCCATTTTACAGAGTGGG + Intronic
961836541 3:129665820-129665842 TTATTCCCATTTTAAAGATGAGG - Intronic
964001314 3:151776152-151776174 TGATTCCCAGTTTAAAGATGAGG - Intergenic
966210448 3:177447958-177447980 TGATTCCCATTTTACAGATGTGG - Intergenic
966576231 3:181505778-181505800 TGAATCCCCTGTTAGAGAAAAGG - Intergenic
967507964 3:190274922-190274944 TGAATACCATTTTAAAGAAAAGG - Intergenic
968391834 4:199177-199199 TTATGCCCCTTTTACAGAGGAGG - Intergenic
969131927 4:4996418-4996440 TGAACCCCATTTTACAGATGTGG + Intergenic
969827939 4:9772927-9772949 TGGATGCCATTTTAAAGATGAGG + Intronic
970091905 4:12418969-12418991 TGATTCCCTTTTTATAGATGAGG - Intergenic
970580397 4:17469552-17469574 TTATTCCCATTTTAAAGATGAGG - Intronic
972479275 4:39482632-39482654 TGAATCTGCTTTTAAAGAGCAGG + Intergenic
973647779 4:52967472-52967494 TTAATCCCATTTTACAGATGAGG + Intronic
974785511 4:66615072-66615094 TGAATACCGTGTTAAATAGGTGG + Intergenic
974909508 4:68099866-68099888 TGTTTCCCCTTTTAAAGTGTGGG - Intronic
975647238 4:76557107-76557129 TAAATCCTCATTTAAAGATGAGG - Intronic
976430970 4:84963836-84963858 TTAATCCCATTTTACAGATGGGG - Intronic
977926592 4:102706459-102706481 TGAATTCTCTTTTATAGGGGAGG - Intronic
981054042 4:140341470-140341492 TTATTCCCATTTTAAAGATGAGG - Intronic
981340067 4:143611375-143611397 TGACTCCCTTTATGAAGAGGAGG - Exonic
982065806 4:151653497-151653519 TTTATCCCCATTTAAAGAGGAGG - Intronic
982072440 4:151707231-151707253 TGGATCCTCTGATAAAGAGGTGG + Intronic
982832029 4:160074300-160074322 TATATCCCCTTTCAAGGAGGTGG - Intergenic
984412685 4:179414867-179414889 GGAATCCCATTTTACAGAAGGGG - Intergenic
984461281 4:180040287-180040309 TTATTCCCCATTTAAAGATGAGG + Intergenic
984620516 4:181947044-181947066 TGAAGCCCATTTTATAGATGAGG - Intergenic
984724818 4:183010329-183010351 TGATTCCCATTTTATAGATGAGG - Intergenic
985336413 4:188900721-188900743 TGTATCCCCTTTTATAGATGAGG - Intergenic
985353348 4:189090721-189090743 TGCAATCACTTTTAAAGAGGTGG - Intergenic
985926462 5:3023264-3023286 TGATTCCCATTTCACAGAGGAGG - Intergenic
986045201 5:4030180-4030202 GAAATGTCCTTTTAAAGAGGTGG + Intergenic
986369028 5:7062181-7062203 ACAATCTCCTCTTAAAGAGGGGG - Intergenic
986754181 5:10819180-10819202 TGAAGCCCATTTTATAGAGGAGG - Intergenic
987008927 5:13740158-13740180 TGAATCTCATTTTGAAGTGGAGG - Intronic
988477788 5:31602895-31602917 TGAATTGCGTTTTAAAGTGGAGG - Intergenic
988812104 5:34795771-34795793 TCAATCTCACTTTAAAGAGGAGG - Intronic
988887554 5:35574497-35574519 TCAATCCCATTTTATAGATGAGG + Intergenic
989060505 5:37406544-37406566 TCAGTCCCATTTTATAGAGGGGG - Intronic
990481470 5:56215377-56215399 TGAATCCTCTCTGGAAGAGGTGG + Intronic
991610534 5:68445428-68445450 TGATTCCCATTTTACAGATGAGG + Intergenic
992188355 5:74265691-74265713 TTAATCCCATTTTGCAGAGGAGG - Intergenic
992871422 5:81009140-81009162 TTATTCCCCTTTTACAGATGAGG - Intronic
993322987 5:86497674-86497696 TGAATCCCTTTTGACAGAGATGG + Intergenic
993537172 5:89101182-89101204 TCAATCCTCTTCTAAAAAGGAGG - Intergenic
993811411 5:92482283-92482305 TTAATCCCTTTTTATAGACGTGG - Intergenic
994189858 5:96857560-96857582 TCAATCCCATTTTAAAGATAAGG + Intronic
994213095 5:97108016-97108038 TTATTCCCATTTTATAGAGGAGG - Intronic
994632308 5:102301137-102301159 TGAATTATCTTTTAAAGAGATGG - Intergenic
995085629 5:108105998-108106020 TTAATCCTATTTTAAATAGGGGG + Intronic
995430115 5:112065109-112065131 TGCATCTACTTTTACAGAGGAGG - Intergenic
996421663 5:123269604-123269626 TGAAGCCCATTTTACAGAAGAGG + Intergenic
996459203 5:123721909-123721931 CCAAACCCCTTTTAATGAGGGGG + Intergenic
997359587 5:133286223-133286245 TGAGTCCCATTTTAAAGAAGAGG - Intronic
999307733 5:150531289-150531311 TGAGTCCCATTTAACAGAGGTGG + Intronic
999552613 5:152705636-152705658 TGATTCCCATTTCAAAGATGAGG + Intergenic
1000064784 5:157685210-157685232 TGATTCCCATTTTACAGAGTAGG + Intergenic
1001229890 5:169977518-169977540 TTTATCCCCTTTTACAGATGAGG + Intronic
1001309534 5:170601044-170601066 TGAAGCCCATTTTATAGAGGAGG - Intronic
1001748825 5:174112238-174112260 TTATTCCCATTTTAAAGATGAGG - Intronic
1003052465 6:2792444-2792466 TGATACCCATTTTAAAGATGAGG - Intergenic
1003278377 6:4671746-4671768 TGATTCCCATTTTACAGATGTGG + Intergenic
1004046095 6:12025072-12025094 TGATTCCCATTTTATAGATGTGG + Intronic
1005160876 6:22862011-22862033 TTAATCCCATTTTAAACATGAGG - Intergenic
1005487924 6:26318872-26318894 TTAATCTCCCTTTAAAGAGGTGG + Intergenic
1005692592 6:28321860-28321882 TCAACTCCATTTTAAAGAGGGGG - Intergenic
1006805214 6:36783815-36783837 TTATTCCCATTTTAAAGATGAGG + Intronic
1006942993 6:37765306-37765328 TGAATCTCCTTTTAGAGGAGAGG - Intergenic
1007605810 6:43117158-43117180 TGAATGCTCTTTTAAACAGGTGG - Intronic
1007630149 6:43268990-43269012 TGACCCCCATTTTACAGAGGAGG + Intronic
1008040877 6:46796901-46796923 TGAATCATCTTTTAAACAGAGGG - Intronic
1008118106 6:47577058-47577080 TGAACTTACTTTTAAAGAGGGGG + Exonic
1008753789 6:54769424-54769446 TGTATCTCATTTTAAAGATGAGG + Intergenic
1009699144 6:67153770-67153792 TGTATCTCCTTTAATAGAGGAGG - Intergenic
1010731210 6:79393474-79393496 TTAATCCCATTTTATAGAGGAGG - Intergenic
1011698931 6:89937403-89937425 TTTATCCCCATTTACAGAGGAGG - Intronic
1011801033 6:91016572-91016594 TTATTCCCCTTTTAGAGATGAGG - Intergenic
1012958150 6:105592836-105592858 TGATTCCCATTTTATAGAAGTGG + Intergenic
1014288728 6:119533951-119533973 TAAATCCCATTTTATAGATGAGG + Intergenic
1015613229 6:135048356-135048378 GGAATCCCCTCTTTAAAAGGCGG + Intronic
1016155454 6:140801296-140801318 TGTAGCCCTTTTTAAAGAGTAGG + Intergenic
1017453625 6:154577702-154577724 TTATCCCCCTTTTAAAGATGAGG - Intergenic
1017668661 6:156748018-156748040 TGACACCACTTATAAAGAGGGGG - Intergenic
1021826797 7:24561494-24561516 TGACTCCCATTTTAAACAGGAGG - Intergenic
1021944745 7:25715682-25715704 TTATTCCCATTTTACAGAGGAGG + Intergenic
1022568488 7:31427672-31427694 TGACTCTCCTTTTGAGGAGGGGG + Intergenic
1022954654 7:35370024-35370046 GAAATCCCGTCTTAAAGAGGAGG - Intergenic
1023272248 7:38476762-38476784 CCAATCTCCTTTTATAGAGGAGG + Intronic
1023555682 7:41420348-41420370 TCAATCCCATTTTAAAGAAGAGG - Intergenic
1023946425 7:44806528-44806550 TGAAACCCAATTTATAGAGGTGG + Intronic
1024183314 7:46919903-46919925 AGAATCCCTTTTTATAGATGTGG + Intergenic
1024312660 7:47983644-47983666 TTATTCCCATTTTAAAGATGGGG + Intergenic
1024595938 7:50937624-50937646 TGATCCCCCTTTTATAGATGAGG - Intergenic
1024739310 7:52337547-52337569 ACAATTTCCTTTTAAAGAGGTGG - Intergenic
1028051556 7:86194237-86194259 TAAGTCCCCTTTTGAAAAGGTGG - Intergenic
1028445008 7:90912119-90912141 TGAATCTCCTTTTATAAAGATGG + Intronic
1028729200 7:94125891-94125913 TTATTTCCATTTTAAAGAGGGGG - Intergenic
1030730704 7:112984691-112984713 TTAATCCCCATTTATAGATGAGG - Intergenic
1031123905 7:117751631-117751653 TGAGGTCCCTTTTAAAGAAGAGG + Intronic
1031152284 7:118068078-118068100 TGGATCCCATTTTATAGATGAGG - Intergenic
1031780953 7:125963534-125963556 TTACTCACCTTTTAAAGAGAAGG + Intergenic
1032792256 7:135251251-135251273 TGATTCCTGTTTTATAGAGGAGG + Intronic
1032984239 7:137319221-137319243 TTAATCCCATTTTACAGATGAGG - Intronic
1033444990 7:141412813-141412835 TTAATCCCATTTTACAGAGGGGG + Intronic
1033609407 7:142951561-142951583 TGGTTCCTATTTTAAAGAGGAGG - Intronic
1035031309 7:155862951-155862973 GGAATCCCATTTTACAGATGTGG - Intergenic
1036242128 8:7090314-7090336 GGATTCCCATTTTATAGAGGAGG - Intergenic
1037347506 8:17915629-17915651 TCAAACTCCTCTTAAAGAGGGGG - Intergenic
1037865214 8:22437885-22437907 TGAATCTCCTTAGAAAGGGGTGG + Intergenic
1038067863 8:23982453-23982475 TGAATCCCCATTGAAAGTAGTGG - Intergenic
1038238298 8:25783823-25783845 TGATTCCCATTTTACAGATGAGG + Intergenic
1038880819 8:31609200-31609222 AGAATCCCCATTAAGAGAGGTGG + Intergenic
1039021787 8:33215900-33215922 TGAATCCTATTTAAAAGAGCAGG + Intergenic
1040527275 8:48236178-48236200 TGCATCCCCCTTTAAACATGGGG - Intergenic
1041471436 8:58213020-58213042 TGAATTTCCTTTTGAAGGGGAGG - Intergenic
1041550184 8:59091579-59091601 TGAAACCCATTTTACAGATGAGG - Intronic
1041675282 8:60532172-60532194 TGAACCCCTTTGGAAAGAGGTGG + Intronic
1042777366 8:72448306-72448328 TTACTCCCATTTTACAGAGGAGG - Intergenic
1043293216 8:78630142-78630164 TGTATCCCCTTTTATATAAGAGG + Intergenic
1043597514 8:81902434-81902456 ACAATCTCCTCTTAAAGAGGTGG - Intergenic
1043801314 8:84614057-84614079 TGGATCCCATTTTACAGATGAGG - Intronic
1043991322 8:86758920-86758942 TTATTACTCTTTTAAAGAGGAGG + Intergenic
1044114907 8:88324014-88324036 TGGATCCCTTTTTTAAGAGTTGG - Intronic
1044896144 8:96893579-96893601 TGATTCCCACTTTAAAGATGAGG + Intronic
1044929221 8:97235681-97235703 TGATTCCCATTTTATAGATGAGG + Intergenic
1045343351 8:101273356-101273378 TGCATCCACTTTTAAACACGGGG + Intergenic
1047172267 8:122505335-122505357 TTTATCCACTTCTAAAGAGGAGG + Intergenic
1047315849 8:123732224-123732246 TTAGTCCCCTTTTAAATATGGGG - Intronic
1047524002 8:125616932-125616954 TGATTCCCATTTTAAGGATGAGG + Intergenic
1047778212 8:128090991-128091013 TTATTCCCATTTTACAGAGGAGG - Intergenic
1048343769 8:133560855-133560877 TTAATCCCATTTTATAGATGTGG - Intronic
1048631457 8:136247339-136247361 TGCATCCACCTTTAAACAGGGGG + Intergenic
1048822266 8:138391280-138391302 TTATTCCCATTTTACAGAGGAGG + Intronic
1050338865 9:4615952-4615974 TCAAACCCATTTTAAAGATGAGG + Intronic
1050744275 9:8858217-8858239 AGAATCCGCTTTAAAAGAAGAGG - Intronic
1051103232 9:13547119-13547141 TGATTCCCATTTTATAGATGAGG - Intergenic
1051769143 9:20557371-20557393 TAATTCCCATTTTAAAGATGAGG - Intronic
1051778345 9:20660316-20660338 TTATTCCCATTTTAAAGATGAGG + Intronic
1051785771 9:20741816-20741838 TGAATTTCTTTTTAAAAAGGAGG - Intronic
1052996340 9:34553394-34553416 TGAATGCCGTTTTACAGATGAGG - Intronic
1053053269 9:34978470-34978492 TGAAGCCCCTGGTATAGAGGAGG + Exonic
1053388469 9:37715268-37715290 TTATTCCCCTTTTACAGATGAGG + Intronic
1053816552 9:41918157-41918179 TAAATCGATTTTTAAAGAGGAGG - Intronic
1055716914 9:79127833-79127855 TCATTGCCCTTTAAAAGAGGAGG + Intergenic
1056237802 9:84613110-84613132 TCAATCCCACTTTAAAGATGAGG + Intergenic
1056724618 9:89103758-89103780 TGAATCCCATTTTAAACATGGGG + Intronic
1058890046 9:109353888-109353910 TGAATCTCCATTTACAGAGGAGG + Intergenic
1058890549 9:109357129-109357151 TGGATCTCCATTTACAGAGGAGG + Intergenic
1059461416 9:114433012-114433034 TTAATCCCATTTTACAGATGAGG + Intronic
1059631129 9:116123788-116123810 TCAATCCCATTTCATAGAGGAGG + Intergenic
1059794887 9:117683369-117683391 TGAGTCCCTATTTAAAGATGGGG + Intergenic
1060088767 9:120724681-120724703 TGATCCCCATTTTACAGAGGAGG - Intergenic
1060850299 9:126869353-126869375 TGACTCCCATTTTAAAGATGAGG - Intronic
1061543862 9:131292461-131292483 TTATTCCCCATTTAAAGAGGGGG + Intronic
1061979978 9:134096807-134096829 AGAATCTCCTTTTGAAGAGCTGG - Intergenic
1187450651 X:19393248-19393270 TTCATCCCCTTTTATAGATGGGG - Intronic
1187787888 X:22913737-22913759 TGATTGCCCTTTTATAGAAGAGG + Intergenic
1189193865 X:39135246-39135268 TTATTCCCATTTTAAAGATGTGG + Intergenic
1189717093 X:43878118-43878140 TGAGTCTCATTTTAAAGATGAGG + Intronic
1190028187 X:46945833-46945855 GGAATCTCCTGTTAAAGAAGGGG - Intronic
1190407390 X:50101496-50101518 AGAAGCCCCTTTTCAAGAGGAGG - Intergenic
1192544019 X:71997683-71997705 TTATTCCCATTTTAAAGATGAGG - Intergenic
1193414378 X:81203732-81203754 TGAATCTACTTTTAAAGAAGGGG - Intronic
1193658430 X:84225920-84225942 TGAATACTCTTTTAAACAGATGG - Intergenic
1195768410 X:108321207-108321229 TAATTCCCATTTTAAAGATGAGG + Intronic
1196016770 X:110947864-110947886 TCAACCTCATTTTAAAGAGGGGG - Intronic
1196123630 X:112077103-112077125 TTAATCCCATTTTATAGATGGGG + Intronic
1196148311 X:112344254-112344276 TAAATCCTCTGTAAAAGAGGTGG - Intergenic
1196224362 X:113148147-113148169 TGCATCCCCTTTTTAAAAAGTGG - Intergenic
1196539882 X:116895320-116895342 TGATTCCCATTTTAATGAAGAGG + Intergenic
1197348618 X:125355479-125355501 AGAACCTCTTTTTAAAGAGGTGG + Intergenic
1198637251 X:138713231-138713253 TGAATCAAATTTTAAAGAAGTGG - Intronic
1199955321 X:152737076-152737098 TGAATGGGCTTTTAGAGAGGGGG + Exonic