ID: 1085588594

View in Genome Browser
Species Human (GRCh38)
Location 11:77735125-77735147
Sequence GAGGGAGGGCTGGCTATGGG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 612
Summary {0: 1, 1: 4, 2: 9, 3: 50, 4: 548}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085588584_1085588594 10 Left 1085588584 11:77735092-77735114 CCTTGGGGCGGTCTGAGGGTGCC 0: 1
1: 0
2: 2
3: 14
4: 134
Right 1085588594 11:77735125-77735147 GAGGGAGGGCTGGCTATGGGCGG 0: 1
1: 4
2: 9
3: 50
4: 548

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085588594 Original CRISPR GAGGGAGGGCTGGCTATGGG CGG Intronic
900338767 1:2177873-2177895 GAGGCAGGGCTGGCAGTCGGTGG - Intronic
900343397 1:2199265-2199287 GATGGAGGACAGGCTGTGGGAGG - Intronic
900411494 1:2514652-2514674 GGGTGGGGGCTAGCTATGGGGGG + Intronic
900472878 1:2863311-2863333 TAGGGGGTGCTGGCCATGGGAGG + Intergenic
900521165 1:3106146-3106168 CAGGGTGGGCGGGGTATGGGGGG + Intronic
900543892 1:3217927-3217949 GAGGGAGGGCCGGCAAGAGGGGG - Intronic
900700692 1:4047099-4047121 AAGGGAGGTCCAGCTATGGGAGG - Intergenic
901130989 1:6962555-6962577 GTGGGAAGGCTGGATGTGGGCGG - Intronic
901527840 1:9835434-9835456 CAGGGAGGGTAGGCTCTGGGAGG - Intergenic
901790831 1:11653158-11653180 GAGGGAGGGCTGGAGAGGTGAGG - Intronic
902980551 1:20119580-20119602 GAGGGAGGGCTGGGCAAGGCTGG - Intergenic
903291814 1:22318768-22318790 GAGGGAGGGTTGCCTGAGGGCGG - Intergenic
904094794 1:27968204-27968226 GAGAGAGGGCTGGCTTAGGTGGG + Intergenic
904260121 1:29283345-29283367 TCAGGAGGGCTGGCTATGGGAGG - Intronic
904317220 1:29673337-29673359 CAGGGAGGGCTTGCTGGGGGAGG - Intergenic
904701937 1:32362874-32362896 GAGGGAGGACTGGCTGAGGTGGG + Intronic
904917831 1:33983089-33983111 GAAGCTGGGCTGGCAATGGGAGG - Intronic
904985804 1:34547452-34547474 CAGGGAGGGCAGGGTATGGCTGG + Intergenic
905173281 1:36121780-36121802 GAGGGAGGGCAGCCTTTGTGAGG + Intronic
905378751 1:37544648-37544670 AACAGAGGGCTAGCTATGGGCGG - Intronic
905456661 1:38092749-38092771 GAGGAAGGACTGGGTAGGGGAGG + Intergenic
905665502 1:39760980-39761002 GAGGGAGGCCAGGGTGTGGGAGG - Intronic
905919812 1:41711883-41711905 AAGGGAAGGCAGGCTCTGGGCGG + Intronic
907532603 1:55116017-55116039 GGGGGTGGGCAGGCTAGGGGAGG + Intronic
908583406 1:65542605-65542627 GGGGGGTGGCTGGCTAGGGGAGG - Intronic
909055626 1:70817287-70817309 GAGGGAGGGAGGGAAATGGGTGG + Intergenic
909778251 1:79511384-79511406 GAGGGAGGGATAGCATTGGGAGG - Intergenic
909855212 1:80521026-80521048 AAGGGAGGGTTGGGGATGGGAGG + Intergenic
910150284 1:84134235-84134257 GGGGCAGGGCAGGCCATGGGTGG + Intronic
912275720 1:108256543-108256565 GAGGGAGGGCAGGGGAGGGGAGG - Intergenic
912292506 1:108437811-108437833 GAGGGAGGGCAGGGGAGGGGAGG + Intronic
912374801 1:109201391-109201413 CTGGGAGGGCTGGCTTTGTGTGG + Intronic
912509956 1:110182569-110182591 GAGGGCGGGATAGCTGTGGGTGG + Intronic
912884396 1:113454637-113454659 GAGGGATGGGGGGCTAGGGGAGG - Intronic
914433595 1:147641099-147641121 GAGGCTGGGCGGGCTGTGGGGGG - Intronic
914711803 1:150221446-150221468 GAGGGAGGGCAGGCTAAGAGAGG + Intronic
914846131 1:151284319-151284341 AAGGAAGGGCTGGCTAGGGGAGG + Intronic
914937611 1:151994096-151994118 GAGGAAGGGCAGGCTCAGGGTGG - Exonic
915274931 1:154781962-154781984 CAGGGAGGGCTCTCTATGGAAGG + Intronic
915299934 1:154946101-154946123 GAAGGAGGGCAGGCCAAGGGTGG - Exonic
915555851 1:156660255-156660277 GGGGGGTGGCTGGCTATGTGGGG + Intergenic
915743472 1:158138166-158138188 GAGGAAGAGATGGGTATGGGGGG - Intergenic
916583791 1:166131821-166131843 GCGGCAGGGCTGTCTAGGGGTGG + Intronic
918449127 1:184642026-184642048 GAGGAGGGGCTGCTTATGGGAGG - Intergenic
920727588 1:208450603-208450625 GAGGGAGGGGCGACAATGGGAGG + Intergenic
921464187 1:215465782-215465804 GAGGGAGGGATGGGAATGGAGGG - Intergenic
923140883 1:231161269-231161291 GAGGGAAGGCTGGGTGGGGGAGG - Intergenic
924075410 1:240329192-240329214 GAGGGCGTCCAGGCTATGGGTGG + Intronic
924135228 1:240958798-240958820 GAGGGAGGGCTGTATTTGGGTGG - Intronic
924794874 1:247285929-247285951 GAGGCAGGGCTGTCCATGGGTGG - Intergenic
1065670724 10:28113927-28113949 GAGGGATGGCGGGCCATGGGAGG - Intronic
1066589759 10:36981657-36981679 GAGGGAGGAGGGGATATGGGAGG + Intergenic
1068272593 10:54748266-54748288 GAGGGATGTGTGGTTATGGGAGG - Intronic
1068281557 10:54877756-54877778 GAGGAAGGGCTGGTAATGGAAGG - Intronic
1068938729 10:62660280-62660302 GAGGGAGAGAAGGCTAAGGGAGG + Intronic
1069125585 10:64628724-64628746 GGGGCAGGGCAGGCCATGGGTGG - Intergenic
1070005382 10:72419460-72419482 GAGGGCAGGCTGGCTCTGAGAGG - Intronic
1070166731 10:73904487-73904509 AAAGGAAGACTGGCTATGGGTGG + Intergenic
1070325480 10:75386004-75386026 GAGGGAGAGCAGGCTTTGGCAGG - Intergenic
1070555838 10:77527277-77527299 GGGGGTGGCCTGGCTATGGATGG - Intronic
1070602791 10:77877568-77877590 GAGGGAGGGAAGGCAGTGGGAGG + Intronic
1070613272 10:77949227-77949249 GGGGGAGGGCTGGCTAGGGCTGG - Intergenic
1070627446 10:78061442-78061464 GAGGCAGGGCTTCCTGTGGGTGG + Intergenic
1070848992 10:79547645-79547667 GAGGGAGGGCTGGAAATCGCTGG + Intergenic
1070924799 10:80212550-80212572 GAGGGAGGGCTGGAAATCGCTGG - Intergenic
1071152628 10:82652619-82652641 CAGGTAGGGCAGGCCATGGGTGG + Intronic
1071343384 10:84668331-84668353 GAGGGAAGGCAGGCTGGGGGTGG - Intergenic
1071371074 10:84952418-84952440 GAGGGAGTGCTAGGTGTGGGTGG + Intergenic
1072826685 10:98613750-98613772 GAGGGACTGCTAGCTAGGGGAGG - Intronic
1073070228 10:100788556-100788578 GAGTGAGGGCTGGGTATGGCTGG + Intronic
1073924278 10:108497143-108497165 GGGGGAGGGATGGCAATGGGAGG - Intergenic
1074655363 10:115581871-115581893 GGGGGAGGGATAGCAATGGGAGG - Intronic
1074874462 10:117603167-117603189 GTGTGAGGGGTGGCTATGTGTGG + Intergenic
1075204010 10:120431162-120431184 GAGGGAAGGCTGGTTTTAGGGGG - Intergenic
1075595145 10:123723888-123723910 GAAGTAGCGCTGGTTATGGGGGG - Intronic
1075722550 10:124595921-124595943 GAGGGAGGCTTGGGTATTGGAGG - Intronic
1075746912 10:124734509-124734531 GAGCGAGGGCTGCATAAGGGAGG - Intronic
1076048334 10:127312791-127312813 GAGGGAGTGATGGCTGTGAGGGG - Intronic
1076195504 10:128514720-128514742 CAGGCTGGGCTGGCTTTGGGAGG + Intergenic
1076520324 10:131077106-131077128 GAGGCAGGACTGGCTGTGGCAGG + Intergenic
1076806447 10:132861550-132861572 TGGGGAGGCCTGGCTCTGGGAGG - Intronic
1076829380 10:132986337-132986359 GAGGAAGGGGCGGCTCTGGGTGG + Intergenic
1077141460 11:1026706-1026728 GAGGGTGGGCTGCCCATGTGTGG - Intronic
1077326558 11:1966591-1966613 GAGGAGGGGCTGGGTATCGGGGG - Intronic
1077404081 11:2375024-2375046 CAGGGAAGACTGGCTATGAGGGG - Intergenic
1077573325 11:3357165-3357187 GAGGGAGGGATGGCTATGGAGGG + Intronic
1077882789 11:6364144-6364166 ATGGGAGGCCTGCCTATGGGAGG - Intergenic
1078124267 11:8544152-8544174 GGGGGATGGGGGGCTATGGGAGG - Intronic
1079095819 11:17509546-17509568 GGGGGAGGGATGGGAATGGGGGG + Exonic
1079202047 11:18384716-18384738 GAGGGAGCTCAGGCTGTGGGGGG - Intergenic
1079312444 11:19378601-19378623 GATGGAGGGCTGGGTGGGGGTGG + Intronic
1079805378 11:24924050-24924072 GAGTGGGGGCTGGGTGTGGGGGG - Intronic
1079993196 11:27268029-27268051 CAGGGAGTGGGGGCTATGGGAGG - Intergenic
1080002312 11:27363370-27363392 GAGGAAGGGCTGGCTAAGGGAGG - Exonic
1081636735 11:44726895-44726917 GAGGGAGGGCGGGGGAGGGGAGG + Intronic
1081693461 11:45093951-45093973 GAGTCAGGGCTGGCACTGGGAGG + Intergenic
1081854732 11:46296199-46296221 GAGGGAGGGCTGGGTGTGGTTGG + Intronic
1082163207 11:48907211-48907233 GTGGGAGCACTGGCTATGGGTGG - Intergenic
1082169603 11:48987425-48987447 GTGGGAGTGCTGCCTATGGGTGG + Intergenic
1082173680 11:49036407-49036429 GTGGGAGTGCTGCCTGTGGGTGG - Intronic
1082234613 11:49808644-49808666 GTGGGAGTGCTGCCTATGGGTGG - Intergenic
1082658432 11:55879660-55879682 GTGGAAGTGCTGTCTATGGGTGG - Intergenic
1082769048 11:57191577-57191599 GTGGGAGGGCTGGGGAGGGGTGG + Exonic
1083342456 11:61967524-61967546 GACGGAGGGCTGGCTATGGGCGG + Exonic
1083651971 11:64209162-64209184 GAGGGGGAGCTGGCTAGGAGAGG + Intronic
1083756864 11:64796609-64796631 GAGGCCCGGCTGGCTGTGGGGGG - Intronic
1084005526 11:66321418-66321440 AAGGGAGGGGTGGGGATGGGAGG + Intergenic
1084266914 11:68009890-68009912 GAGGGAAGGCTGGGAGTGGGGGG + Intronic
1084314578 11:68337700-68337722 GAGGTAGACCTGACTATGGGTGG - Intronic
1084314586 11:68337743-68337765 GAGGAAGATCTGGCTGTGGGTGG - Intronic
1084590055 11:70085290-70085312 GGGGGAGGGCTGGCTTTTGAGGG - Intronic
1085250963 11:75143653-75143675 GAGGGAGGTCTGGAGATGGATGG + Intronic
1085588594 11:77735125-77735147 GAGGGAGGGCTGGCTATGGGCGG + Intronic
1085898311 11:80666363-80666385 GAGGGAGGAGGGGATATGGGAGG - Intergenic
1086692088 11:89799685-89799707 GTGGGAGTGCTGCCTGTGGGTGG + Intronic
1086696234 11:89849216-89849238 GTGGGAGTGCTGCCTGTGGGTGG - Intergenic
1086702293 11:89913173-89913195 GTGGGAGTGCTGCCTGTGGGTGG + Intronic
1086703874 11:89931277-89931299 GTGGGAGTGCTGCCTGTGGGTGG - Intergenic
1086709922 11:89995273-89995295 GTGGGAGTGCTGCCTGTGGGTGG + Intergenic
1086713711 11:90039971-90039993 GTGGGAGTGCTGCCTGTGGGTGG - Intronic
1088722452 11:112606408-112606430 GAATGAGGGCTGGGTTTGGGGGG + Intergenic
1088805862 11:113351509-113351531 GAGGAAAAGCTGGATATGGGTGG + Intronic
1089372453 11:117971023-117971045 GAGGTATGGCTGGCTCTGGCAGG - Intergenic
1090161857 11:124503651-124503673 GAGGGAGGTATGGCTATAAGAGG + Intergenic
1090406507 11:126478952-126478974 GAGGGAAGCCTGGCTGAGGGGGG + Intronic
1090526874 11:127546683-127546705 GGGGGAGGGCTAGTTATGGAAGG + Intergenic
1090857538 11:130623470-130623492 GAGGGAGGAGTGGATATGAGTGG + Intergenic
1091225749 11:133955914-133955936 GAGGCAGAGCTGGCTGGGGGCGG - Intronic
1091301494 11:134510746-134510768 CAGGGAGGGCTGCGTGTGGGAGG - Intergenic
1091309654 11:134563317-134563339 GAAGGAGAGCTGGCTCTGGGTGG + Intergenic
1202809539 11_KI270721v1_random:21770-21792 GAGGAGGGGCTGGGTATCGGGGG - Intergenic
1091465274 12:678523-678545 GAGGAAGGGATGGCGATGGGTGG + Intergenic
1091544728 12:1493997-1494019 GAGGGCGGGATGGTTCTGGGAGG - Exonic
1091793196 12:3283222-3283244 GGGGTAGGGCAGGCTGTGGGGGG - Exonic
1092057952 12:5522884-5522906 GAAGCAGGGCTGGAGATGGGAGG - Intergenic
1092774976 12:11935960-11935982 GAGGGAGGGATAGCATTGGGAGG - Intergenic
1093275739 12:17123126-17123148 GAGGGAGGCAGGGGTATGGGTGG - Intergenic
1093905264 12:24684014-24684036 GAGGGCTGGCGGGCTAGGGGAGG - Intergenic
1096469714 12:51868672-51868694 GAGTGTGGGCTGGGGATGGGAGG - Intergenic
1096582135 12:52592528-52592550 GAGGGAGGGATGGGCAGGGGAGG - Intronic
1096682240 12:53264069-53264091 GAGGGATGGGTGGCTAGGGGAGG - Intergenic
1097036759 12:56129289-56129311 GACGGAGGGAGGGCTACGGGAGG + Intronic
1097157993 12:57026653-57026675 GAGGCAGGGCTGGGGAGGGGAGG + Intronic
1097240421 12:57571397-57571419 GAGGGAGGGCAGGACATGAGAGG + Intronic
1098539469 12:71637934-71637956 GTGGGAGGACTGGAGATGGGGGG + Intronic
1098579724 12:72085159-72085181 GCAGTAGGGGTGGCTATGGGTGG + Intronic
1098860339 12:75702576-75702598 GAGGGAGGGCAGGGGAGGGGAGG + Intergenic
1098872938 12:75836941-75836963 TGGGGTGGGCTGGGTATGGGAGG - Intergenic
1099189397 12:79547292-79547314 GTGGGAGGGATGGGTTTGGGGGG - Intergenic
1100458060 12:94771989-94772011 GAGGGAGAGCTGGATCTGGTGGG - Intergenic
1100594608 12:96061122-96061144 GGGGCAGGGCAGGCTGTGGGTGG + Intergenic
1101977999 12:109378793-109378815 GAGGGAGGGAGGGATAGGGGTGG + Intronic
1102299761 12:111762710-111762732 GAGAGAGGGCAGGACATGGGTGG + Intronic
1102704673 12:114870667-114870689 GAAGGAGGGCTGGCCAAGTGGGG + Intergenic
1103330241 12:120149229-120149251 GAGGGAGAGCTGGCCAGGCGTGG + Intronic
1103962589 12:124618190-124618212 GAGGCAGGGCTGGCTGGGGTTGG + Intergenic
1104278532 12:127352772-127352794 GAGAGATGGCTGGGTGTGGGTGG - Intergenic
1104691110 12:130827071-130827093 GAGGGAGGGGTGGGGAGGGGAGG + Intronic
1104804071 12:131573856-131573878 GAGGAAGGGGTGGCCAGGGGCGG + Intergenic
1105450163 13:20492558-20492580 CAGGGTTGGCTGGCTATGGAGGG - Intronic
1105678092 13:22696676-22696698 GACGGAGGGCTGGCTATGGACGG + Intergenic
1105841066 13:24254012-24254034 GAGGGAGGGCAGTTTGTGGGGGG + Intronic
1106031957 13:26012300-26012322 CAGGAAGCGCTGGCTAAGGGAGG + Intronic
1106177329 13:27342520-27342542 GAGGGAGGTCTGCATGTGGGTGG - Intergenic
1106611756 13:31290008-31290030 GAAGGTGGGGTGGCTAGGGGAGG - Intronic
1107021414 13:35756248-35756270 GTGGCAAGGCTGGTTATGGGAGG + Intergenic
1108316523 13:49242480-49242502 GGGGCAGGGCGGGCCATGGGTGG - Intergenic
1108323358 13:49307124-49307146 GGGGGTGGGCTGGGGATGGGGGG - Intergenic
1109410586 13:61961326-61961348 GAGAGAGAGATGGCTATGAGAGG - Intergenic
1111331477 13:86764788-86764810 GAGAGAGGGATGGCTATGGAGGG + Intergenic
1112463871 13:99626153-99626175 GAGGCAGGGGTGGCTTTTGGAGG + Intronic
1112572357 13:100605457-100605479 GAAGCAAGGCTGGGTATGGGAGG + Intronic
1113272232 13:108686139-108686161 CAGGCAGAGTTGGCTATGGGAGG + Intronic
1113699568 13:112374590-112374612 GAGGGATGTCTGGCTAAGGCAGG - Intergenic
1114245498 14:20909635-20909657 GAGGGAGGGTAGGGTAGGGGAGG + Intergenic
1115151057 14:30286126-30286148 GAGGGAGGCCTGGCAATACGTGG - Intergenic
1115650359 14:35398683-35398705 CAGGGAGGGCTGGGTGTGGTGGG + Intergenic
1116292045 14:43056582-43056604 GAGGAAGGGATGGGTGTGGGTGG - Intergenic
1116337411 14:43675090-43675112 GGGGGATGGGGGGCTATGGGAGG - Intergenic
1117625456 14:57632880-57632902 GAGGGAGGGATGGATAGGGAGGG - Intronic
1118765978 14:68909615-68909637 GGGGTAGGGCTGGATATGGCAGG - Intronic
1118782550 14:69018576-69018598 GAGGGTGGGCTAGTTATGGTGGG + Intergenic
1119851952 14:77872566-77872588 GATGGGGGGCTGGCCTTGGGGGG + Intronic
1121764918 14:96478178-96478200 GAGGGAGGGCGGGGGAAGGGAGG + Intronic
1121896728 14:97655606-97655628 GAGGGAGGGGGGACTTTGGGAGG + Intergenic
1121985254 14:98498873-98498895 GAGGGCGGGCAGGCGAAGGGAGG + Intergenic
1122505246 14:102227756-102227778 GAGGGAGGGCAGGCTGGAGGAGG - Intronic
1122858463 14:104571522-104571544 GAGGGAGGGCTGGGGAGGGCTGG - Intronic
1122975311 14:105168489-105168511 GAGGGCGGGCGGGCGCTGGGAGG - Exonic
1122975986 14:105170975-105170997 GGGGGACGGGTGGCTCTGGGAGG - Intergenic
1124130814 15:26984013-26984035 GAGGGAGGGCTTCCTGTAGGGGG - Intronic
1125281226 15:38044338-38044360 GAGGGAGGGAAGGGTAGGGGAGG + Intergenic
1125518243 15:40334759-40334781 GAGGGAGGCCAGGCCCTGGGGGG + Exonic
1125793795 15:42389596-42389618 GAAGGAGGCCTGGCCATGGGCGG - Intronic
1126778416 15:52118977-52118999 GAGTGGGGGCTGCCTATGGATGG + Exonic
1127776805 15:62270288-62270310 TAGGGAGGTCTGGCTTGGGGTGG + Intergenic
1128146902 15:65336997-65337019 GGGGGAGGGCTTCCTCTGGGAGG - Intronic
1128553942 15:68617212-68617234 GAGTGGGGGCTGGGGATGGGTGG + Intronic
1128987993 15:72235223-72235245 GTGGAAGGGCTGGCTCTAGGGGG - Intergenic
1129194460 15:73955790-73955812 GAGGGAGGGGAGGAAATGGGAGG + Intergenic
1129245367 15:74276012-74276034 GAGGGATGGCTGGGTAAGGTTGG - Intronic
1129253870 15:74323035-74323057 GAGGGAGGGATGCATAGGGGAGG - Intronic
1129265783 15:74392419-74392441 GAGGAGGGGCAGGCTAGGGGTGG - Intergenic
1129607968 15:77034069-77034091 GAGGGAGGCCTGGCTGCTGGAGG + Intronic
1129692538 15:77721909-77721931 GAGGGAGGTCACGCTTTGGGGGG - Intronic
1130282642 15:82531810-82531832 GTGGGAGGGCTGGGGACGGGAGG + Intergenic
1130420769 15:83745021-83745043 GGGGCAGGGCAGGCCATGGGTGG - Intronic
1131132106 15:89906796-89906818 CATGGAGGGCTTGCTATGGTTGG + Intronic
1131442090 15:92467014-92467036 CAGTGAGGGCTGGCTGAGGGTGG - Exonic
1131593794 15:93775942-93775964 GAGGGAGGGCAGGCTGTGTGAGG + Intergenic
1132314394 15:100879722-100879744 AAGGGAGGGCGGGCTGCGGGAGG - Exonic
1132425621 15:101713806-101713828 GAGGCATGGCTAGCTATGGCTGG + Intronic
1132557298 16:578274-578296 GAGGGAAGGCTGGCCAAGGTGGG + Intronic
1132567684 16:630850-630872 GGGGAAGGGCTGGCTCTGGCTGG - Intronic
1132764229 16:1526304-1526326 GTGGGAGGGGGGGCTGTGGGAGG - Intronic
1132945235 16:2528619-2528641 CAGAGAGGGCAGGCTCTGGGGGG - Exonic
1133038570 16:3047559-3047581 GAGGCAGGGCTGGGGAGGGGTGG - Intronic
1133233583 16:4377621-4377643 GAGGGAAGGCTGACTGTGGAGGG - Intronic
1133304570 16:4801360-4801382 GAGGGAGGGCTGGGTGGTGGGGG - Intronic
1133634696 16:7653974-7653996 GAGGGAGGGCTGGTGCAGGGAGG - Intronic
1133922518 16:10166409-10166431 GAGGGAAGGCTGGCTCATGGAGG - Intronic
1133944446 16:10336755-10336777 GGTGGAGGGTTGGCTGTGGGTGG - Intronic
1134250240 16:12569104-12569126 TAGGGATGGCTGGCTTTGCGGGG + Exonic
1134446698 16:14336569-14336591 GAGGGCGGCCTGGTTATGGGTGG - Intergenic
1134663878 16:16004117-16004139 TAGGGAGGACTGGCTGTGGTGGG + Intronic
1135274723 16:21102302-21102324 GAGTGAGGGGTGGCTCTGTGAGG - Intronic
1135940935 16:26821173-26821195 GAGGTGGGGGTGGCTATGAGAGG + Intergenic
1136016756 16:27405667-27405689 GAGGGAGAGGGGGCAATGGGAGG + Intronic
1136073683 16:27804251-27804273 GAGGCAGGGAGGGCAATGGGAGG - Intronic
1136223325 16:28842914-28842936 GAGGGAGCCCTGGCTAGGGCAGG + Exonic
1136381241 16:29896917-29896939 GAGGCAGGGCTGGGTGGGGGTGG + Exonic
1136471866 16:30486091-30486113 GATGGAGGACTGGTTATGGAGGG + Intronic
1137265531 16:46865997-46866019 GAGGGAGGGATGGTTATGATTGG + Intergenic
1137979360 16:53056241-53056263 AAGGAAGGGCTGCCTATGGGGGG - Intronic
1138556215 16:57772584-57772606 GAGGGTGGGCTGCCGTTGGGTGG - Intronic
1141442235 16:84036949-84036971 GAGGGGTGGCTGGCTGGGGGTGG - Intronic
1141766428 16:86062698-86062720 TCTGGAGGGCAGGCTATGGGCGG + Intergenic
1142179306 16:88659617-88659639 TAGGGAGGGCTGGCTTTGGTTGG - Intronic
1142288574 16:89182098-89182120 GGGGGAGGGCAGGCTGGGGGAGG - Intronic
1142288581 16:89182113-89182135 GGGGGAGGGCAGGCTGGGGGAGG - Intronic
1142288596 16:89182143-89182165 GGGGGAGGGCAGGCTGGGGGAGG - Intronic
1142288611 16:89182173-89182195 GGGGGAGGGCAGGCTGGGGGAGG - Intronic
1142288618 16:89182188-89182210 GGGGGAGGGCAGGCTGGGGGAGG - Intronic
1142288633 16:89182218-89182240 GGGGGAGGGCAGGCTGGGGGAGG - Intronic
1142288640 16:89182233-89182255 GGGGGAGGGCAGGCTGGGGGAGG - Intronic
1142760147 17:2037205-2037227 GAGGGTGGGCTGGAAATGGTGGG + Intronic
1143052496 17:4137666-4137688 AAGGGATGGCTGGCTGTGGATGG - Intronic
1143090414 17:4446474-4446496 AGGGAAGGGCCGGCTATGGGAGG + Intronic
1143098049 17:4488984-4489006 TGGGGAGGGCTGGCTCTGCGGGG + Intergenic
1143584101 17:7842848-7842870 GAGGGAGGGCTTTGTACGGGGGG + Intronic
1144667421 17:17111551-17111573 GAGGGAGACCTGGCAACGGGTGG + Intronic
1145268315 17:21391157-21391179 GAGGGATGCCTGGGTATGGATGG + Intronic
1146941621 17:36847525-36847547 GAGGGAGGTCTTCCTCTGGGAGG + Intergenic
1148850137 17:50550628-50550650 CAGGCAGGCCTGGCTGTGGGAGG + Intronic
1148909139 17:50931201-50931223 GAGGGAGGGCGGGCTGAGGCGGG - Intergenic
1149317564 17:55452927-55452949 TAGGGAGGGCTAGGAATGGGTGG + Intergenic
1150108770 17:62479579-62479601 AAGGGAGGGCCGGCTCTCGGGGG - Intronic
1150727901 17:67666455-67666477 GAGAGAGGTGTGGCTTTGGGAGG + Intronic
1151210764 17:72542299-72542321 CAGGGAGGGCTGTGTAGGGGAGG + Intergenic
1151569157 17:74917495-74917517 GAGGGGGAGCTGGCTATGCTTGG + Exonic
1151682461 17:75629248-75629270 GAGGCAGCGCTCACTATGGGGGG - Exonic
1151903826 17:77035036-77035058 GAGGGAGGGTTTGCAAAGGGGGG - Intergenic
1151947501 17:77327547-77327569 CAGTGGGGGCTGGGTATGGGAGG + Intronic
1151984912 17:77536046-77536068 CAGGGAGGGCTGGGGATAGGAGG - Intergenic
1152276303 17:79359655-79359677 CAGGGAGGGCTGGCTCTGCAGGG + Intronic
1152280119 17:79380186-79380208 GGGGGAGGGGTGGCAAGGGGGGG - Intronic
1152282113 17:79390931-79390953 GAAGCAGAGCTGGCTTTGGGTGG - Intronic
1152343578 17:79738323-79738345 GAGGGAGTTCTGGCTTTTGGGGG - Intronic
1152354273 17:79799186-79799208 GAGGGTGGGCTTTCTCTGGGCGG - Intronic
1152386833 17:79979848-79979870 GACAGAGGCCTTGCTATGGGTGG + Intronic
1152485011 17:80584966-80584988 GAGCGTGAGCTGGCTATGGCTGG + Intronic
1152595542 17:81236062-81236084 GAGGGAGGCCTGGCTCCAGGTGG - Intronic
1152600425 17:81259489-81259511 GTGGGAGGGCTGGCCTGGGGAGG + Intronic
1152844031 17:82588382-82588404 CCGGGAGGGCTGGCGATTGGAGG + Intronic
1152844040 17:82588412-82588434 GTTGGAGGGCTGGCTATTGGAGG + Intronic
1153312813 18:3694022-3694044 GAGGGGGGGGTGGCTAGGGGAGG - Intronic
1154485232 18:14867311-14867333 GAGGGGGGGCAGGTTAGGGGTGG + Intergenic
1155519694 18:26656454-26656476 GGAGGAGGGCTGGAGATGGGAGG + Intronic
1155715998 18:28944652-28944674 GAGGGTGGGGTGGAGATGGGTGG - Intergenic
1156298837 18:35817923-35817945 GAGGGTGGCCAGGCTAAGGGTGG - Intergenic
1156496044 18:37525603-37525625 GAGGGAGGGGTGGGGAGGGGCGG + Intronic
1156621080 18:38852792-38852814 GAGTTTGGGTTGGCTATGGGAGG + Intergenic
1157194708 18:45611286-45611308 GAGGAAGGGCTGTCCCTGGGAGG - Intronic
1157479626 18:48045122-48045144 GAGGGAGGGAAGGATTTGGGTGG + Intronic
1157609210 18:48945752-48945774 GAGGAATGGCTGGCCTTGGGGGG - Intronic
1158159563 18:54465586-54465608 AGGGCAGGGCAGGCTATGGGTGG + Intergenic
1158196134 18:54886995-54887017 GAGGGAGAGTTGGCGAGGGGAGG - Intronic
1158710341 18:59831746-59831768 GAGGCAGGGGTGTCCATGGGAGG - Intergenic
1158941952 18:62412688-62412710 GAGGAAGGGCTGAGGATGGGAGG - Intergenic
1159005375 18:63005620-63005642 GAGGGTGTGCTGGCAGTGGGGGG - Intergenic
1159030561 18:63226270-63226292 GAGGCAGGGCAGGCCATGGGTGG + Intronic
1160350964 18:78177939-78177961 GATGGGGAGCAGGCTATGGGTGG - Intergenic
1160682429 19:417959-417981 GAGGGAGGGCCGGCAGGGGGAGG - Intronic
1160710434 19:548829-548851 GGGGGAGGGGTGGCAGTGGGGGG - Intronic
1160843560 19:1156992-1157014 GATGGGGGGCTGGCAGTGGGCGG - Intronic
1160898096 19:1412239-1412261 GAGGGAGTCCAGGCTATGGAGGG + Intronic
1161114475 19:2489059-2489081 GAGGGAGCGCTGGCGAGGGTGGG - Intergenic
1161226105 19:3146735-3146757 CAGGGAGGACAGGCTGTGGGGGG - Intronic
1161558669 19:4958414-4958436 GGCAGAGGGCTGGCTGTGGGGGG + Intronic
1161894339 19:7069302-7069324 GAGGCAGGGCTGAGTGTGGGTGG - Intergenic
1161957847 19:7506330-7506352 AGGGGAGGGCTGGTTAGGGGCGG - Intronic
1162775130 19:12974878-12974900 GAGGGCGGCCTGGCTTTGGGCGG + Intergenic
1163020504 19:14478659-14478681 GAGTGAGGGCTGCCTGGGGGAGG - Intronic
1163055123 19:14712190-14712212 TAGGGAGAGCAGGCTTTGGGAGG + Intronic
1163162050 19:15470613-15470635 AAGGGAGGGGTGGCGAGGGGAGG - Intronic
1163699554 19:18780561-18780583 GAGGGATGGATGGACATGGGGGG - Exonic
1164580732 19:29433421-29433443 CAGGAAGGACTGGCTCTGGGTGG - Intergenic
1164646242 19:29860540-29860562 GAGGAAAGGGTGGCCATGGGGGG - Intergenic
1164981681 19:32619225-32619247 GAGGAAGGGCTGGGGAGGGGAGG - Intronic
1166113878 19:40640856-40640878 GAGAGAAGGCAGGCTGTGGGTGG + Intergenic
1166133268 19:40759635-40759657 GAGGAAGGTCTGGCAGTGGGAGG - Intronic
1166536976 19:43580607-43580629 GAGAGAGGGGTGGCCGTGGGTGG + Intronic
1166855400 19:45780666-45780688 GAGAGAGGGATGGGTATGGGAGG + Intronic
1166995087 19:46716354-46716376 GAGGGGGCGGTGGCCATGGGGGG + Exonic
1167148344 19:47695351-47695373 GAGGGAGGCCTGGGGGTGGGTGG - Exonic
1167152153 19:47716548-47716570 GATGGAGAGCTGCCTGTGGGAGG - Exonic
1167272260 19:48511993-48512015 GAGGGAGGGGAGGAAATGGGAGG + Intronic
1167513790 19:49910885-49910907 GAGGGAGTGCTGAATAGGGGTGG + Intronic
1167603542 19:50467901-50467923 GAGGGAGGGGTGGCAAGGTGGGG - Intronic
1167650101 19:50724298-50724320 GAGGGCGGGGTGGCGGTGGGGGG - Intronic
1167676244 19:50887880-50887902 GAGGGAGTGCTGGGTCAGGGAGG + Intergenic
1168277022 19:55284241-55284263 GAGGGGGGGCTGGCCCGGGGGGG - Exonic
1168286751 19:55339101-55339123 GAGGGAGGGGAGGCTGAGGGAGG - Intergenic
925294168 2:2766900-2766922 AACGGAGGGCTTGCTATGGGTGG - Intergenic
925430550 2:3788827-3788849 GAGGGAGGGTTGGGGAAGGGAGG - Intronic
925509022 2:4603717-4603739 GCAGGAGGGCTGGATTTGGGAGG - Intergenic
925784793 2:7421564-7421586 GAGAGAAGGCAGGGTATGGGGGG - Intergenic
926930329 2:18031610-18031632 GAGAGAGGGGTGGCAAGGGGAGG - Intronic
927102817 2:19800966-19800988 CAGGGAGGGCAGGCTATTAGGGG - Intergenic
927968515 2:27288035-27288057 AACAGAGGGCTAGCTATGGGCGG - Intronic
927983835 2:27393469-27393491 GACGGAGGGCTGGCTATGGGCGG + Intronic
928195531 2:29214067-29214089 GGAGGAGGGCTGGCTCTGTGGGG + Exonic
928465917 2:31522276-31522298 AAGGGAGGGTTGGCAATGGAAGG - Intergenic
929444509 2:41991965-41991987 GGGGGAGGGCAGGGTAGGGGAGG + Intergenic
931216895 2:60253705-60253727 AAGGGAGGGCATGCTGTGGGGGG - Intergenic
931634796 2:64331503-64331525 GAGAGGGGGCTGGCCATGGAAGG - Intergenic
931738038 2:65215937-65215959 GAGGGAAGGATGGATATTGGGGG - Intergenic
932605142 2:73160370-73160392 GAGGGTGGGGTGCCCATGGGAGG + Intergenic
933069254 2:77836779-77836801 GAGGGAGGGCAGGGGAGGGGAGG + Intergenic
933780233 2:85795993-85796015 GAGAGAGGGCTGGCTCTGAGAGG - Intergenic
934579734 2:95428435-95428457 AAGGGAGGTCTGGCTAAAGGAGG - Intergenic
934599713 2:95648290-95648312 AAGGGAGGTCTGGCTAAAGGAGG + Intergenic
934650025 2:96085404-96085426 GAGGGAGGGCTGGGACTGAGGGG + Intergenic
934768603 2:96894386-96894408 GTGGGAGGCCTGGGTATGTGTGG - Intronic
935175869 2:100648310-100648332 GAGACAGGGCAGGCCATGGGTGG - Intergenic
935332707 2:101988735-101988757 GAGGGAGAGCAGGCTCTGGAGGG + Intergenic
935338487 2:102038224-102038246 TAGGGTGGGGTGGCTTTGGGAGG + Intergenic
936503035 2:113081539-113081561 GAAGGAGGGCTGGTGAGGGGTGG + Intergenic
936533052 2:113290295-113290317 AAGGGAGGTCTGGCTAAAGGAGG + Intergenic
938096672 2:128468408-128468430 GAGGGAGGCCTGGCTGGGAGAGG + Intergenic
938260934 2:129894967-129894989 GAGGGAGGGTTGGCTGTGTTTGG - Intergenic
938312319 2:130301418-130301440 GCAGGTTGGCTGGCTATGGGGGG + Intergenic
938341558 2:130539692-130539714 GAGGCAGGGGTGGCCTTGGGTGG + Exonic
938348271 2:130581017-130581039 GAGGCAGGGGTGGCCTTGGGTGG - Intronic
938989665 2:136615024-136615046 GTTGGAGGGCTGCCTCTGGGTGG + Intergenic
941706797 2:168667381-168667403 GAGGCAGGGCTGGGCTTGGGTGG - Intronic
942457364 2:176147511-176147533 CAGGGAGGTCTGGGTATTGGTGG + Intergenic
943653176 2:190478976-190478998 GAGGAAGGGCTGGGTAGCGGGGG - Intronic
943749846 2:191500078-191500100 GAGGCAGGGCTGGCTGTGGGTGG + Intergenic
946189818 2:218002295-218002317 GAGGAAGGGATGGCAGTGGGTGG + Intronic
946399850 2:219462440-219462462 CTGGGAGGTCTGGCTTTGGGTGG + Intronic
946414425 2:219532487-219532509 CATGGAGGGCTGGCTGGGGGTGG - Intronic
947715678 2:232337845-232337867 CAGACGGGGCTGGCTATGGGAGG + Intronic
947836499 2:233179628-233179650 CGGGGAGGGCTGGGTTTGGGAGG + Intronic
948667604 2:239546167-239546189 GAGGCAGGGCTGGTTCTGGAGGG - Intergenic
948710647 2:239822931-239822953 GAGGGAGTGCTAGGTATGGGAGG + Intergenic
948782819 2:240333835-240333857 AAGGGAGGGCTGGCCATCGAGGG + Intergenic
948999243 2:241602928-241602950 GCGGGAGGGCTGGCCATGGGAGG - Intronic
1168793501 20:595944-595966 GAGCGGGGGCTGCCTCTGGGAGG + Intergenic
1169169505 20:3453293-3453315 GAGGGAGGGATGGATAGGGCAGG + Intergenic
1169195962 20:3682126-3682148 GAGCGAGGGCGGGCGGTGGGAGG - Exonic
1170534643 20:17327620-17327642 GAGGGTGCACTGTCTATGGGAGG - Intronic
1170733661 20:18995047-18995069 AAGGGAGGGATGGCAAGGGGTGG + Intergenic
1172105941 20:32517372-32517394 AAGGGAGGGCTGGCAATGCAGGG + Intronic
1172650207 20:36497218-36497240 CAGCGAGGCGTGGCTATGGGTGG - Intronic
1172830984 20:37834215-37834237 GAGGGAGGGCTGGGTGCTGGTGG - Intronic
1173043769 20:39490356-39490378 GTGGGAGTGTAGGCTATGGGAGG - Intergenic
1173189628 20:40866132-40866154 GAAGGAGGCCTGGCTCAGGGTGG - Intergenic
1174191887 20:48746595-48746617 GAGGGAGGACTGACTGAGGGGGG + Intronic
1174402337 20:50282791-50282813 GAGGCAGGACTGGCTTCGGGGGG - Intergenic
1175242474 20:57559936-57559958 AAGTGTGGGCTGGCTGTGGGGGG + Intergenic
1175320095 20:58079319-58079341 GTGGGAGGGCGGGTTGTGGGGGG - Intergenic
1175684749 20:61020511-61020533 GAGGAATGGCTGGCTCTGTGCGG + Intergenic
1175823930 20:61926414-61926436 GAGGCAGCGCTGGCTGGGGGAGG - Intronic
1175966281 20:62661659-62661681 GAGGGAGGGAGGGAGATGGGGGG - Intronic
1176157460 20:63628836-63628858 GAGGGGGGCCTGGGGATGGGAGG + Intergenic
1176777305 21:13149646-13149668 GAGGGAGGGATAGCATTGGGAGG + Intergenic
1178518366 21:33266952-33266974 TAGGGAGGGCTGGCACTGAGGGG - Intronic
1180038701 21:45264709-45264731 GAGGGAGGGGTGGCCAGTGGGGG + Exonic
1180140913 21:45892964-45892986 GAGGGAGTGCTGGAGAGGGGAGG + Intronic
1180913430 22:19469326-19469348 GAGGGAAGGCTGGCCAGGGATGG + Intronic
1181376850 22:22465554-22465576 GAGGCAGGGATGGCACTGGGAGG + Intergenic
1182092066 22:27602604-27602626 GAGGTAGGGCTGGCAGTGGACGG + Intergenic
1182709194 22:32310065-32310087 GAGGGAGGACGGGGGATGGGGGG + Intergenic
1183303383 22:37069452-37069474 AAGGGAGGGCTGGGTGTGGAGGG - Intronic
1183598490 22:38826463-38826485 CAGGGAGGGCTGGCTGGGGGAGG - Intronic
1183936180 22:41263740-41263762 GGGGGAGGGCTGGCTAAGGCAGG + Intronic
1183987171 22:41576116-41576138 GAGGGAGGGCTGGCCAGGGGTGG + Exonic
1184686778 22:46099800-46099822 CAGGGAGGGCTGGGTACAGGTGG - Intronic
1184757950 22:46527385-46527407 GAGAGAGGGCTGACTGTGGAGGG - Intronic
1184763770 22:46561097-46561119 GAGCAAGGGCTGGCTGTGGGAGG + Intergenic
1184992832 22:48182239-48182261 GAGAGAGGCCTGGCGGTGGGAGG - Intergenic
1185220969 22:49629144-49629166 GAGGCATTGCTGGCTCTGGGTGG - Intronic
1185377463 22:50488867-50488889 GAGGGACGGGCGGCCATGGGGGG - Intronic
1185377485 22:50488935-50488957 GAGGGACGGGCGGCCATGGGGGG - Intronic
1185377507 22:50489003-50489025 GAGGGACGGGAGGCCATGGGGGG - Intronic
950404094 3:12793941-12793963 GAGGGAGGGCGGGCTATGGCTGG - Intergenic
950487348 3:13281540-13281562 GAGGGTGTGCTGGCTCTGGGCGG - Intergenic
950527529 3:13533131-13533153 GAGGGATGCCTGGCCATAGGGGG - Intergenic
950621519 3:14209486-14209508 GGAGGAGGGCTGGGAATGGGGGG - Intergenic
950628363 3:14265038-14265060 GAGTTGGGGCTGGCTATGAGGGG - Intergenic
950915923 3:16645209-16645231 GATGGGGGGCTGGCTATAGTAGG - Intronic
951975165 3:28498791-28498813 GGGGGGTGGCTGGCTAGGGGAGG - Intronic
952051967 3:29394917-29394939 GAAGGAGGTGTGGCTATGTGAGG - Intronic
952946254 3:38479506-38479528 GAGGCAGGGAGGGCTAGGGGTGG - Intronic
954563572 3:51579284-51579306 GGGGCAGGGCGGGCCATGGGTGG + Intronic
954704209 3:52470407-52470429 CAGGGAGGGTTAGCTCTGGGTGG + Intronic
955420394 3:58730647-58730669 GAGGTAGGGGTGACTATGGCTGG + Intronic
956818288 3:72928931-72928953 GACGGAGGACTGGCTATGGGCGG - Intronic
958037570 3:88188596-88188618 CAGGAGGGGCTGGCTCTGGGAGG + Intergenic
959500428 3:107100354-107100376 GAGGGAGGAGGGGCTATGGCAGG + Intergenic
959539361 3:107523115-107523137 CAGGGAGGGCTGGGGATGGGGGG - Intronic
960031185 3:113056489-113056511 GAGGAAGGGCTGCCTTTGGAAGG + Intergenic
960899208 3:122537779-122537801 GAGGGAGGGAGGGAAATGGGAGG - Intronic
961412708 3:126734288-126734310 GAGGGAAGCATGGCTGTGGGCGG + Intronic
961550587 3:127668600-127668622 GAGCGAGGGCAGGTGATGGGAGG + Intronic
961703445 3:128765110-128765132 GACAGAGGGCTGGCTACGGGCGG + Intronic
961858305 3:129893850-129893872 GTGGGAAGGCGGGCTAGGGGAGG - Intergenic
963732567 3:148987298-148987320 GGTGGAGGGCTGGGTAGGGGTGG + Intergenic
963843196 3:150129010-150129032 AAGTGAGGGCTGGGGATGGGGGG + Intergenic
965208892 3:165759151-165759173 GAAGTAGGGCGGGCTATGGGTGG - Intergenic
965881729 3:173395892-173395914 GAGGGAGTCCTGGCTCTGAGGGG + Intergenic
968233338 3:197016913-197016935 GAAGGAGGGCTGGCCAGGAGAGG - Intronic
968959884 4:3738064-3738086 GAGGATGGGCTGGATAGGGGAGG + Intergenic
969331782 4:6477822-6477844 GAAGGAGGACAGGCTGTGGGGGG - Intronic
969706367 4:8794317-8794339 GAGGGAGGGGTGGGAATGGAGGG + Intergenic
972415781 4:38839096-38839118 GAGGGAGGGGAGGCAAAGGGAGG + Intronic
973117433 4:46478583-46478605 GAGGGTGGGCGGGCTAGGGGAGG + Intergenic
975529503 4:75386055-75386077 GAGAGGGTTCTGGCTATGGGGGG - Intergenic
976695829 4:87918794-87918816 GAGGGAGGGCAGGGGAGGGGAGG + Intergenic
977672865 4:99716133-99716155 GGGGCAGGGCAGGCCATGGGAGG - Intergenic
977700367 4:100015280-100015302 GAAGGAGGGTTGGCTAAGGGAGG - Intergenic
978125687 4:105132459-105132481 AAGGGTGGGGTGGCTATGTGTGG + Intergenic
980119641 4:128714440-128714462 GAGATAGGGCTGCCTTTGGGAGG - Intergenic
980126120 4:128775974-128775996 GAGAGAGAGCAGGCTGTGGGAGG + Intergenic
980894471 4:138848883-138848905 GGGGGATGGAGGGCTATGGGAGG - Intergenic
983186417 4:164706083-164706105 GTGGTGGGGCTGGCCATGGGTGG - Intergenic
983792474 4:171814137-171814159 GTGGGAGGGCTGGGTCGGGGTGG - Intronic
983944048 4:173566732-173566754 GCGGGAGGGCTGGGGTTGGGGGG - Intergenic
984714858 4:182916734-182916756 GAGGGAGGGGGAGCCATGGGGGG + Intronic
986428780 5:7660894-7660916 CAGGGAAGGGTAGCTATGGGAGG + Intronic
990048054 5:51458740-51458762 AAGGAATGGCTGCCTATGGGTGG + Intergenic
992335195 5:75760202-75760224 GAGGGATGGGGGGCTAGGGGAGG - Intergenic
992519291 5:77533559-77533581 GAGTAGGGGATGGCTATGGGAGG + Intronic
992533021 5:77670699-77670721 TAGGGAGGTCTGGCAATGGGTGG - Intergenic
992789878 5:80203831-80203853 GATGGAAGGCTGGCTATCAGTGG + Intronic
992901558 5:81301818-81301840 GAGCGCGGGCTGTCTAGGGGCGG + Exonic
993504303 5:88692289-88692311 GGGGGAGGGGTGGATATGGGGGG + Intergenic
993601612 5:89932938-89932960 GAGGGTGGGCAGGGAATGGGTGG - Intergenic
993814827 5:92529838-92529860 GTGGTAGGGCTGGCTATGATGGG - Intergenic
994777177 5:104049641-104049663 GAGGAAGGGCAGGCCATAGGTGG - Intergenic
994898800 5:105744226-105744248 GGGGTAGGGCAGGCCATGGGTGG - Intergenic
995908020 5:117149801-117149823 GAGGGAAGGCTGGGCAGGGGAGG - Intergenic
998368933 5:141649106-141649128 GAGGTGGGGCTGTCTAGGGGTGG - Intronic
998983957 5:147734500-147734522 GAGGGTGGGGGGGCTAGGGGAGG + Intronic
999324789 5:150637192-150637214 AAAGGAGGGCTGTCTGTGGGAGG + Intronic
1001044906 5:168364306-168364328 CAGGGAGGGCTGGGGAGGGGAGG - Intronic
1002106458 5:176881615-176881637 GGGGGATTGCTGGCCATGGGTGG - Intronic
1002871383 6:1169944-1169966 GGGAGATGGCTGACTATGGGTGG + Intergenic
1004104939 6:12658539-12658561 GAGGAAGGGCTGGGGATTGGCGG + Intergenic
1004495175 6:16156181-16156203 GAGGCAGGGTGGGCCATGGGTGG + Intergenic
1005273103 6:24187209-24187231 GAGGGATGGCTGGATGTGGCAGG + Intronic
1005893030 6:30155245-30155267 GAAGGAGGGCGGCCTGTGGGTGG - Intronic
1006799129 6:36748301-36748323 GAGGGAGGCAGGGCTGTGGGAGG + Intronic
1007259854 6:40555823-40555845 GAGGGATGGGTGGCCATTGGTGG - Intronic
1007817991 6:44538305-44538327 CAGGCAGGGCAGGCTCTGGGAGG + Intergenic
1007889849 6:45278142-45278164 GAGGGTTGGGAGGCTATGGGAGG + Intronic
1009376934 6:62984349-62984371 GAGGGTGGGGGGGCTAAGGGAGG - Intergenic
1009932564 6:70193562-70193584 GAGGGAGTACTGGCTCTGGTGGG - Intronic
1010024451 6:71199411-71199433 GAGGCAGGGCTGGCTTTGAGAGG + Intergenic
1010086554 6:71925253-71925275 GAGGGAGGGCAGGCAACGGATGG - Intronic
1011159826 6:84376678-84376700 GTGGGAGGGCTGGGGGTGGGAGG + Intergenic
1012643387 6:101650616-101650638 GAGGGAGGGCAGATAATGGGAGG - Intronic
1012829287 6:104185892-104185914 GGTGCAGGGCTGGCAATGGGTGG - Intergenic
1012846289 6:104393605-104393627 GAGGTGTGGCTGACTATGGGAGG + Intergenic
1013009052 6:106103665-106103687 GAGACAGGGCTGGCTGTGGCAGG + Intronic
1013466968 6:110426476-110426498 GAGGGAGGGGTGGGAAAGGGGGG - Intronic
1014846317 6:126281896-126281918 GAGGGTGGGGGGGCTAGGGGAGG - Intergenic
1015378058 6:132533107-132533129 GAGAGAGGGCTGGGTTGGGGTGG + Intergenic
1015592364 6:134834065-134834087 GAGGGAGGGTGGGTTAGGGGAGG + Intergenic
1016429050 6:143964073-143964095 GATGGGGGGTTGGCCATGGGGGG - Intronic
1016548986 6:145255744-145255766 GGGGCAGGGCAGGCCATGGGTGG + Intergenic
1016569136 6:145492855-145492877 GGGGCAGGGCAGGCCATGGGTGG + Intergenic
1017608438 6:156158165-156158187 GAGGGAGGGCTGGGGCTTGGTGG + Intergenic
1018390274 6:163336362-163336384 GAGGGAGGCCTGGCCAAGGAAGG + Intergenic
1018442520 6:163826079-163826101 GCGGGAGGGCTGGGGAAGGGTGG + Intergenic
1018442790 6:163828397-163828419 GCGGGAGGGCTGGGGAAGGGTGG + Intergenic
1019625919 7:2015579-2015601 CAGGGAGTGCAGGCAATGGGAGG - Intronic
1019819786 7:3234066-3234088 GAGGGAGGGAGGGCAATGGAGGG + Intergenic
1021996506 7:26183111-26183133 CTGGGAGGGCTGGCTATGGAGGG + Intronic
1022522850 7:31019170-31019192 GAGAGAGGGCTGGTAATGGGAGG + Intergenic
1022531049 7:31067101-31067123 GAGTCAGGGCTGGCCATAGGAGG + Intronic
1022905299 7:34849880-34849902 GAAGGAGGGCTGGGAATGGTGGG - Intronic
1022948321 7:35310480-35310502 GAGTGAGGTCTGGGTGTGGGAGG - Intergenic
1023061953 7:36336153-36336175 GAAGGAAGGCTGCCTAGGGGAGG - Intronic
1023969232 7:44979024-44979046 GGGGGAGGGAAGGCTAGGGGAGG + Exonic
1024741202 7:52356724-52356746 AAGGAAGAGGTGGCTATGGGTGG + Intergenic
1025256438 7:57386650-57386672 GAAGGATGGCTGGCCATGGCCGG + Intergenic
1026010142 7:66629505-66629527 GAGGGAGGGTGGGCCGTGGGAGG + Intronic
1026282403 7:68933483-68933505 GAGGGAGGGCAGGGCATGGCAGG + Intergenic
1026436772 7:70406164-70406186 GAGGGAGGCCTGGCAAGGGAGGG - Intronic
1026833092 7:73622009-73622031 GAGGGAGGGAGGGAGATGGGGGG - Intronic
1027587739 7:80078621-80078643 GTGGGAGGGCTGGTAGTGGGGGG + Intergenic
1029122532 7:98278531-98278553 GAGGTGGGGCTGGCCAGGGGAGG - Intronic
1029539469 7:101174178-101174200 GAGAGAGGGTAGGCTAGGGGTGG - Intronic
1029578704 7:101420732-101420754 AGGGAAGGGCTGACTATGGGCGG - Intronic
1032037784 7:128532089-128532111 AAGGGAGGGCCGGCTCTCGGGGG - Intergenic
1032239294 7:130148596-130148618 GACAGAGGGCTGGCTTGGGGCGG + Intergenic
1032675910 7:134129407-134129429 GAGGGAGGGGTGGGGAGGGGAGG - Intronic
1033352620 7:140573887-140573909 GAGGGAGGGCTGATTTTGGAAGG + Exonic
1033432187 7:141299525-141299547 GAGGCAGGCCTGGCCAAGGGAGG - Intronic
1033585024 7:142768044-142768066 CAGGCAGGGCTGGCTCTGGCTGG + Intergenic
1034679401 7:152917159-152917181 GAGGGAGGGAGGGGTATAGGTGG - Intergenic
1034892675 7:154854843-154854865 GAGGGAGGGCTGGAAAGGGAGGG - Intronic
1035783108 8:2244308-2244330 GTGGGAGGGGTGGTGATGGGGGG + Intergenic
1035809017 8:2475278-2475300 GTGGGAGGGGTGGTGATGGGGGG - Intergenic
1036658893 8:10695076-10695098 GAGGGAAGGCTGGATGGGGGAGG + Intronic
1037074552 8:14697891-14697913 GAGGGAGGGCTGACAATAGAGGG - Intronic
1037488734 8:19376149-19376171 GAGGGAAGGCTGGAGATGCGGGG + Intronic
1037689333 8:21169606-21169628 GAGGGAGGAAGGGCTGTGGGTGG - Intergenic
1037738086 8:21582733-21582755 GAGGGAGGGCAGGATGTGGCTGG - Intergenic
1037877286 8:22554350-22554372 GAGGAGGGGCCGGCTGTGGGAGG - Intronic
1037981816 8:23259753-23259775 CAGGGAGGGCAGGCTAGGAGAGG - Intronic
1038233643 8:25730467-25730489 GAGGGAGGGATAGCATTGGGAGG - Intergenic
1038577965 8:28721646-28721668 GAGGGAGGACTGGGTCTGGCAGG + Intronic
1038908672 8:31937093-31937115 GAGAGAAGGCTGACTCTGGGAGG - Intronic
1039695435 8:39905547-39905569 GAGGAAGAGCTGGATGTGGGAGG - Intronic
1039853897 8:41396335-41396357 GAAGGAAGGCTGGCTGTGTGAGG + Intergenic
1040981171 8:53247579-53247601 GAGGTAGGGCTGCCTCTGGCAGG + Intronic
1041595583 8:59647215-59647237 GTGGAAGGGTTGGCTATGGGTGG - Intergenic
1042500024 8:69498766-69498788 GAGAGAGGACTGTTTATGGGTGG + Intronic
1042533275 8:69835127-69835149 GCGGGGTGGCTGGCTGTGGGAGG - Intergenic
1042605987 8:70547065-70547087 GAGGGAGGGGTTGTTCTGGGAGG + Intergenic
1042727469 8:71893565-71893587 CAGGCATGGCTGGCTGTGGGAGG + Intronic
1043563499 8:81522320-81522342 GACGGACGGCTGGCTATGGGCGG + Intergenic
1043728478 8:83644282-83644304 GAGGTAGTGCTGCCTTTGGGAGG + Intergenic
1044274379 8:90283622-90283644 GAGGCAGGGCAGGCCATGGGTGG - Intergenic
1044286857 8:90419972-90419994 GGGGAAGGGCAGGCCATGGGTGG + Intergenic
1045099025 8:98826137-98826159 TAGTGAGGGCAGGCTAGGGGCGG - Intronic
1048562444 8:135555877-135555899 GAGGGATGGGGGGCTAGGGGAGG - Intronic
1048581427 8:135732436-135732458 GAGGTGGGGCTGGATTTGGGGGG - Intergenic
1048995592 8:139792004-139792026 CAGGGAGGGCTCCCTGTGGGAGG - Intronic
1049427057 8:142542400-142542422 GCGGGAGGGCGGGCTGCGGGCGG - Exonic
1049599910 8:143502913-143502935 GGGGGAGGGCTGGCCAAGGCCGG + Intronic
1049662118 8:143824210-143824232 CAGAGAGGGCTGGCTGGGGGCGG - Intronic
1049726486 8:144148683-144148705 GAGTGAGGGCTGGCTCCCGGCGG - Intronic
1049770733 8:144379794-144379816 GAGGGCGGGGTGACTATAGGTGG + Intronic
1050090984 9:2016395-2016417 GAGGGAGGGCAGGGTAACGGAGG - Intronic
1051158924 9:14183762-14183784 GAGGGAGGACTGGTTTTGGTTGG - Intronic
1051289136 9:15527779-15527801 GACGGAGGGCTGGCTATGGGCGG + Intergenic
1051545157 9:18265349-18265371 TAGGAAGCACTGGCTATGGGTGG - Intergenic
1052357508 9:27520293-27520315 GAGGGAGGGCTGGTTAGCAGGGG - Intronic
1056245391 9:84689778-84689800 GAGGGAGGTAAGGTTATGGGGGG - Intronic
1056643260 9:88388570-88388592 GAGGGAGTGCGGGCTGCGGGCGG + Intronic
1056827921 9:89889840-89889862 GAGGGAGGGATGACCATGTGGGG + Intergenic
1057210169 9:93196790-93196812 GAGGGGTGGCGGGCTGTGGGTGG + Intronic
1057222021 9:93262583-93262605 GAGGGAGAGCTGACTATGCGTGG + Intronic
1057392646 9:94652556-94652578 GGGGGTGGGCTGGATATGGAGGG - Intergenic
1057526521 9:95807989-95808011 GAGGGCAGGCAGGCAATGGGTGG - Intergenic
1058324234 9:103675547-103675569 GGGTGAAGGATGGCTATGGGGGG - Intergenic
1058414183 9:104768153-104768175 GAGGGAGGGCTGACTATACTAGG + Intronic
1059887406 9:118761654-118761676 GGGGGAGGGCTGCTTATGGAGGG + Intergenic
1060994352 9:127867712-127867734 GAGGGGTGGCTGGCAAAGGGAGG + Exonic
1061003553 9:127916058-127916080 GAGAGAGAGCTGGATGTGGGGGG - Intronic
1061224974 9:129276154-129276176 GAGGGAGGGTGGGGTATTGGAGG - Intergenic
1061296867 9:129681668-129681690 GAGGGAGGGCGGGTTTAGGGAGG - Intronic
1061396978 9:130348689-130348711 TAGGGTGGGCGGGGTATGGGTGG + Intronic
1061541101 9:131278113-131278135 GGGGGAGGGCGGGCTGTGTGCGG - Intergenic
1061591872 9:131603114-131603136 GAAACAGGGCTGGCTCTGGGTGG + Intronic
1061848124 9:133399545-133399567 GAGGGAGGTGTGGCTCCGGGTGG - Intronic
1062030110 9:134358384-134358406 GAGGGAGGGCTTCCTGGGGGAGG + Intronic
1062109105 9:134772438-134772460 GAGGGCGGGCTGGCTCTGGCCGG + Intronic
1062213748 9:135378123-135378145 GCAGAAGGGCTGGCTAGGGGTGG - Intergenic
1062225190 9:135446446-135446468 GAGGAAGGGCTGGCTGGGGTGGG + Intergenic
1062225301 9:135446763-135446785 GAGGAAGGGCTGGCTGGGGTGGG + Intergenic
1062225354 9:135446903-135446925 GAGGAAGGGCTGGCTGGGGTGGG + Intergenic
1062225409 9:135447044-135447066 GAGGAAGGGCTGGCTGGGGTGGG + Intergenic
1062225462 9:135447184-135447206 GAGGAAGGGCTGGCTGGGGTGGG + Intergenic
1062225476 9:135447230-135447252 GAGGAAGGGCTGGCCGTGGCAGG + Intergenic
1062403249 9:136381631-136381653 GAGGGAGGGCTGGCTGTGACTGG + Intronic
1185859070 X:3560943-3560965 GAGGGGGGGCGGGGTGTGGGTGG + Intergenic
1187441975 X:19328868-19328890 GATGGAGGGCTGTTTATGTGTGG - Intergenic
1190062033 X:47217922-47217944 GATGGAGGGCGGGCTAAAGGCGG + Intronic
1190166182 X:48074681-48074703 GAGGGAGGGAGCGCTCTGGGAGG - Intergenic
1190230288 X:48576453-48576475 GAGGGAGAGTTGCCTATGTGTGG + Intronic
1191201467 X:57786987-57787009 GGGGGATGGTGGGCTATGGGAGG + Intergenic
1192179763 X:68909180-68909202 GAGGGAGGGGTGGAACTGGGTGG - Intergenic
1192657275 X:73004306-73004328 GGGGGAGGGCTGGGGGTGGGGGG - Exonic
1192664845 X:73078701-73078723 GGGGGAGGGCTGGGGGTGGGGGG + Exonic
1192962516 X:76145373-76145395 GGGGGAGGGCTGGCGGGGGGAGG + Intergenic
1192963017 X:76149714-76149736 GGGGGAGGGCTGGCGGGGGGAGG - Intergenic
1193061551 X:77213476-77213498 GAGGTAGTGTTGGCTTTGGGTGG + Intergenic
1194586928 X:95746653-95746675 GTCGGAGGGCTGGGTGTGGGAGG + Intergenic
1194878921 X:99225762-99225784 GGGGCAGGGCAGGCTATTGGTGG - Intergenic
1195580232 X:106493411-106493433 GGGGAAGGGATGGCTGTGGGTGG - Intergenic
1196061082 X:111409023-111409045 GAGAGAGGGCTGGATAATGGGGG + Intronic
1197773594 X:130106187-130106209 GAGGGAGGGAAGGCTTTGTGAGG - Intronic
1199005263 X:142688573-142688595 GAGGAAGGGCTGGGGAGGGGAGG - Intergenic
1199458047 X:148052097-148052119 GACGGAGGGCTGGCTATGGGTGG - Intergenic
1200117810 X:153776812-153776834 GAGGCAGGGCAGGATGTGGGCGG + Intronic
1200123568 X:153802697-153802719 GAGGGAGGGCTGGGGATGGATGG - Exonic
1201274774 Y:12286978-12287000 AAGGGAGGGGTGGCTACGGAGGG + Intergenic