ID: 1085590519

View in Genome Browser
Species Human (GRCh38)
Location 11:77755458-77755480
Sequence TTGTTTGTACATAAAGATGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 329
Summary {0: 1, 1: 0, 2: 4, 3: 29, 4: 295}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085590519 Original CRISPR TTGTTTGTACATAAAGATGA TGG Intronic
900761611 1:4475903-4475925 TTGTTTTTACATAAAACTGTCGG + Intergenic
904072394 1:27811507-27811529 TTGTTTTTTAATAGAGATGAGGG + Intronic
904156622 1:28488618-28488640 TTTTTTGAAAATAGAGATGAGGG - Intronic
907155821 1:52332849-52332871 GTGTGTGTACAGAATGATGATGG + Exonic
907179509 1:52557323-52557345 TTCTTTATACATAAAAATGAGGG + Intergenic
907507723 1:54933431-54933453 TTATTTGTACATAAAAGTGATGG - Intergenic
907654428 1:56327703-56327725 TTTATTGTACATGAAGAAGAAGG + Intergenic
909502422 1:76349868-76349890 TTGTCTGTCCAGCAAGATGAGGG + Intronic
911378063 1:97075945-97075967 TTGGTTGAACAAAAGGATGAAGG + Intergenic
911528983 1:99021086-99021108 AAGTATTTACATAAAGATGAGGG + Intergenic
911599291 1:99830843-99830865 TTGGAATTACATAAAGATGAAGG - Intergenic
911710406 1:101064954-101064976 GTGTGTGTACATGAATATGAGGG + Intergenic
912063563 1:105705893-105705915 TTATTATTACATAATGATGATGG - Intergenic
912584045 1:110745632-110745654 TGGTTTGACCATCAAGATGATGG + Intergenic
912897894 1:113612423-113612445 TTATTTCTGCATAAGGATGATGG + Intronic
913184484 1:116356715-116356737 TAATTAGTACATAAAGATGATGG - Intergenic
913221490 1:116664273-116664295 CTGTTTACACATGAAGATGAGGG + Intronic
914381323 1:147119012-147119034 TTGTTTGCAGAGAATGATGAAGG - Intergenic
917954465 1:180079106-180079128 TTGATTTTAAATTAAGATGATGG + Intronic
918388106 1:184031328-184031350 TGGGTTGTACATAAATATGCAGG - Intronic
918700819 1:187604467-187604489 TTCTTTGTACATAAAGTTACTGG - Intergenic
919532373 1:198739484-198739506 TTGTCTCTACATAATGATAAAGG + Intronic
921956720 1:220992696-220992718 TAGTTTGTCCAAAAAGAAGAAGG - Intergenic
923003617 1:230027681-230027703 TTATTTGTACATGAAGCAGAGGG + Intergenic
923975732 1:239260305-239260327 TTGTCTGTAGATACAGATGTAGG - Intergenic
924093136 1:240522813-240522835 TTCTTTGTAAATAAAGCTCAAGG - Intronic
1065598473 10:27342998-27343020 TTGTTTATACATACAGATGATGG - Intergenic
1067734800 10:48841970-48841992 ATCTTTGTACATGAAGATGCCGG + Intronic
1068345500 10:55772941-55772963 TTATTTGTACATATCCATGATGG - Intergenic
1068400648 10:56523350-56523372 TTGTTTGCACATATTGAAGAGGG + Intergenic
1070005982 10:72424488-72424510 TTTTTTGTAAATAGAGATGGGGG + Intronic
1070054220 10:72919257-72919279 TTGTTTGTATATAAGAATGCCGG + Intronic
1070219240 10:74423239-74423261 GTATTTGTACAGAAAGATGCAGG + Intronic
1072064563 10:91853412-91853434 TTGAATGAACATAAAGAAGATGG - Intronic
1072507399 10:96082276-96082298 GTGTGTGTAAATAAACATGATGG + Intergenic
1073508629 10:104025868-104025890 TTGTTTTTAAGCAAAGATGAAGG + Exonic
1075815051 10:125258662-125258684 GTGTTTATACATTTAGATGATGG + Intergenic
1076330576 10:129662097-129662119 TTGTTTGTAAATAAGAATGGGGG + Intronic
1077767510 11:5176566-5176588 GTGTGTGTACATATATATGAAGG + Intronic
1077820601 11:5735762-5735784 TTATTTGTCCATAATGTTGAAGG - Intronic
1079510801 11:21207563-21207585 TTATTTGTACATAAAGTAGTAGG - Intronic
1080196027 11:29610004-29610026 TTGTTTGTAGACAAAAATGGTGG + Intergenic
1080610067 11:33896257-33896279 TTGGCTGTGAATAAAGATGATGG + Intergenic
1080916491 11:36665612-36665634 TGGTTTGTACAGAAAGTTGAGGG - Intergenic
1080934087 11:36843432-36843454 TTCTATACACATAAAGATGATGG + Intergenic
1080953852 11:37069034-37069056 CAATTTGTACATAAATATGATGG + Intergenic
1081015295 11:37870738-37870760 TAGTTTCTCCATAAAAATGAAGG - Intergenic
1081801712 11:45864447-45864469 TTGTTTTTATTTAGAGATGAGGG - Intronic
1082696758 11:56376384-56376406 CTGTAAGTACATAAAAATGAGGG - Exonic
1084731406 11:71075972-71075994 TTGTTTCTGCCTACAGATGAGGG - Intronic
1085590519 11:77755458-77755480 TTGTTTGTACATAAAGATGATGG + Intronic
1085821121 11:79794803-79794825 TTGTAAGTACATAAAGACCAAGG + Intergenic
1086203258 11:84228611-84228633 TTGTTTGAACATTAAAATGCTGG + Intronic
1086242943 11:84718511-84718533 TTGTTTGTAAATGAACTTGAAGG + Intronic
1086947593 11:92858521-92858543 TTGTTAAAACATAAAGTTGAAGG + Intronic
1087037546 11:93770296-93770318 TTGTTTTTACATAAACAATAGGG - Intronic
1087383270 11:97436376-97436398 TTGTTTTCACATTAAGATGTAGG - Intergenic
1087990189 11:104739953-104739975 TTGTTTGGATAGAAAGATTAAGG + Intergenic
1091123180 11:133073882-133073904 TTGTTTGTGAATAAAGAAAAAGG + Intronic
1091700791 12:2660264-2660286 GTTTTTGTACAAAAAGATGGGGG + Intronic
1093194649 12:16115668-16115690 TTATTTCTAAATAAAGAAGAGGG + Intergenic
1093869986 12:24279120-24279142 TTGACTTGACATAAAGATGATGG - Intergenic
1094699846 12:32858402-32858424 TTCTTTATACATATAGGTGAAGG - Intronic
1098185020 12:67887366-67887388 TTGTTTTTACCTGAAAATGATGG - Intergenic
1098526287 12:71490759-71490781 TTGTTTGTTTACAAACATGATGG - Intronic
1098785855 12:74754151-74754173 TTTTTTGTTAAAAAAGATGATGG - Intergenic
1099208631 12:79757724-79757746 TTTATTGTAAATAATGATGAGGG + Intergenic
1099659027 12:85532033-85532055 TTAATTGTCCATAAAGAAGATGG + Intergenic
1100851652 12:98718530-98718552 TTGATTTTACATAAAAAAGAAGG - Intronic
1101686514 12:107028953-107028975 CTGTTTATACATAAAGATTTAGG + Intronic
1102382090 12:112475424-112475446 TTGATTGTATATAGAGATGGGGG + Intronic
1105328032 13:19387903-19387925 TCGTTTGTTCATGAAGATGAAGG + Intergenic
1105863874 13:24441786-24441808 TCGTTTTTTCATGAAGATGAAGG - Intronic
1106688604 13:32089589-32089611 TTTTTTGTAGATAGAGATGGGGG - Intronic
1107391658 13:39971313-39971335 TTGTTAGCACAAAAAAATGAAGG - Intergenic
1107423296 13:40269601-40269623 ATGGGTGTACATGAAGATGAGGG - Intergenic
1109128175 13:58544883-58544905 TTGTTTGAACATAGGAATGAAGG - Intergenic
1109507067 13:63316404-63316426 TTTCTTGTAAATAAATATGAGGG + Intergenic
1109529843 13:63627672-63627694 TGTTTTTTACATAAAGAGGAAGG - Intergenic
1110669845 13:78164825-78164847 TTGTTTCCACTTAAAGTTGATGG + Intergenic
1110776892 13:79418281-79418303 TTGTTTGTAGAAATAGATTAAGG - Intergenic
1111695467 13:91618036-91618058 TGGGTTGTACATAAACAGGAAGG + Intronic
1113102469 13:106735472-106735494 TTGTTTCTACAGTAAGATGAAGG - Intergenic
1115930395 14:38484988-38485010 TTGTTATTACATAATGATAAAGG + Intergenic
1116933573 14:50714672-50714694 ATGTTGGACCATAAAGATGAGGG - Intergenic
1117926418 14:60784349-60784371 TTTTTTTTAAATAGAGATGAGGG + Intronic
1117945847 14:61019600-61019622 CTGTTTATACATAAATGTGATGG + Intronic
1118922722 14:70164856-70164878 GTGTTTATACATACAAATGAAGG - Intronic
1119887725 14:78157544-78157566 GTGTGTGTACATAAAGAAAACGG - Intergenic
1120280117 14:82428765-82428787 TTGTTTACACAGAAAGGTGAGGG - Intergenic
1120559036 14:85968599-85968621 ATGTTTCTACAGAAAAATGATGG + Intergenic
1122101411 14:99413204-99413226 TTGTTTTTAAATGATGATGAAGG - Intronic
1123456516 15:20431229-20431251 TTGTTTTTAAATTCAGATGATGG - Intergenic
1123661546 15:22569133-22569155 TTGTTTTTAAATTCAGATGATGG + Intergenic
1124262655 15:28206376-28206398 TTGTTTTTAAATTCAGATGATGG - Exonic
1124315346 15:28663362-28663384 TTGTTTTTAAATTCAGATGATGG + Intergenic
1124630727 15:31335561-31335583 TTGTTTGTCCAGAAAGATGTTGG - Intronic
1125691093 15:41596808-41596830 TTTTTTTTTAATAAAGATGAGGG + Intergenic
1127243035 15:57139603-57139625 GTGTTTGCAAATAAAGGTGATGG - Intronic
1127445399 15:59057317-59057339 TTGCTTGTACATAAAAAAGGGGG - Intronic
1128411022 15:67397281-67397303 TTGATTGTAGTTAAAGATGCAGG + Intronic
1128617588 15:69122116-69122138 TGGTTTGTCCCTACAGATGAAGG - Intergenic
1129026111 15:72575870-72575892 TTGTTTTTTCATTGAGATGAGGG + Intronic
1129357146 15:74998781-74998803 TTGTTTGTATATAAAGGTTAGGG - Intronic
1130941647 15:88514980-88515002 TTTTTTATACATAAAAAAGATGG - Intronic
1133424471 16:5675831-5675853 TTGCTTTGAAATAAAGATGAGGG + Intergenic
1135273810 16:21093034-21093056 TTGTTTTTAAATTGAGATGAGGG - Intronic
1135592519 16:23714479-23714501 TTATTTTTACACAAGGATGAAGG - Intergenic
1135700826 16:24630992-24631014 ATGCTTGTACATACAGATGAAGG + Intergenic
1136144542 16:28308599-28308621 TTCTTTGTAGATAGAGATGGAGG + Intronic
1136157605 16:28394553-28394575 TTGTTTTGACCAAAAGATGAAGG + Intronic
1136205482 16:28720731-28720753 TTGTTTTGACCAAAAGATGAAGG - Intronic
1136566130 16:31071624-31071646 TTCTTTGTATATAGAGATGGAGG + Intronic
1138954767 16:61957870-61957892 TTCTTGGAATATAAAGATGAAGG - Intronic
1139762821 16:69200685-69200707 TTGTTTTTAAATAGAGATGGGGG + Intronic
1141505303 16:84473277-84473299 GTGTTTCTACATACAGATAATGG + Intergenic
1144053847 17:11521143-11521165 TTGTTAGCAAATAAAAATGAGGG - Intronic
1144510489 17:15871015-15871037 TTGTTTGAAAATAAAGACGAAGG + Intergenic
1145174648 17:20688739-20688761 TTGTTTGAAAATGAAGACGAAGG + Intergenic
1148974020 17:51511125-51511147 TTCTTTGTATAAAAAGCTGATGG + Intergenic
1149876258 17:60236234-60236256 TCTTTTGTACATACAGAGGATGG - Exonic
1150524949 17:65912687-65912709 TTTTTTAAAAATAAAGATGAAGG + Intronic
1152452982 17:80395205-80395227 TTGTTTGTACAGAAATATACTGG + Exonic
1153525592 18:5992050-5992072 TTCTTGGGACACAAAGATGAAGG + Intronic
1153552929 18:6281385-6281407 GTTTTTGTACATAAAGCTTATGG + Intronic
1154085143 18:11297251-11297273 TTGTTTGTTCATGAAAATCAAGG + Intergenic
1154112587 18:11583001-11583023 TTGTTTGTACACAAACATTCTGG + Intergenic
1155706884 18:28826597-28826619 GTGTTTGTGCAAAAAGATTATGG + Intergenic
1162597053 19:11637653-11637675 TTGTTTGTTGATAAACATGTGGG + Intergenic
1162612221 19:11765699-11765721 TTGTTTTTAAATAGAGATGGGGG + Intergenic
1166767207 19:45258830-45258852 CTTTTTGTAGAGAAAGATGAAGG + Intronic
1168030489 19:53675879-53675901 TTGTTTTTACTCCAAGATGAGGG + Intergenic
925540143 2:4958005-4958027 TTGTGTGTACCTAAAAATGAAGG - Intergenic
925778975 2:7362411-7362433 TTGTTTTTTTCTAAAGATGAAGG - Intergenic
926943759 2:18166277-18166299 TTGTTTCTTCATAATGTTGATGG + Intronic
927412028 2:22837472-22837494 TTGTCTCTACTTAAACATGATGG - Intergenic
928625655 2:33137373-33137395 TTGTTGGTACTTAAAGGTGAGGG + Intronic
929076171 2:38080662-38080684 ATGTTAGTACATAAAAATAAGGG - Intronic
930290546 2:49487887-49487909 TTGTTTGTCCTTTAATATGAGGG - Intergenic
930794595 2:55375195-55375217 TTGTTTGTGTGTAGAGATGAAGG - Intronic
932050456 2:68393098-68393120 TTGTTTGTACAGAGTGATGCTGG + Intronic
932898853 2:75674296-75674318 TTGTTTGTACATAAAAAAATTGG + Intronic
934545348 2:95209808-95209830 TTGTTTGTACAGAACGAAGATGG + Intronic
935100418 2:99989393-99989415 TTGTATGTCCATAAAGCTGATGG - Intronic
936980393 2:118259136-118259158 AAGTTTGTACAAAAATATGAAGG - Intergenic
937750545 2:125471940-125471962 TTATTTGTACATAGAGGTGGAGG + Intergenic
937778512 2:125810000-125810022 TTTTTTATACATATAAATGATGG - Intergenic
939436637 2:142185488-142185510 TTGTTAGAACTTAAAGTTGAAGG - Intergenic
939939955 2:148337282-148337304 ATGTTTTTACATAAAGAATATGG + Intronic
940279819 2:151977580-151977602 TTGTTTGGACAGAGAGAAGAAGG + Intronic
941187743 2:162338217-162338239 ATAATTGTACATAAATATGAAGG + Intronic
941211201 2:162641993-162642015 TTGTTTGTTCATAAAGAAGCAGG + Intronic
941578112 2:167261337-167261359 TTTTTTTTAAAAAAAGATGAGGG - Intergenic
942415943 2:175759568-175759590 TTGCTTGTACATGAAAAAGAAGG + Intergenic
942692349 2:178599355-178599377 TGGTTTCCACCTAAAGATGATGG - Exonic
943546262 2:189283167-189283189 TTGTTTGAAAATAAAGAGGAAGG + Intergenic
944834301 2:203562884-203562906 TGGTTTCTGTATAAAGATGAAGG + Intergenic
944891451 2:204121443-204121465 TTGTTGGGACACAAAGATAAAGG + Intergenic
945963423 2:216160499-216160521 TTGTGTGTACTTGAAGATTAAGG - Intronic
946857647 2:223968630-223968652 TTTTTTATAAAGAAAGATGAAGG + Intergenic
946934426 2:224705138-224705160 TTGTTTGTAAATGATGATGGAGG + Intergenic
947562043 2:231163384-231163406 TGGTTTGTTCATAAAGATAAAGG + Intronic
1171244388 20:23599519-23599541 TTGTTTGTCCAAAAATATAAAGG + Intergenic
1173517707 20:43676920-43676942 TTGTTTTTAAATAGAGAAGAGGG + Intronic
1175086912 20:56467458-56467480 GTATTTGTACATATATATGATGG - Intergenic
1176514379 21:7772989-7773011 TTGTTTGTATATAAATTTAAGGG - Intergenic
1176718545 21:10374834-10374856 TTGTCTTTACATGAAGATCAAGG - Intergenic
1177317667 21:19481248-19481270 TGGTTTTTACATAAAGTAGATGG - Intergenic
1178464753 21:32837142-32837164 TTTTCTGTACATAAATATAATGG + Intergenic
1178648492 21:34403513-34403535 TTGTTTGTATATAAATTTAAGGG - Intronic
1180937451 22:19635028-19635050 TTGTTTGGACATGATGATTAGGG - Intergenic
949264751 3:2143661-2143683 ATGTTTGTAAATAAAGAACAGGG - Intronic
949290240 3:2456701-2456723 TTATTTGTACATAAAAAAGAAGG - Intronic
951337060 3:21436161-21436183 GTGTGTGTACACACAGATGAGGG + Intronic
951457775 3:22912025-22912047 TTGTTTGTCAATAAACATGGTGG - Intergenic
951520677 3:23608448-23608470 TAGTTTGTACATAAAGTGCAAGG - Intergenic
953032998 3:39190257-39190279 TCATTTATAAATAAAGATGAGGG + Intronic
953793417 3:45965563-45965585 TTGATAGTACACAAAGATGAGGG - Intronic
955786877 3:62550406-62550428 TTGTTTGTGTTTAAAGATGAGGG - Intronic
959277446 3:104294546-104294568 TTGTTTCTCCATAAAACTGAAGG + Intergenic
959309685 3:104717921-104717943 TTATTTTTACAGAAAGAGGAAGG - Intergenic
959382958 3:105664313-105664335 TTGATAGTACATAAAAATAATGG + Intronic
959837745 3:110940501-110940523 TTTCTTGTAAATCAAGATGAGGG + Intergenic
960326022 3:116296875-116296897 TTGTTATTACATAAACAAGAAGG + Intronic
963482686 3:145896382-145896404 TCTCTTGTACATAAAGTTGATGG - Intergenic
963790727 3:149579774-149579796 TTGTTTTAACATTAAGAGGATGG - Intronic
963943670 3:151121299-151121321 TTGTTTGTATAAAAAAAAGACGG + Intronic
964593391 3:158393057-158393079 TTGTTTATACAAAAAGAAGCAGG - Intronic
964664544 3:159157741-159157763 TTGTATGTGCATAAAGTGGAAGG - Intronic
965259527 3:166463333-166463355 CTTTTTCTACATAAAAATGAAGG + Intergenic
972181326 4:36470353-36470375 TTGTTTGTATAAAGAGAGGAAGG - Intergenic
972202051 4:36724841-36724863 TTTTTTGTATATGAGGATGAGGG + Intergenic
972555669 4:40178449-40178471 TTTCTTGTGCCTAAAGATGAAGG - Intergenic
972903573 4:43716404-43716426 TTTCTTATATATAAAGATGAAGG - Intergenic
973101352 4:46275172-46275194 TAGTTTGGTCATTAAGATGATGG - Intronic
973701625 4:53543031-53543053 TTGTTTTTAAATAGAGATGAGGG + Intronic
977722543 4:100256942-100256964 TTCTTGGGACATAAGGATGAGGG - Intergenic
980730446 4:136816830-136816852 TCTTTTGTAAACAAAGATGACGG + Intergenic
982754159 4:159198817-159198839 ATGTGTGTACATAAAGAAAATGG + Intronic
982996701 4:162357934-162357956 TTGTTAGTACATACAGACCATGG - Intergenic
983026356 4:162741659-162741681 TTATTTGTAGATCCAGATGAAGG + Intergenic
983185740 4:164698546-164698568 ATGTTTCTTCAAAAAGATGATGG + Intergenic
984403453 4:179296178-179296200 TTTCTTATACATAAAGATGCTGG + Intergenic
984442123 4:179785609-179785631 TTGATTCTACATAAAAAGGAAGG - Intergenic
986095804 5:4553193-4553215 TTGTTGTTACATACACATGATGG + Intergenic
986421417 5:7587668-7587690 TTGTTCTTAATTAAAGATGAAGG - Intronic
986516064 5:8565099-8565121 ATTTTGGTACATAAAAATGAAGG - Intergenic
987692079 5:21280215-21280237 ATTTTTGTCCATGAAGATGAGGG - Intergenic
987717966 5:21595743-21595765 TTGTTTGCACATACAGATGTAGG + Intergenic
988353029 5:30136883-30136905 TTAATTGTACAAAAAGATAAAGG + Intergenic
989623687 5:43409758-43409780 TTTATTGTACATTAAGATTAAGG - Intronic
989656485 5:43750652-43750674 CTAATTGTACATAAAGTTGATGG - Intergenic
990590366 5:57256564-57256586 TAGTGTGGACATGAAGATGAAGG + Intronic
990728537 5:58783773-58783795 TTGTTTGTGGATAAAGGGGAAGG - Intronic
991748299 5:69769877-69769899 ATTTTTGTCCATGAAGATGAGGG + Intergenic
991799879 5:70349722-70349744 ATTTTTGTCCATGAAGATGAGGG + Intergenic
991828718 5:70660316-70660338 ATTTTTGTCCATGAAGATGAGGG - Intergenic
991892237 5:71349153-71349175 ATTTTTGTCCATGAAGATGAGGG + Intergenic
992057841 5:73009890-73009912 CTGCTTTTAAATAAAGATGATGG + Intronic
993574939 5:89589354-89589376 TTATCTGTATATCAAGATGAGGG - Intergenic
995182384 5:109240972-109240994 TTGACTGTACAAACAGATGAGGG + Intergenic
995424722 5:112007695-112007717 TTGTTTTTTAATAAAGAGGAAGG + Intergenic
996493370 5:124125509-124125531 GTGTTTGTACATAAAGTTGCTGG + Intergenic
999007420 5:147997750-147997772 TGGTTTGTACATTAAGGTCAAGG - Intergenic
999532114 5:152475370-152475392 TTTTTTGTACAGAATGCTGAGGG - Intergenic
999549620 5:152671925-152671947 TTAGTGGTACATAGAGATGATGG + Intergenic
1000894100 5:166834074-166834096 TTATTTGAAAATAAATATGAGGG - Intergenic
1000952371 5:167500040-167500062 GTGTTTGTACATATATATGAGGG + Intronic
1001687037 5:173601242-173601264 TTGTTTGTACTTGGGGATGATGG + Intergenic
1002107304 5:176886506-176886528 TTGTTCTTACACAAGGATGAGGG - Intronic
1002770299 6:284746-284768 TTATTTGTACCTAAAGAGGATGG + Intergenic
1003629429 6:7773231-7773253 ATGTGTGTACATGGAGATGAAGG - Intronic
1008528085 6:52427868-52427890 TTGTATTTACTTCAAGATGAAGG - Intronic
1009049934 6:58263597-58263619 TTGTTTTTATATACATATGAGGG - Intergenic
1009225479 6:61016856-61016878 TTGTTTTTATATACATATGAGGG - Intergenic
1010739632 6:79484728-79484750 TTTTTTTTAAAAAAAGATGAGGG - Intergenic
1010971130 6:82264482-82264504 TTGTCAGTACAGAATGATGAAGG - Intergenic
1011117262 6:83907006-83907028 TTGCATGTATATAAAGATGTAGG - Intronic
1011490354 6:87885171-87885193 TTATCTGTCCATAAAGATAATGG + Intergenic
1011889000 6:92133288-92133310 TTGTTTGCATATAGAGAAGATGG - Intergenic
1011903354 6:92329310-92329332 GTATTTGTGCATAAAAATGATGG - Intergenic
1013802146 6:113959399-113959421 GTTTTTGTAGATAAAGATGAGGG - Intronic
1014465118 6:121746934-121746956 TTATTTTTCCATAAAGATGCTGG - Intergenic
1015015104 6:128403299-128403321 TTGTTTCTCTGTAAAGATGAAGG - Intronic
1015240689 6:131020274-131020296 ATTTATGTACATAAATATGAGGG - Intronic
1016725321 6:147358465-147358487 TTGTTTGTATATTAAGAAAAAGG + Intronic
1017427612 6:154338988-154339010 TTTTTTGTGCATGAAGATAATGG - Intronic
1017642095 6:156504369-156504391 TTGATTGTACATCAATTTGATGG - Intergenic
1019190722 6:170249192-170249214 GTGTGTGTAGTTAAAGATGAGGG - Intergenic
1019975872 7:4581001-4581023 GTGTGTGTACATAAAAATGTTGG - Intergenic
1020508824 7:9026530-9026552 TTTTTTGAAAATAAAGATCATGG + Intergenic
1022082673 7:27038231-27038253 TTTTTTTTACAAAAAGAAGAGGG + Intergenic
1022736160 7:33078075-33078097 TTGTTTTTATATGAAGGTGAAGG + Intergenic
1024182240 7:46908115-46908137 TTGCTTGAACATCAAGATGAAGG - Intergenic
1024419008 7:49140432-49140454 TTATTTGTACTTGAAGATAACGG + Intergenic
1024957464 7:54938745-54938767 TTATTTGTAAGTAAAGATGAAGG - Intergenic
1025968692 7:66301198-66301220 TTGTTTGTTTATGAAGATTAAGG - Intronic
1026679137 7:72451994-72452016 TTGATTGTAAATAGAGATGGGGG - Intergenic
1027649355 7:80846228-80846250 TTGTAGGTGCATAAAGATCAAGG - Intronic
1028003121 7:85526640-85526662 TATTTTCTACATAAAAATGAAGG + Intergenic
1028365683 7:90028066-90028088 ATGTGGGTACATAAACATGATGG + Intergenic
1030101638 7:105952019-105952041 TTGTTTTTACACACAAATGAGGG - Intronic
1030243623 7:107358342-107358364 TTGTTTGTCTGTAAATATGAAGG + Intronic
1030609781 7:111676661-111676683 ATGTTTGTACATTTAGAAGATGG + Intergenic
1031028517 7:116709175-116709197 GTGTCTGTAGGTAAAGATGAAGG - Intronic
1031929270 7:127668024-127668046 TTGTTTCTATTGAAAGATGATGG - Intronic
1032803265 7:135333494-135333516 TTCTTTGTCCATAAAGAGGTAGG + Intergenic
1033014688 7:137660666-137660688 TTCTTGGTACATATAGATCAGGG - Intronic
1033419141 7:141190482-141190504 TTTTTTTTATATAGAGATGAAGG + Intronic
1034808640 7:154110540-154110562 TTGTTTGTACCTTATGATAAGGG - Intronic
1034903667 7:154924801-154924823 TTGTTTGTACATGAAAATGATGG - Intergenic
1035890994 8:3342666-3342688 TGATTTGTTCATACAGATGATGG + Intronic
1036907866 8:12722326-12722348 TTAATTGTACATAAAGGTAAAGG - Exonic
1036984757 8:13516108-13516130 TTGATTGTAAATAAAGTAGAAGG - Intergenic
1037010923 8:13841477-13841499 TTTTTTGTCCATAAAACTGATGG + Intergenic
1037091506 8:14925421-14925443 TTCTTAGTACATAAATATAAAGG - Intronic
1043268220 8:78294002-78294024 ATGTTTGTACAAAAATATTAGGG + Intergenic
1043713998 8:83458421-83458443 TTCTTTGTAAGTAAATATGATGG + Intergenic
1043737345 8:83765330-83765352 TTGTTTTTACTTAAAAAAGAAGG + Intergenic
1045887783 8:107120409-107120431 ATGTCTGTACGTAAAGATGTTGG + Intergenic
1046269058 8:111869452-111869474 TTATTTGGACATAAAGATACTGG + Intergenic
1046680144 8:117159799-117159821 TTGATGCTACACAAAGATGAAGG + Intronic
1046723201 8:117645623-117645645 TTCTTAGTACATAATAATGAAGG - Intergenic
1047166575 8:122446017-122446039 TTATTTGTACCAAAATATGAGGG - Intergenic
1047479538 8:125268054-125268076 TTTTTTTTAAATAGAGATGAGGG - Intronic
1048712235 8:137225074-137225096 TTGCTTTTACACAAACATGATGG + Intergenic
1048731409 8:137445055-137445077 TGGGGTGTACATAAAAATGATGG - Intergenic
1051638461 9:19202759-19202781 TTGTTTGGACAGACAGATGCAGG - Intergenic
1053594179 9:39543541-39543563 TTTTTGGTTTATAAAGATGAGGG - Intergenic
1053851960 9:42298587-42298609 TTTTTGGTTTATAAAGATGAGGG - Intergenic
1054572074 9:66821416-66821438 TTTTTGGTTTATAAAGATGAGGG + Intergenic
1054800513 9:69343805-69343827 TTGTTGGGAGATAAAGATAAGGG + Intronic
1055202860 9:73688742-73688764 CTATTTGTAAATATAGATGAAGG + Intergenic
1055220463 9:73924078-73924100 GTGTTTCTACATAAAAAAGAAGG + Intergenic
1055438282 9:76314362-76314384 GTGTTTAAACACAAAGATGAGGG - Intronic
1055611448 9:78030314-78030336 TTCCTTCTAGATAAAGATGAGGG - Intronic
1056553641 9:87671886-87671908 TTGCTTCTACATAAAGATGAGGG - Intronic
1057246206 9:93456482-93456504 ATGTTTGTATTTAGAGATGATGG + Intronic
1057357597 9:94344786-94344808 TTGTTTGTTTATAAAGTTGCTGG - Intergenic
1058066144 9:100550112-100550134 TTGTTGGGAAAGAAAGATGATGG + Exonic
1058217407 9:102252554-102252576 TTGCGTGCACATCAAGATGATGG + Intergenic
1058999568 9:110334638-110334660 TTGTAAGTACATAAAAATCATGG + Intronic
1059498717 9:114731972-114731994 TAGTTTGTACAGGAAAATGAAGG + Intergenic
1059783863 9:117559240-117559262 TTATTTGCCCATTAAGATGAAGG + Intergenic
1060233540 9:121843161-121843183 TTTTTTTTAAATAAAGATGGGGG - Intronic
1060577785 9:124713104-124713126 TTGTTTGACCATATATATGAGGG - Intronic
1061436935 9:130569723-130569745 ATGTTTTTTCATAGAGATGAGGG - Intergenic
1061529170 9:131196781-131196803 TTATTTGCTCATAAAAATGAAGG + Intronic
1187068252 X:15862463-15862485 TTGTTTTTGCCTAAAGATAATGG - Intergenic
1188098935 X:26058247-26058269 TTGTTTGAACAATAAGGTGATGG - Intergenic
1188511825 X:30944396-30944418 TTGTTAAAACATAAAAATGAAGG + Intronic
1188629970 X:32343373-32343395 TAAGTTGTACAAAAAGATGAGGG - Intronic
1190531088 X:51377232-51377254 TTGTTTGTCCATAAAAATAAGGG - Intergenic
1192474260 X:71426158-71426180 TTTTTTGTAAATAGAGATGGGGG + Intronic
1193110829 X:77728203-77728225 TTTTTTTTAAATAAAGATGGGGG - Intronic
1193377166 X:80775079-80775101 TTGCATGTACAAAAAGATGGTGG - Intronic
1194329831 X:92568058-92568080 TAGTTTGTGCACAGAGATGATGG + Intronic
1194440955 X:93933357-93933379 CTGTCTGTTAATAAAGATGAGGG - Intergenic
1194964579 X:100272640-100272662 TTTTTCTTACAAAAAGATGAGGG + Intergenic
1195267310 X:103195226-103195248 TCGTTTGTTGATGAAGATGATGG + Intergenic
1196150313 X:112366337-112366359 AGGCTTGTACATAATGATGATGG - Intergenic
1197137798 X:123083200-123083222 CTGTTGCCACATAAAGATGAAGG - Intergenic
1197189860 X:123634163-123634185 TTATTTGTATATAAATATGGGGG + Intronic
1198079397 X:133224887-133224909 TGGTTTGTAGTTAAAGAAGATGG + Intergenic
1198239502 X:134769223-134769245 TTATTTTTAGAAAAAGATGAGGG - Intergenic
1199194674 X:145014043-145014065 ATGTGTGTACATAAACATAATGG + Intergenic
1200638535 Y:5687240-5687262 TAGTTTGTGCACAGAGATGATGG + Intronic
1201988560 Y:19996529-19996551 ATTTTTGTGAATAAAGATGATGG + Intergenic
1202603824 Y:26621714-26621736 TTGTTTGTTCATGAAGATGAAGG - Intergenic