ID: 1085594456

View in Genome Browser
Species Human (GRCh38)
Location 11:77795933-77795955
Sequence GTTTAGAGGTGTATGTGTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 274
Summary {0: 1, 1: 0, 2: 0, 3: 35, 4: 238}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085594452_1085594456 0 Left 1085594452 11:77795910-77795932 CCTCAGGGATTCGACTTTTCCTG 0: 1
1: 0
2: 0
3: 8
4: 124
Right 1085594456 11:77795933-77795955 GTTTAGAGGTGTATGTGTCCAGG 0: 1
1: 0
2: 0
3: 35
4: 238
1085594448_1085594456 28 Left 1085594448 11:77795882-77795904 CCTCAATTTCAGAACTTGTTATT 0: 1524
1: 1958
2: 6826
3: 3987
4: 1294
Right 1085594456 11:77795933-77795955 GTTTAGAGGTGTATGTGTCCAGG 0: 1
1: 0
2: 0
3: 35
4: 238

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085594456 Original CRISPR GTTTAGAGGTGTATGTGTCC AGG Intronic
900078773 1:839318-839340 GTGTCCAGGTGTGTGTGTCCAGG - Intergenic
900078774 1:839332-839354 GTGTCTAGGTGTTTGTGTCCAGG - Intergenic
900078784 1:839416-839438 GTGTCTAGGTGTGTGTGTCCAGG - Intergenic
900078788 1:839458-839480 GTGTCTAGGTGTGTGTGTCCAGG - Intergenic
900078793 1:839500-839522 GTGTCTAGGTGTGTGTGTCCAGG - Intergenic
900078799 1:839570-839592 GTGTCTAGGTGTGTGTGTCCAGG - Intergenic
901342581 1:8508837-8508859 TTTTAGAGGTGCATGTGTGGTGG - Intronic
902461334 1:16579595-16579617 GTGTAGAAGTGTTTATGTCCTGG - Intronic
902462118 1:16585891-16585913 GTGTAGAAGTGTTTATGTCCTGG - Intronic
902559918 1:17270961-17270983 CCCTAGAGGTGTATGTGTGCCGG + Exonic
905530246 1:38672688-38672710 TTTTGCAAGTGTATGTGTCCAGG + Intergenic
906294725 1:44642586-44642608 GTTTAATGGAGTATGAGTCCTGG + Intronic
907225478 1:52942415-52942437 ATCTACAGGTGTATGGGTCCTGG + Intronic
908683050 1:66683540-66683562 CTTTAGATGTGTATGCTTCCAGG + Intronic
909456803 1:75858989-75859011 TTAGAAAGGTGTATGTGTCCAGG + Intronic
910563901 1:88621988-88622010 CTTGAGAGGGGTATGTGTCCAGG - Intergenic
911317575 1:96374014-96374036 GTTTAGAGATATATCTCTCCTGG + Intergenic
912591792 1:110829760-110829782 GTTTAGAAGTATGGGTGTCCTGG - Intergenic
913603338 1:120442625-120442647 GTGTAGAAGTGTTTATGTCCTGG + Intergenic
913604085 1:120448977-120448999 GTGTAGAAGTGTTTATGTCCTGG + Intergenic
914277524 1:146138639-146138661 GTGTAGAAGTGTTTATGTCCTGG - Intronic
914365281 1:146972535-146972557 GTGTAGAAGTGTTTATGTCCTGG + Intronic
914538571 1:148589587-148589609 GTGTAGAAGTGTTTATGTCCTGG - Intronic
918684591 1:187398761-187398783 CTTGGGGGGTGTATGTGTCCAGG - Intergenic
919928284 1:202204385-202204407 GTTTGGAGGTGTGTGTGTGGAGG - Intronic
919928293 1:202204460-202204482 GTTTGGAGGTGTGTGTGTGGAGG - Intronic
919928297 1:202204486-202204508 GTTTGGAGGTGTGTGTGTGGAGG - Intronic
922580448 1:226693532-226693554 GTTTTCAGTTGTATGTGTCTGGG - Intronic
924362961 1:243260234-243260256 GGTTAAAAGTGTATGTGTCCTGG + Intronic
1063194874 10:3731961-3731983 TTTTACATGTCTATGTGTCCTGG + Intergenic
1063939067 10:11108258-11108280 GTTTAGGTGTGTGTGTATCCTGG + Intronic
1064933623 10:20654995-20655017 GTGGGGGGGTGTATGTGTCCAGG + Intergenic
1066604780 10:37153172-37153194 GTTTAATGCTGTATGTGTCCTGG + Intronic
1066605604 10:37166205-37166227 GTTTACTGCTGTATGTGTCCAGG + Intronic
1066606318 10:37177267-37177289 GTTTACTGCTGTATGTGTCCCGG + Intronic
1066607102 10:37189068-37189090 GTTTACTGCTGTATGTGTCCCGG + Intronic
1067155066 10:43774610-43774632 GTTTAGATGTGCTTGTTTCCTGG + Intergenic
1068126522 10:52847987-52848009 TTTGAAGGGTGTATGTGTCCAGG + Intergenic
1068493257 10:57750967-57750989 CTTAGGAGGTGTATGTTTCCAGG + Intergenic
1068513672 10:57998620-57998642 GTTTATTTGTGTATGTGTCATGG + Intergenic
1069573837 10:69511301-69511323 TTGTGGGGGTGTATGTGTCCAGG + Intergenic
1071751804 10:88487298-88487320 GTTCAGGGGTGCATGTGTCATGG - Intronic
1071983440 10:91027141-91027163 GTTTGAGGGTGTATGTGTCGAGG - Intergenic
1072286164 10:93917632-93917654 GTTGAGAGGTTAATTTGTCCCGG + Intronic
1075033675 10:119044379-119044401 CTGTAGAGGTGTATGTTCCCAGG - Intronic
1077856310 11:6129528-6129550 GTTTGGGCGAGTATGTGTCCAGG + Intergenic
1077972670 11:7211435-7211457 TTTTAGAGGTATATTAGTCCAGG + Intergenic
1081166367 11:39813345-39813367 CTTGGGAGGTGTATGTGTCCAGG - Intergenic
1081171648 11:39877002-39877024 TTTTGAGGGTGTATGTGTCCAGG - Intergenic
1083807883 11:65085932-65085954 GTATAGATGTGTATGTGTGAGGG + Intronic
1085594456 11:77795933-77795955 GTTTAGAGGTGTATGTGTCCAGG + Intronic
1086108608 11:83174051-83174073 GGTTATATGTGTATGTGTACAGG + Intronic
1087300631 11:96430430-96430452 CTTGGGAGGTGTATGTGTTCAGG - Intronic
1088619218 11:111664695-111664717 GTGTAGAGGTGTGTGTGTGGGGG - Intronic
1088790175 11:113218020-113218042 CCTTAGAAGTCTATGTGTCCAGG + Intronic
1090129925 11:124129708-124129730 GGTGGGGGGTGTATGTGTCCAGG + Intronic
1090338951 11:125998308-125998330 GGTGAGAGGTGTCTGTGTCATGG + Intronic
1091050210 11:132361143-132361165 CTTTAGAAGTGTTTGTGCCCCGG + Intergenic
1093004744 12:14039188-14039210 GTGGGGAGGTGTATGTGTCCAGG - Intergenic
1093080830 12:14808773-14808795 GTATATATGTGTATGTGTGCTGG - Intronic
1094816793 12:34194982-34195004 CTTGAGGGGTGTATGTGTCCAGG - Intergenic
1097664267 12:62461778-62461800 GTTGAGAGGTGTCAGTGTGCTGG - Intergenic
1099497906 12:83375439-83375461 CTTGGGAGGTATATGTGTCCAGG + Intergenic
1099549020 12:84019915-84019937 CTTGGTAGGTGTATGTGTCCAGG - Intergenic
1101098427 12:101367895-101367917 GTCTTCAGGTGAATGTGTCCTGG + Exonic
1101737378 12:107473224-107473246 GTTCACAGGTGTGTGTGTTCAGG - Intronic
1102039258 12:109790261-109790283 GCTCAGATGTGTATGTGTCCAGG + Intronic
1102495649 12:113317072-113317094 GTTTAGGGGTGCAAGTGTTCAGG + Intronic
1104488932 12:129177460-129177482 GTTTAAAAGTATATGTGGCCGGG + Intronic
1105576812 13:21661481-21661503 GTTAAGAGGTGTTTGAGTCATGG - Intergenic
1106608448 13:31253951-31253973 GTTTAGTCTTGCATGTGTCCAGG - Intronic
1106651204 13:31692076-31692098 TTTGGAAGGTGTATGTGTCCAGG - Intergenic
1107022045 13:35761935-35761957 GTGTAGGGGTGTATGTGTATAGG - Intergenic
1109659428 13:65438799-65438821 CTTGGGAGGTGTATGTGTCCAGG - Intergenic
1110238588 13:73242380-73242402 GTTTAGAGGGTGATGTGGCCTGG - Intergenic
1110790127 13:79578582-79578604 GAATTTAGGTGTATGTGTCCTGG + Intergenic
1111600835 13:90471898-90471920 CTTGGGGGGTGTATGTGTCCAGG + Intergenic
1113327282 13:109294287-109294309 GTGTAGGGGTGTATGTGTAGAGG - Intergenic
1113391391 13:109900709-109900731 GCTTGGAGGTGTAAGTGTGCAGG + Intergenic
1114682980 14:24502531-24502553 GTTTAGAGGTCTAAGTTTCCAGG + Intronic
1115122850 14:29958098-29958120 CTTGGGAGGTTTATGTGTCCAGG + Intronic
1116344632 14:43775988-43776010 TTGGAAAGGTGTATGTGTCCAGG - Intergenic
1117170347 14:53088082-53088104 GGGGAAAGGTGTATGTGTCCAGG - Intronic
1120449185 14:84644233-84644255 GTTTAGACCTCTATGTATCCTGG + Intergenic
1120582020 14:86264067-86264089 CTTGGGAGGCGTATGTGTCCAGG + Intergenic
1124530775 15:30503760-30503782 GGTCAGAAGTGTGTGTGTCCTGG + Intergenic
1124767885 15:32503935-32503957 GGTCAGAAGTGTGTGTGTCCTGG - Intergenic
1125199574 15:37090718-37090740 GAGTAGAGGTGTATGTGTTTTGG + Intronic
1128997744 15:72309338-72309360 GGTGAGAGGTGAATGTGACCTGG + Intronic
1129564906 15:76611347-76611369 TTGAAAAGGTGTATGTGTCCAGG - Intronic
1130619754 15:85450142-85450164 GGGTGGGGGTGTATGTGTCCAGG + Intronic
1131563127 15:93461613-93461635 GTTCAGGGGTGTGTGTGTGCTGG + Intergenic
1133080217 16:3312839-3312861 GTTCAGAGGTGTGTTAGTCCCGG + Intronic
1133342694 16:5047031-5047053 GTTTGGAGGGGTCTGTGTGCTGG - Intronic
1133424024 16:5672086-5672108 GGTTAGAGGTTTATGTCTCTTGG + Intergenic
1135695395 16:24582035-24582057 GGGTAGAGGTGTATGTGTGTGGG - Intergenic
1137051620 16:35718509-35718531 GTGGAGGGGTGTATGTGTCCAGG + Intergenic
1140743565 16:77962326-77962348 GTCTAGAAGTGTATGTGTTGGGG + Intronic
1141755487 16:85987955-85987977 ATTTTGGGGTGTATGTATCCAGG - Intergenic
1143785824 17:9254735-9254757 GTGTAGATGTTCATGTGTCCAGG - Intronic
1145209880 17:21004896-21004918 GCTTAGCGGTGTGGGTGTCCAGG - Intronic
1148865561 17:50626463-50626485 GGTTAGAGGGGTCTGTGCCCAGG - Exonic
1149681869 17:58513032-58513054 CTTTAGAGGTGTGTGTGTGTGGG - Intronic
1150347649 17:64416367-64416389 GTTTGGAGGTGAGTGTGTCGTGG - Intergenic
1150749942 17:67851612-67851634 GTTTTCAGGGGTATGTGTACTGG + Intronic
1151996525 17:77612791-77612813 GGTCAGAGGTGCATGTATCCGGG - Intergenic
1152428919 17:80236612-80236634 GCTTTGAGGTGGATGTGCCCTGG + Intronic
1153454482 18:5265080-5265102 CTTGGGAAGTGTATGTGTCCAGG - Intergenic
1153644350 18:7181438-7181460 TTAGGGAGGTGTATGTGTCCAGG - Intergenic
1154478160 18:14788150-14788172 GTTTAATGCTGTATGTGTCATGG + Intronic
1155909231 18:31489042-31489064 GTTAAGAGGTGTAAGTATCCAGG - Intergenic
1158084304 18:53632730-53632752 CTTGGGGGGTGTATGTGTCCTGG - Intergenic
1159646501 18:70924370-70924392 TTTGGAAGGTGTATGTGTCCAGG - Intergenic
1161566245 19:5004431-5004453 GGGTAGAGGTGTATGAGCCCGGG - Intronic
1164377181 19:27698162-27698184 CTTGGGAGGTGTATGTGTCGAGG + Intergenic
925858662 2:8154240-8154262 GTGTAGAAGTGTGTGTGTCCTGG + Intergenic
927866583 2:26591796-26591818 GTTGAGAGGCCCATGTGTCCAGG + Intronic
928883221 2:36120666-36120688 CTTGGGAGGTGTAAGTGTCCAGG + Intergenic
929255822 2:39810415-39810437 CTTGGGAGGTATATGTGTCCAGG + Intergenic
929401331 2:41585363-41585385 CTTGGGAGGAGTATGTGTCCAGG - Intergenic
929406982 2:41653654-41653676 CCTTAGAGTTCTATGTGTCCAGG + Intergenic
933038490 2:77430788-77430810 GTTTTGAGGTGTATCTGTGAAGG + Intronic
935288596 2:101589264-101589286 GGTCAGAGGTGTAAGTGTGCTGG + Intergenic
935782025 2:106516469-106516491 TTTTATAGCAGTATGTGTCCTGG + Intergenic
935858035 2:107296548-107296570 CTTGGGAGGTGTATGTGTCGAGG + Intergenic
939896698 2:147800437-147800459 GTACAGAGCTGTATGTGCCCAGG + Intergenic
940407747 2:153325222-153325244 CTTGGGAGGTGTATGTGTCCAGG + Intergenic
940702385 2:157061838-157061860 GTTTACAGGCTTATGTGTCTGGG - Intergenic
941117084 2:161484325-161484347 CTTGGTAGGTGTATGTGTCCAGG - Intronic
941854784 2:170219961-170219983 ATTAAGAGGTGTTTGTGGCCGGG + Intronic
942065502 2:172267429-172267451 CTTGGGGGGTGTATGTGTCCAGG + Intergenic
942124106 2:172805737-172805759 ATCTGGAGGTGGATGTGTCCTGG - Intronic
942544787 2:177052291-177052313 GTTTGTAGGTGTATGTGTACAGG - Intergenic
942896196 2:181057384-181057406 GTTTAGAGGGGTGTGTGTTTCGG + Intronic
944620875 2:201514982-201515004 GTTTAGGGGTGCATCTGACCTGG - Intronic
944774110 2:202944566-202944588 GTTGAGAGGTGACTGTGTGCAGG + Intronic
945046025 2:205782548-205782570 GGTTTGAGGAGTATGTTTCCAGG + Intronic
947774455 2:232697055-232697077 GTTGAGTGGTGTTGGTGTCCAGG - Intergenic
948383258 2:237565628-237565650 GTGTAGATGTGTATGTGTGTAGG - Intergenic
1173562179 20:44013829-44013851 GATGAGAGGTGTATGTCTCAAGG + Intronic
1174841021 20:53901701-53901723 CTTTAGAGGGGAATGTTTCCTGG - Intergenic
1175481752 20:59316260-59316282 GATTAAAAGTGTATGTGTGCAGG + Intronic
1175568617 20:60001064-60001086 GTTTTCAGGTGTCTGTGTCATGG + Intronic
1177241525 21:18464676-18464698 TTGCAGGGGTGTATGTGTCCAGG - Intronic
1178607404 21:34051867-34051889 GTTTAGAATTGTATGTGTTTAGG + Intergenic
951012455 3:17696516-17696538 GTTTAGTCTTGTATGTATCCAGG - Intronic
951167207 3:19496976-19496998 GCATAGAGGTATATGTGTCCAGG + Intronic
951676137 3:25244035-25244057 TTGGAAAGGTGTATGTGTCCAGG + Intronic
952503421 3:33985906-33985928 CTTGGGAGGTGTATGTGTCCAGG + Intergenic
953051098 3:39344524-39344546 GTTTAGACATGTATGCCTCCTGG - Intergenic
953266123 3:41390096-41390118 CTTGGGAGGTGTATGTGTCGAGG + Intronic
956805320 3:72804307-72804329 GTTCAGAGGTATGTGTGTCATGG + Intronic
957696159 3:83640277-83640299 CTTGGGAGGGGTATGTGTCCAGG - Intergenic
957908177 3:86584395-86584417 TCTTAAGGGTGTATGTGTCCAGG - Intergenic
959597913 3:108147780-108147802 GTTTATAGGTGTATTAGTCAGGG + Intergenic
960314321 3:116157622-116157644 TTGGAGAGGTGTATGTTTCCAGG - Intronic
960580134 3:119270603-119270625 CTTGGGAGGTGTATGTGTCCAGG - Intergenic
961151568 3:124642736-124642758 TTGCAGAGGTGTATGTTTCCAGG + Intronic
963360054 3:144260421-144260443 CATGGGAGGTGTATGTGTCCAGG + Intergenic
964560710 3:157992872-157992894 TTGGGGAGGTGTATGTGTCCAGG - Intergenic
965090781 3:164160179-164160201 TTGTGGAGGTGTATGTGTCCAGG + Intergenic
967263925 3:187673236-187673258 TTCTAGAGGTGCATGTATCCCGG - Intergenic
967715918 3:192761479-192761501 TTGCAAAGGTGTATGTGTCCAGG - Intronic
967972552 3:195010283-195010305 GTTTAGGGGTGTATGTGTGTAGG - Intergenic
972905395 4:43740180-43740202 GTGTACATGTGTATGTGTACAGG - Intergenic
973237345 4:47919757-47919779 TTTTGAGGGTGTATGTGTCCAGG + Intronic
973868000 4:55133816-55133838 GTTTAGAGGTGAATATGCACAGG - Intergenic
975306388 4:72854190-72854212 TTTGAAGGGTGTATGTGTCCAGG - Intergenic
976823138 4:89229849-89229871 GTTTAGTGGTTTATGTATCTGGG + Intergenic
976918798 4:90411041-90411063 CTTAGGAGGTGTATGTGTCCAGG - Intronic
977051678 4:92136163-92136185 GTTAGGAAGGGTATGTGTCCAGG + Intergenic
978418701 4:108506502-108506524 TTGGAAAGGTGTATGTGTCCAGG - Intergenic
980179653 4:129388359-129388381 GTTTACAGGTGTGTATTTCCTGG + Intergenic
980715060 4:136617127-136617149 GTTTGGTGATGTATGTGGCCGGG - Intergenic
980721459 4:136701137-136701159 GATTAGAGGCTTATGTGTCTTGG - Intergenic
982852644 4:160339208-160339230 TTTGAAGGGTGTATGTGTCCAGG + Intergenic
983051863 4:163057359-163057381 TCTTGGGGGTGTATGTGTCCAGG + Intergenic
983371172 4:166860657-166860679 GTTGAGAAGTGTATGTATGCTGG - Intronic
986488429 5:8264536-8264558 GGTTAGAGGTGTTTGGGTCATGG + Intergenic
986817991 5:11433747-11433769 GGTGAGAGGTGTTTGTGTCATGG - Intronic
987922991 5:24307991-24308013 CTTGGGAGGTGTATGTGTCCAGG + Intergenic
989657130 5:43756765-43756787 CTTGGGAGGTGTATGTGTCCAGG + Intergenic
989968919 5:50498000-50498022 CTTGGGAGGTGTATGTGTCGAGG - Intergenic
990858779 5:60302393-60302415 TTTGGAAGGTGTATGTGTCCAGG + Intronic
993426005 5:87764992-87765014 GTTTCGTGGTGTGTGTGTGCGGG + Intergenic
993951080 5:94176109-94176131 GTTGAGAGGTGTTTGGGTCATGG + Intronic
994257831 5:97620985-97621007 CTTAAGAGGTGTATATTTCCAGG + Intergenic
995169628 5:109091795-109091817 GGTAAGAAGTGTGTGTGTCCAGG - Intronic
995519138 5:112984314-112984336 ATCTAGATGTGTATGTGACCAGG - Intronic
995642677 5:114275558-114275580 CTTGGGGGGTGTATGTGTCCAGG + Intergenic
995816033 5:116169264-116169286 CTTGGGAGGTGTATGTGTACAGG - Intronic
996256364 5:121409145-121409167 GTTCAGTGGTGTAGGTGTGCAGG + Intergenic
998723845 5:144986162-144986184 CTTGGGGGGTGTATGTGTCCAGG + Intergenic
1002837814 6:880163-880185 GTCTGGAGCTGTATGTGACCTGG - Intergenic
1003202694 6:3976750-3976772 GTTTAGAGGTCTGGGTTTCCAGG - Intergenic
1003559877 6:7171712-7171734 CATTAGAGGTGAGTGTGTCCTGG + Intronic
1004541160 6:16551484-16551506 GGTTGGAGGTGTATGTGTGTGGG + Intronic
1004757266 6:18625338-18625360 GTGTATAGGTGTGTGTGTACAGG - Intergenic
1006577574 6:35057507-35057529 ATTTAGAGGGTAATGTGTCCAGG + Intronic
1006715142 6:36113776-36113798 GTTTAAAAGTCTATGTGACCTGG + Intergenic
1008269523 6:49474924-49474946 CTTGGGAGGTGTATGTGTCCAGG - Intronic
1010281950 6:74032397-74032419 GTTTAGTCTTGTATGTGTCCAGG + Intergenic
1010811569 6:80306532-80306554 GCTTATATGTTTATGTGTCCAGG - Intronic
1010961350 6:82149269-82149291 TTGGAGAGTTGTATGTGTCCAGG - Intergenic
1011913105 6:92466793-92466815 GGTGAGAGGTGTTTGTGTCATGG - Intergenic
1014338530 6:120172617-120172639 ATTTATAGGTGTATCTGTCCAGG + Intergenic
1014354142 6:120383091-120383113 GGTTAGAGGTGTATGAGTACAGG - Intergenic
1015719020 6:136222134-136222156 TTTTGGGAGTGTATGTGTCCAGG - Intergenic
1019203300 6:170337755-170337777 CTTGGAAGGTGTATGTGTCCAGG + Intronic
1019955837 7:4413752-4413774 GAATAGAGGTGAATGTGGCCGGG - Intergenic
1024748527 7:52434777-52434799 TTTTGAATGTGTATGTGTCCTGG + Intergenic
1026960494 7:74404518-74404540 GCTTAGAGGTGTGTGTGTGTTGG - Exonic
1028562041 7:92186468-92186490 CTTGGGAGGTGTATGTGTCCAGG + Intergenic
1030508816 7:110457565-110457587 CTTGGGAGGGGTATGTGTCCAGG - Intergenic
1031902341 7:127425172-127425194 GTTGGAAGGTTTATGTGTCCAGG + Intronic
1032928082 7:136632088-136632110 TTTCATAGGTGTATGTGTCTAGG + Intergenic
1033924141 7:146436656-146436678 TTTTAGAGGTTTCTGTTTCCAGG - Intronic
1035526824 8:320058-320080 GTGTCTAGGTGTGTGTGTCCAGG + Intergenic
1035526825 8:320072-320094 GTGTCCAGGTGTGTGTGTCCAGG + Intergenic
1035526827 8:320086-320108 GTGTCCAGGTGTGTGTGTCCAGG + Intergenic
1035526831 8:320128-320150 GTGTCCAGGTGTGTGTGTCCAGG + Intergenic
1035526835 8:320156-320178 GTGTCTAGGTGTGTGTGTCCAGG + Intergenic
1035526839 8:320198-320220 GTGTCTAGGTGTGTGTGTCCAGG + Intergenic
1035526850 8:320296-320318 GTGTCTAGGTGTTTGTGTCCAGG + Intergenic
1035526860 8:320394-320416 GTGTCTAGGTGTTTGTGTCCAGG + Intergenic
1035690896 8:1558690-1558712 GTGTATACGTGTATGTGTGCAGG - Intronic
1038540087 8:28384991-28385013 GTTTCGAGGTGTTTGCGACCAGG + Intronic
1040473271 8:47754357-47754379 GGTCATAGGTGTATGTGTCCAGG - Intergenic
1040473497 8:47756678-47756700 TTTGGAAGGTGTATGTGTCCAGG + Intergenic
1042443057 8:68850102-68850124 CTTTAATGGTGTTTGTGTCCTGG - Intergenic
1043961194 8:86420510-86420532 GTGTAGATGTGTATGTGTGCAGG + Intronic
1045587116 8:103550873-103550895 GTTTAGTCTTGTATGTGTCGAGG - Intronic
1046610086 8:116413727-116413749 CTGGGGAGGTGTATGTGTCCAGG - Intergenic
1047351197 8:124076281-124076303 GTTTAGGGATGTATTTATCCCGG - Exonic
1048467362 8:134677360-134677382 CTTGGGAGATGTATGTGTCCAGG - Intronic
1051884657 9:21878081-21878103 CTTGGGAGGTGTATGTTTCCAGG + Intronic
1051918214 9:22232699-22232721 CTTGGAAGGTGTATGTGTCCGGG - Intergenic
1054859566 9:69935079-69935101 GTTTAGAGGTATATGTTTATTGG - Intergenic
1055755640 9:79554785-79554807 GTTAAGAGGTGTATGGGTTGGGG + Intergenic
1055823372 9:80295245-80295267 CTTGGGAGGTGTATGTGTCCAGG - Intergenic
1056240482 9:84641624-84641646 GATTAGAAGAGTATGTGTTCTGG + Intergenic
1058081662 9:100707206-100707228 CTTGGGGGGTGTATGTGTCCAGG + Intergenic
1060294605 9:122334713-122334735 GTTAGGAGGTGGATGTGTCTTGG + Intergenic
1062156835 9:135053958-135053980 GTTGACAGGTGTATGAGTCAGGG - Intergenic
1185612377 X:1400422-1400444 GTGTAGAGGTGTGAGTGTTCAGG - Intergenic
1187216299 X:17280387-17280409 GTATAGAGGTGTGTGTGTGGTGG - Intergenic
1190494139 X:51011560-51011582 CTTGGGAGGTGTGTGTGTCCAGG + Intergenic
1190889148 X:54554008-54554030 GTTTAGTGGTGAAGGTTTCCTGG + Intronic
1191190582 X:57662459-57662481 CTTGGGGGGTGTATGTGTCCAGG - Intergenic
1191610859 X:63111561-63111583 CTTGGGAGGTGTATGTGTCCAGG - Intergenic
1191670781 X:63746311-63746333 GTTTAGAGAGGGATGTGTTCAGG - Intronic
1191676946 X:63801161-63801183 CTTAGGGGGTGTATGTGTCCAGG - Intergenic
1192406768 X:70893990-70894012 CTTGGGAGGTGTATGTGTGCAGG - Intronic
1193635113 X:83940696-83940718 TTCAAAAGGTGTATGTGTCCAGG + Intergenic
1193825361 X:86219355-86219377 TTTTATAGGTGAATGTGTCATGG + Intronic
1194201849 X:90961415-90961437 TTTGAAGGGTGTATGTGTCCAGG - Intergenic
1194238231 X:91411238-91411260 TTTGGAAGGTGTATGTGTCCAGG - Intergenic
1194825926 X:98562822-98562844 CTTGGGAGGTGTATGTTTCCAGG + Intergenic
1198752207 X:139947075-139947097 GTTTGGAGGTGTTTGAGTCATGG + Intergenic
1199120771 X:144051101-144051123 TTGAAAAGGTGTATGTGTCCAGG - Intergenic
1199152122 X:144499321-144499343 GTTGAGAGGTGAATGGATCCTGG - Intergenic
1199376163 X:147112146-147112168 CTTGGGAGGTGTATGTGTCAAGG - Intergenic
1199740427 X:150730503-150730525 GTTTTGTGGTTTTTGTGTCCAGG + Exonic
1200065124 X:153500677-153500699 GTATACAGGTGTATATGTGCAGG + Intronic
1200547687 Y:4536867-4536889 TTTGAAGGGTGTATGTGTCCAGG - Intergenic
1200731587 Y:6748701-6748723 CTTCGGAGGTGTATGTGTCCAGG + Intergenic
1200736055 Y:6796807-6796829 CTTGGGAGTTGTATGTGTCCAGG + Intergenic
1201350570 Y:13036469-13036491 CTTGGGAGGTGTATGTGTCAAGG - Intergenic
1201761698 Y:17546883-17546905 TTTAGAAGGTGTATGTGTCCAGG - Intergenic
1201782082 Y:17734306-17734328 TTGCAGAAGTGTATGTGTCCAGG + Intergenic
1201819471 Y:18171682-18171704 TTGCAGAAGTGTATGTGTCCAGG - Intergenic
1201839854 Y:18359107-18359129 TTTAGAAGGTGTATGTGTCCAGG + Intergenic
1202174943 Y:22089464-22089486 TTTGAAGGGTGTATGTGTCCAGG - Intronic
1202216419 Y:22496919-22496941 TTTGAAGGGTGTATGTGTCCAGG + Intronic