ID: 1085597140

View in Genome Browser
Species Human (GRCh38)
Location 11:77820546-77820568
Sequence GGTGCTGCAGGCGCCGCCGC CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 316
Summary {0: 1, 1: 0, 2: 3, 3: 38, 4: 274}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085597140_1085597149 10 Left 1085597140 11:77820546-77820568 CCGGCGGCGGCGCCTGCAGCACC 0: 1
1: 0
2: 3
3: 38
4: 274
Right 1085597149 11:77820579-77820601 CAGGGAACGGCAACTCAGGCAGG 0: 1
1: 0
2: 0
3: 16
4: 149
1085597140_1085597150 21 Left 1085597140 11:77820546-77820568 CCGGCGGCGGCGCCTGCAGCACC 0: 1
1: 0
2: 3
3: 38
4: 274
Right 1085597150 11:77820590-77820612 AACTCAGGCAGGTCTAGCAGCGG 0: 1
1: 0
2: 0
3: 12
4: 118
1085597140_1085597148 6 Left 1085597140 11:77820546-77820568 CCGGCGGCGGCGCCTGCAGCACC 0: 1
1: 0
2: 3
3: 38
4: 274
Right 1085597148 11:77820575-77820597 AGCTCAGGGAACGGCAACTCAGG 0: 1
1: 0
2: 0
3: 15
4: 130
1085597140_1085597143 -8 Left 1085597140 11:77820546-77820568 CCGGCGGCGGCGCCTGCAGCACC 0: 1
1: 0
2: 3
3: 38
4: 274
Right 1085597143 11:77820561-77820583 GCAGCACCCGCTCCAGCTCAGGG 0: 1
1: 0
2: 1
3: 19
4: 256
1085597140_1085597142 -9 Left 1085597140 11:77820546-77820568 CCGGCGGCGGCGCCTGCAGCACC 0: 1
1: 0
2: 3
3: 38
4: 274
Right 1085597142 11:77820560-77820582 TGCAGCACCCGCTCCAGCTCAGG 0: 1
1: 0
2: 1
3: 23
4: 262
1085597140_1085597144 -3 Left 1085597140 11:77820546-77820568 CCGGCGGCGGCGCCTGCAGCACC 0: 1
1: 0
2: 3
3: 38
4: 274
Right 1085597144 11:77820566-77820588 ACCCGCTCCAGCTCAGGGAACGG 0: 1
1: 0
2: 0
3: 11
4: 168

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085597140 Original CRISPR GGTGCTGCAGGCGCCGCCGC CGG (reversed) Exonic
900249299 1:1658929-1658951 GCTGCCGCCGCCGCCGCCGCCGG + Exonic
900255066 1:1693563-1693585 GGGGCCGCAGGCGCGCCCGCGGG - Intronic
900263809 1:1746829-1746851 GGGGCCGCAGGCGCGCCCGCGGG - Intergenic
900449990 1:2701161-2701183 GGGGCTGTGGGCGCCGCCCCAGG - Intronic
900453477 1:2762272-2762294 GGGGCTGTGGGCGCCGCCCCAGG - Intronic
900454190 1:2765857-2765879 GGGGCTGTGGGCGCCGCCCCAGG - Intronic
900455669 1:2773279-2773301 GGGGCTGTGGGCGCCGCCCCAGG - Intronic
900622893 1:3595549-3595571 GGTGCTGCAGCCTGTGCCGCCGG - Intronic
900663159 1:3796128-3796150 CGCGCTGGAGGCGCTGCCGCCGG - Exonic
901050791 1:6424970-6424992 GGCGCTGCAGGCGGCGCGGCAGG + Exonic
902465271 1:16613548-16613570 TGGGCTGCAGGCGCAGGCGCAGG - Intronic
903155530 1:21440107-21440129 TGGGCTGCAGGCGCAGGCGCAGG + Intronic
903389433 1:22953681-22953703 GACGCTGCTGGCGCCGCTGCTGG - Exonic
903849033 1:26295346-26295368 GGGGAAGCAGGCGCCGCCCCTGG - Intronic
906315963 1:44786568-44786590 GGCGCAGCAGGCGGCCCCGCTGG + Exonic
906365414 1:45205959-45205981 GGCGCTGCTGGCGGCGCCGCGGG - Exonic
912431220 1:109629482-109629504 GGTGGTGCAGGCACCTGCGCAGG - Exonic
912568791 1:110607149-110607171 TGCGCTGCAGGCTGCGCCGCCGG + Intronic
912910931 1:113758953-113758975 GGAGGGGCAGGGGCCGCCGCTGG + Intronic
913109063 1:115641861-115641883 AGCGCTGCCGGCCCCGCCGCGGG - Intergenic
913131277 1:115839619-115839641 GGGGCTGCACGCACCGCCCCTGG + Exonic
914790852 1:150876431-150876453 GGAGCTGAAGGCGCCGGGGCGGG - Intronic
915246320 1:154558532-154558554 GATGCAGCAGCCGCAGCCGCAGG - Exonic
915300210 1:154947416-154947438 GCTGCTGCAGGCCCAGCTGCAGG - Exonic
916212008 1:162367137-162367159 GGACCTGCATTCGCCGCCGCTGG + Exonic
916920399 1:169460464-169460486 GGGGCTGCAGCGCCCGCCGCCGG + Exonic
917747154 1:178021370-178021392 TGTGCTGCAGGAGCCACAGCAGG - Intergenic
918879571 1:190098924-190098946 GGTGTTGCAGGTGCCGCAGCGGG + Exonic
920333371 1:205228096-205228118 GGGGCTGCAGCCGGCGCCGATGG + Intergenic
920616355 1:207496360-207496382 GGTGCTGCTTGCGCTGCCGGTGG + Exonic
920632860 1:207669537-207669559 GGTGCTGCTCGCGCTGCCGGTGG + Intronic
920655099 1:207868846-207868868 GGCGCTGCTGGCCTCGCCGCGGG - Intergenic
922145820 1:222943127-222943149 GGTGCTGCAGGGCCAGCCTCGGG - Exonic
924775317 1:247111794-247111816 GGTCCTGCAGGCGGAGGCGCCGG + Exonic
1063364215 10:5480085-5480107 TGTGGTGCAGGCGCCGTGGCAGG - Intergenic
1063663617 10:8049586-8049608 ACGGCTCCAGGCGCCGCCGCTGG - Intergenic
1063664100 10:8051507-8051529 GATGCCGCCGCCGCCGCCGCAGG - Intergenic
1065993164 10:31032080-31032102 GGTAGAGCAGTCGCCGCCGCAGG - Intergenic
1066370526 10:34815220-34815242 GAGGCTGCGGGCGCCGCGGCGGG - Exonic
1066476594 10:35752881-35752903 GGTGCTGTAGGGGCTGGCGCAGG + Intergenic
1067082030 10:43217396-43217418 GGTGCTGCAGTCCCAGGCGCTGG + Intronic
1067226902 10:44382538-44382560 AGTGCTGCAGCCGCCCCCGCTGG + Intronic
1068910524 10:62374420-62374442 GCTGCTGCAGCCGCCGCCTCCGG - Exonic
1069205946 10:65685855-65685877 GGTGCTGCAGTCTCTGCCTCAGG + Intergenic
1069761757 10:70816123-70816145 GGAGGTGGAGGGGCCGCCGCGGG + Exonic
1070145835 10:73772729-73772751 GGTGCGCCAGGCGCGGCAGCGGG - Exonic
1070809857 10:79292234-79292256 GCTGCTGCAGCGGCTGCCGCGGG - Exonic
1073136504 10:101223368-101223390 TGTGCCTCAGGCGCTGCCGCTGG - Intergenic
1073336562 10:102714475-102714497 GGAGCTGCAGAGGCCGCCGCCGG + Intergenic
1074459428 10:113623994-113624016 GGTGCAGCTGGAGCCGCTGCTGG - Intronic
1074535860 10:114328351-114328373 GCTGCTGCAGGTGCTGCTGCAGG + Intronic
1075999774 10:126905495-126905517 GGCGCCGCCGGAGCCGCCGCGGG - Exonic
1076554221 10:131311593-131311615 GCAGCTGCCGCCGCCGCCGCTGG + Exonic
1076740321 10:132479609-132479631 GGGGCTGCAGGTGCCACCACAGG + Intergenic
1076821162 10:132940433-132940455 AGTGCTGGAGTCGCCTCCGCAGG + Intronic
1077298101 11:1835371-1835393 GCTGCTGCTGCCGCCGCCACAGG + Exonic
1077637747 11:3855324-3855346 GCTGCTGTCGCCGCCGCCGCAGG + Intronic
1078216187 11:9314195-9314217 GGGCCTGCTGGCGCCGCGGCGGG - Intronic
1079116172 11:17641881-17641903 GTTCCTGCAGGAGCCGCAGCAGG - Exonic
1081812790 11:45922823-45922845 GGGGCTGCAGGCTCCATCGCAGG - Exonic
1083618160 11:64036368-64036390 GGTGGCGCTGGCCCCGCCGCGGG + Intronic
1083795528 11:65014482-65014504 GGTCCTGCAGGCGCAGCGGCGGG + Intronic
1083815136 11:65128405-65128427 GCTTCTGCAGGCGGCGCCGGCGG + Exonic
1083940124 11:65891232-65891254 GGCGCCGCTGGGGCCGCCGCGGG - Exonic
1084000150 11:66291774-66291796 GGCGCTGCCGGCGGCGCCGCCGG + Intergenic
1084087878 11:66862892-66862914 GGTGCTTCAGGAGCAGCCGAGGG - Intronic
1085597140 11:77820546-77820568 GGTGCTGCAGGCGCCGCCGCCGG - Exonic
1089814196 11:121158004-121158026 GGTGCGGAAGACGCCGCCGCCGG - Exonic
1090963450 11:131577660-131577682 GGTACTGCAGACACCACCGCGGG - Intronic
1095060492 12:37682453-37682475 GGTTCTGCAGCCACCGCAGCTGG + Intergenic
1096499950 12:52058695-52058717 TGGGCTGCAGGAGCCGCGGCGGG + Exonic
1097057428 12:56258302-56258324 GGAGCCGCCGCCGCCGCCGCCGG - Exonic
1097232825 12:57522735-57522757 GCTGCCGCAGCCGCCGCCGCAGG - Exonic
1098161165 12:67649085-67649107 AGGGCTGCCGTCGCCGCCGCCGG - Exonic
1098255489 12:68611257-68611279 GGAGCAGCCGCCGCCGCCGCGGG + Intronic
1098426059 12:70366535-70366557 GGCGCTGCCGCCGCCGCCGCCGG + Exonic
1099876785 12:88417646-88417668 GGTGCTTCAGGCACAGGCGCAGG - Intergenic
1100869564 12:98895428-98895450 GTTACTGCGGTCGCCGCCGCTGG + Intronic
1101303348 12:103503670-103503692 GGTGCTGCAGGAGCAGACGAGGG + Intergenic
1102223323 12:111209758-111209780 GGTGCTGCAGGAGAAGCCGGGGG - Intronic
1102453365 12:113057110-113057132 GGCGCTGCAGGCGCGGCCCAGGG - Intronic
1102689099 12:114746566-114746588 AGTGCTGCAGGCACCTCCGGGGG - Intergenic
1103074155 12:117968901-117968923 GCTGCTGCTGCTGCCGCCGCCGG + Intronic
1103308947 12:119989454-119989476 GCTGCTGCTGCTGCCGCCGCCGG - Intergenic
1103433025 12:120904103-120904125 GGAGCCGCCGCCGCCGCCGCGGG - Exonic
1104093289 12:125533678-125533700 GGGGCTCCAGGAGCCTCCGCCGG - Intronic
1105745742 13:23375580-23375602 GGCCCTGCAGGCGCCGCCCGCGG + Intronic
1106246389 13:27953899-27953921 GGGGCAGCCGGAGCCGCCGCAGG - Intergenic
1106776627 13:33016198-33016220 GGTGCGGCAGGCGTCGCCCGCGG - Intergenic
1109008635 13:56910389-56910411 GGAGCTGCCGGCTCCGCCGGAGG + Intergenic
1114452761 14:22837631-22837653 GGGCCTGAAGGCGCCGACGCGGG - Intronic
1114522790 14:23349340-23349362 GCTGCTGCAGGCTCCTCCACAGG - Exonic
1115235791 14:31207662-31207684 GGTGCTGCGGGCGACGGCGGCGG + Intronic
1116828273 14:49693124-49693146 GGGGCTGGAGGCGAGGCCGCCGG + Exonic
1119808627 14:77498730-77498752 GCTGCTGCTGGCGGCGCTGCTGG - Exonic
1123783141 15:23646119-23646141 GCAGGTGCAGGCGGCGCCGCAGG - Exonic
1124957228 15:34367327-34367349 GCGGCTGCGGGCGCCGCGGCGGG - Intergenic
1125674247 15:41494060-41494082 GTCGCTGCGGCCGCCGCCGCGGG + Exonic
1128161015 15:65422902-65422924 CGTGCTTCGGCCGCCGCCGCGGG + Exonic
1130370651 15:83283589-83283611 GAAGCGGCAGGCGCAGCCGCGGG + Intronic
1132286801 15:100669383-100669405 GGTGCTCCAGCAGCCGCCCCTGG - Intergenic
1132735799 16:1385287-1385309 GGAGCTGCCGGAGCCGGCGCTGG + Intronic
1132741102 16:1413929-1413951 GGCGCCGCAGGCCCCTCCGCAGG - Exonic
1132779422 16:1614471-1614493 GGGGCGGCAGGGGCCGCGGCGGG + Intronic
1132897979 16:2237943-2237965 GGGGCTTCAGGCTCCGGCGCAGG - Exonic
1132991612 16:2798502-2798524 GCTGCTGCTGGCGCTGCTGCTGG + Intergenic
1132994774 16:2817286-2817308 GCTGCTGCTGGCGCTGCTGCTGG + Exonic
1133136717 16:3717436-3717458 TTTGCTGCGGGCGCCGGCGCTGG - Exonic
1133156581 16:3880501-3880523 GCTGCCGCCGCCGCCGCCGCCGG + Exonic
1135712541 16:24729880-24729902 GGAGCCGCGGGCGCTGCCGCAGG + Intronic
1136283278 16:29226808-29226830 GGTGCCACCGGCGTCGCCGCCGG + Intergenic
1136399555 16:30010208-30010230 GGTGCTGCATGAGGGGCCGCAGG - Exonic
1137031135 16:35525987-35526009 GGGGCTGCAGGCGCAGCGGACGG - Intergenic
1137655311 16:50153797-50153819 GGTGCTGCTGCCGCTCCCGCCGG - Exonic
1137748525 16:50841364-50841386 GGTGCCGCAGTCGCAGCCGTGGG + Intergenic
1138104997 16:54283123-54283145 GGGGCTGGGGGCGCCGCAGCAGG - Intergenic
1139459423 16:67110025-67110047 GGTGCTGCTGCCGCTGCCGCCGG + Exonic
1139528110 16:67528821-67528843 GCTGCCGCTGTCGCCGCCGCAGG - Intronic
1139583090 16:67884766-67884788 GGTGTTGGAGGCGGAGCCGCCGG + Intergenic
1139750457 16:69106499-69106521 GGGGCTGCAGGAACGGCCGCCGG - Intronic
1140223212 16:73058542-73058564 GCCGCTGCAGCCGCCGCCGCCGG - Intronic
1141670861 16:85491061-85491083 GGTCCTGCAGGCGCCGGGGGAGG + Intergenic
1142364942 16:89645255-89645277 GGAGCTGCAGACGCACCCGCTGG + Exonic
1142379305 16:89722434-89722456 GGCGCTGCAGGCGCTGCCCTCGG + Intronic
1142497493 17:314147-314169 TGTGCTGCAGAGGCCGCTGCTGG - Intronic
1142631517 17:1229243-1229265 GGGGCTGCAGGAGCTGCCGGTGG + Intergenic
1143548499 17:7614555-7614577 GCTGCTGCAGCCGCCGCCGGGGG - Exonic
1143885819 17:10064107-10064129 GCTGCAGCAGCCGCCGCTGCTGG - Intronic
1144207478 17:12989249-12989271 GCTGCTGCAGCCGCCGCCCTGGG - Intronic
1144825748 17:18104825-18104847 GGTGCTGCAGACGCAGCCCCAGG - Intronic
1145296101 17:21593598-21593620 CATGCTGCAGGGGCTGCCGCTGG + Intergenic
1145884463 17:28372425-28372447 GCTGCTGCAGGCGCCGGAGTTGG + Exonic
1146183059 17:30709415-30709437 GCCGCTGCCGGCGCCGCCTCGGG + Intergenic
1146398418 17:32486472-32486494 GCAGCTGCGGGCGCCGCGGCGGG + Intergenic
1147427970 17:40355297-40355319 CATGCTGCAGGAGCCGCTGCTGG + Exonic
1147720514 17:42536760-42536782 GCTGCTGGAGGCGGCGCAGCTGG - Intronic
1147943504 17:44066607-44066629 GCTGCTGCCGCCGCCGCCGCCGG - Exonic
1147971289 17:44220059-44220081 GCTGCTGCTGCTGCCGCCGCCGG + Intronic
1148555534 17:48576762-48576784 GGTGCGGCAGGCTCAGCCGGAGG - Exonic
1148863694 17:50617908-50617930 GGTGATGCAGGCCCTGCCCCAGG + Exonic
1151548701 17:74808900-74808922 GGTGCTGCAGGAGCCCCCAGTGG + Intronic
1151850006 17:76684612-76684634 GCTGCTGCAGGCGCCGGCCTGGG + Intronic
1151947839 17:77329223-77329245 GCTGCTGCAGGCCCTGCAGCTGG + Intronic
1152049084 17:77958760-77958782 GGAGCCGTAGCCGCCGCCGCCGG + Intergenic
1152357404 17:79813731-79813753 TGGGCTGCAGGGGCCCCCGCCGG - Intergenic
1152526944 17:80893746-80893768 GGTGCTGCTGGCGCTGCTGCTGG - Exonic
1152561331 17:81080228-81080250 GGTGCCGCAGGCGCCCCAGCCGG - Intronic
1152689725 17:81712476-81712498 CGTGCAGCAGGCGGCCCCGCAGG - Exonic
1152743801 17:82030208-82030230 GCTCTTCCAGGCGCCGCCGCAGG - Exonic
1153296010 18:3547226-3547248 CTTGCTGCAGGCTCCGCCCCCGG - Intronic
1153794399 18:8609486-8609508 GCCGCTGCCGCCGCCGCCGCCGG - Exonic
1156036155 18:32770288-32770310 GCAGCAGCAGCCGCCGCCGCAGG - Exonic
1156350526 18:36297979-36298001 GCTGCTGCAGGCGCCGCACAAGG + Exonic
1158570929 18:58596482-58596504 GCTGCTGCAGCAGCCGCCGCAGG + Intronic
1159040288 18:63318419-63318441 GCTGCCCCCGGCGCCGCCGCGGG - Exonic
1160701068 19:507668-507690 GGTGCTGGAGGCGCGGCCCGAGG + Exonic
1160719131 19:589895-589917 GGAGCCGCCGCCGCCGCCGCCGG - Exonic
1160730557 19:639958-639980 GCTGCTGCTGGCGCGGGCGCCGG + Exonic
1160810442 19:1010802-1010824 GCTGCTTCAGGCGCCGCCACTGG - Exonic
1161003197 19:1921441-1921463 GGTGCAGCAGGGGCCCCCGGTGG + Intronic
1161628622 19:5340317-5340339 GGTGGTGCAGCCGGCGGCGCTGG + Intronic
1161707266 19:5828026-5828048 CCCGCCGCAGGCGCCGCCGCTGG - Exonic
1161956894 19:7501107-7501129 GCTGCTGCAAGCGCAGGCGCGGG + Exonic
1162752674 19:12838463-12838485 GAGGCTGCAGCCGCCGCAGCGGG - Intronic
1162975736 19:14206353-14206375 GCCGCTGCCGGCGCCGCCTCGGG - Intergenic
1165695105 19:37894968-37894990 GGTGATGGAGGAGCCGCTGCTGG + Exonic
1165803157 19:38565270-38565292 GCCGCCGCACGCGCCGCCGCAGG - Exonic
1166375147 19:42323816-42323838 GGAGCTGCTGGCGCCGCCCCTGG + Intronic
1166762583 19:45234377-45234399 GGCGCTGCGGGCGCGGCTGCTGG - Intronic
1166817226 19:45553615-45553637 GGTGCAGGCGGCGCCGCCACAGG - Intronic
1166986140 19:46660923-46660945 CGTGCAGCAGGCGCTGCGGCTGG - Exonic
1167391233 19:49196499-49196521 GTTGCTGCGGGGGCCGCTGCGGG + Exonic
1167567618 19:50266912-50266934 GGTGCTGCAGGCACGGGCCCAGG + Exonic
1168076325 19:53982545-53982567 GGCGCCGCCGCCGCCGCCGCCGG - Exonic
1168152251 19:54455499-54455521 GGTGCTGCAGGCGCGGCTGCAGG + Exonic
1168257594 19:55175177-55175199 GGAGCTGCAGGCGGCTCCGCGGG - Exonic
1168287584 19:55342224-55342246 GGTGCTGCTGTCGCCGCAGGGGG - Exonic
1168315185 19:55481958-55481980 GGGGCTGGAGGTGCCGCTGCAGG - Exonic
925912704 2:8583766-8583788 CCTGCTGCAGGCGCCGGCGCGGG - Intergenic
927638963 2:24834885-24834907 GGTCCTGCAGGCGCAGCCTCCGG + Exonic
927970833 2:27305664-27305686 GCTGCTGCAGGCGCTGGCCCGGG + Exonic
930762377 2:55050324-55050346 GCAGCTGCTGCCGCCGCCGCCGG + Exonic
931671744 2:64653953-64653975 GGCGCCGCAGGCCCCGCCCCTGG + Intronic
932331328 2:70900086-70900108 GGTGCTGGAGGCGGGGGCGCAGG - Intergenic
932496205 2:72147118-72147140 GGCGCTGCCGACGGCGCCGCAGG + Intronic
932718468 2:74120523-74120545 GGCCCTGCAGGCGTCGTCGCGGG + Intergenic
933279936 2:80322514-80322536 GGGGCTGCAGGCAGCCCCGCGGG - Intronic
935137568 2:100321466-100321488 GGCGCTGCAGGCTCCGCGCCTGG + Exonic
936254910 2:110903251-110903273 GCTACTGCAGGCGCAGCCTCTGG - Intronic
938966320 2:136391859-136391881 GGTGCTGAAGGTGCGGCCACAGG - Intergenic
940987286 2:160062352-160062374 GCTGCTGCTGGGGGCGCCGCGGG - Exonic
941666375 2:168247332-168247354 GGCGCTGCTGTCGCGGCCGCCGG + Exonic
942448429 2:176093224-176093246 GGCGCTGCAGCGGCCGCTGCAGG - Exonic
943060532 2:183038106-183038128 GCTGGTGCCGCCGCCGCCGCCGG + Exonic
943624150 2:190180543-190180565 GCAGCTGCCGGCGCCGCAGCGGG - Intronic
944451776 2:199851027-199851049 AGAGCGGCAGGCGCGGCCGCTGG - Exonic
946688235 2:222292542-222292564 GTTGCTGGAGGCTCCGGCGCTGG - Intronic
948757433 2:240167649-240167671 GCTGCTGCAGAGGCCGCCCCAGG - Intergenic
948869502 2:240791230-240791252 GGTTCTGGAGGCGGCGCCACGGG - Intronic
1170845246 20:19956783-19956805 GGTCCTGCAGGCCCAGCCTCCGG + Exonic
1171484436 20:25476992-25477014 GGAGCTGGAGGAGCCGCCGCAGG - Exonic
1172029018 20:31968576-31968598 GGTGCTGATGGCGGCTCCGCCGG - Exonic
1174386499 20:50190913-50190935 GCTGCTGCTGCCGCCGCTGCCGG - Exonic
1175846987 20:62064742-62064764 GGTGGTGCAGGCGGCGCCCCCGG - Exonic
1176030535 20:63009156-63009178 GGTCCCGCAGGGGCCGCAGCAGG - Intergenic
1176105068 20:63382045-63382067 GGGGCTGGGGGCGCTGCCGCTGG + Intergenic
1178493854 21:33070950-33070972 GGGGCCGCCTGCGCCGCCGCCGG - Exonic
1179881518 21:44295080-44295102 GCTGCTGCAGGAGCCTCCGGGGG + Intronic
1180064340 21:45405140-45405162 CGCGCTGCAGCCGCCGCCGCTGG - Intronic
1181386300 22:22548309-22548331 GGTGCTGCAGGAGACTCTGCAGG + Exonic
1182211316 22:28679702-28679724 GATGGAGCAGTCGCCGCCGCCGG - Exonic
1182547539 22:31084827-31084849 GGTGCTGGAGGAGCCGCTCCCGG - Intronic
1183653245 22:39171035-39171057 GGTCCTGCAGGCTCTGCCTCTGG - Intergenic
1183912881 22:41092223-41092245 GGGGCCGCCTGCGCCGCCGCCGG + Exonic
1184342183 22:43892014-43892036 GGTGCTCCCTGCGCCGCCCCCGG + Intergenic
1184759690 22:46537443-46537465 GGAGCCGCCGCCGCCGCCGCAGG - Intergenic
1185301633 22:50084011-50084033 GGTGCTGCAGGGGCTGCCGGCGG + Intronic
949970217 3:9397576-9397598 GGTGCCCCTGGCGCCGGCGCTGG + Intergenic
950408005 3:12816561-12816583 GGTGCTGCAGGAGCTGGTGCGGG + Exonic
953410994 3:42690483-42690505 GGGGCTGCAGGGGCCGCTGAGGG + Intronic
954838983 3:53494795-53494817 GGTGATGCCGGCCCGGCCGCCGG - Intronic
955911611 3:63864056-63864078 GCTGCAGCCGGGGCCGCCGCCGG - Intergenic
956417861 3:69052100-69052122 GGTGCTGCCGCCGCCACTGCCGG - Exonic
962302010 3:134251094-134251116 TGAGCTGCAGGCGCGGCCGGTGG - Intergenic
962722314 3:138187514-138187536 GCTGCTGCAGGCGCCGGCGCGGG - Exonic
962751048 3:138435010-138435032 GGTGGCGCAGGAACCGCCGCGGG + Exonic
963240910 3:143001590-143001612 CGTGCTGCTGCCGCCGCCGAAGG + Exonic
963602553 3:147390832-147390854 GCTGCTGCCGCCGCCGCCTCCGG - Intronic
966362780 3:179148394-179148416 GCTGCTGCTGCCGCGGCCGCTGG + Intronic
967875451 3:194265525-194265547 GGTGCTGCAGGCTGCACTGCCGG - Intergenic
968092796 3:195909057-195909079 GCTGCTGCAGCAGCCTCCGCGGG + Intronic
968603209 4:1520168-1520190 GTCGCTGGAGGCCCCGCCGCCGG + Intergenic
968616384 4:1579407-1579429 GGTGGCGCAGGCGCCCACGCAGG - Intergenic
968660082 4:1795238-1795260 GGTGCCGGAGGGGCGGCCGCGGG + Intronic
968726684 4:2251159-2251181 GCTGCTCCAGGCGCCGCTTCAGG + Exonic
981093533 4:140756530-140756552 GGAGCTCCAGTCGGCGCCGCGGG - Intergenic
985548857 5:523342-523364 AGAGCAGCAGGCGCCGCGGCAGG - Intronic
985549087 5:524265-524287 GCTGCTGCTGGCGCTGGCGCTGG - Exonic
986660975 5:10059845-10059867 GCTGCTGCTGGCGCCGGCGTTGG - Intergenic
986706265 5:10457125-10457147 GGAGCTGCAGGCACCGCTCCAGG - Intronic
992105503 5:73447155-73447177 GGAGCTGGCGGCGCCGCCACCGG + Exonic
992473123 5:77077287-77077309 GGCGCTGCAGGCGCGGCTGCGGG - Exonic
993577719 5:89622371-89622393 GGTTCTGCAGACACCGCTGCTGG + Intergenic
993901218 5:93585112-93585134 GGCGCCGCCGCCGCCGCCGCGGG - Exonic
997975415 5:138439078-138439100 GCCGCTGCAGCAGCCGCCGCGGG - Exonic
999685855 5:154102377-154102399 GGGGCTGCAGGTGCCACCTCTGG - Intronic
999782231 5:154858677-154858699 GGGGCTGCCGTCGCCGCCGTCGG + Exonic
1001506490 5:172284061-172284083 GGTGCGGAGGGCGGCGCCGCGGG - Exonic
1002691276 5:181052637-181052659 GGTGCTGTCGGCGCTGCCCCCGG + Intronic
1003624091 6:7727052-7727074 GCTGCCGCGGCCGCCGCCGCCGG + Exonic
1004174560 6:13328512-13328534 GCTGCCGCTGCCGCCGCCGCCGG + Intronic
1010716396 6:79234601-79234623 GGAACTGCTGGCGCCGCCGCTGG + Exonic
1011090625 6:83594442-83594464 GATGCTGCAGGGGCCTCCCCAGG + Exonic
1013242710 6:108260928-108260950 GTAGCTGCTGCCGCCGCCGCGGG + Exonic
1015076099 6:129159441-129159463 GGTGATGGAGGCGCCCCGGCCGG + Intronic
1017164214 6:151391768-151391790 AGTGCTGCAGGCGGCGGCGGCGG - Intergenic
1018400331 6:163414610-163414632 GCCGCTGCTGCCGCCGCCGCTGG + Intronic
1018545886 6:164934774-164934796 AATGCTGCAGGCGCCTCAGCAGG + Intergenic
1018710901 6:166497637-166497659 GGTTCTCCAGGCGACACCGCAGG + Intronic
1019198677 6:170296736-170296758 GGTGCTGCAGGAGCCCGCGCGGG + Intronic
1019253770 7:35468-35490 GCTGCTGCCGCCGCCGCCGCCGG + Intergenic
1019352602 7:562014-562036 GGTGCTCCCGGCGCGGCCGGGGG + Intronic
1019651058 7:2158854-2158876 GGTGCAGCAGGTGCAGCCTCAGG - Intronic
1019989560 7:4682263-4682285 GCCGCTGCAGCCGCCGCCGCCGG + Intergenic
1023177675 7:37449001-37449023 GGAGTTGCAGCCGCCGCCCCCGG + Exonic
1023844645 7:44113823-44113845 GCTGCTGCAGGCGTCGCTGTTGG - Exonic
1024520963 7:50304096-50304118 GTACCTGCTGGCGCCGCCGCCGG - Intergenic
1025017362 7:55449816-55449838 GGGGCTGCAGGGGCCGCAGGAGG - Intronic
1025022345 7:55489616-55489638 GCTCCTGCAGGCGCCTCAGCAGG + Intronic
1029390750 7:100272320-100272342 GCTGCTGCTGCTGCCGCCGCCGG + Intergenic
1031521407 7:122770806-122770828 GGTGCAGCAGGAGCTGCTGCAGG + Intronic
1031966578 7:128031733-128031755 GCTGCGGCCGCCGCCGCCGCCGG - Intronic
1032187988 7:129744083-129744105 GAGGCTGCAAGCGCCGCAGCGGG + Intronic
1032785742 7:135198037-135198059 GGTCCTGCAGGCGCCGCTGCCGG + Exonic
1033300005 7:140177004-140177026 GCTGCTGCAGGAGGCGGCGCTGG - Exonic
1034937983 7:155211989-155212011 GGTGCTGCAGGAGCTGGCGTGGG - Intergenic
1035475899 7:159144370-159144392 GGAGCTGCGGGCGCCTGCGCGGG - Intronic
1035593529 8:836431-836453 GGTCCTGCAGGCGCCCTGGCAGG + Intergenic
1036466557 8:9003114-9003136 GCTGCTGGAGTCGCCGCGGCCGG + Exonic
1037900996 8:22689702-22689724 GGTGCTGCTGCCGCCGCTTCGGG - Exonic
1038727615 8:30095462-30095484 GCTGCTGCCGCCGCCGCCTCGGG + Exonic
1040727354 8:50398339-50398361 GGTCCAGCAGGGGCCGCTGCAGG - Intronic
1047615100 8:126557233-126557255 GGAGCCGCAGCCGCCGCCTCAGG - Exonic
1047961801 8:130016498-130016520 GCTGCTGCTGCCGCCGCGGCGGG - Intronic
1049427594 8:142544309-142544331 GCCGCTGCAGCCGTCGCCGCTGG + Exonic
1049557692 8:143291271-143291293 TGAGCTGAAGGCGCCGCGGCTGG + Intronic
1049682172 8:143924282-143924304 GCTCCTCCAGCCGCCGCCGCTGG + Exonic
1049719567 8:144109414-144109436 GGACCTGCAGGCGGCGGCGCAGG + Exonic
1049745319 8:144260790-144260812 GGTCCTGCAGGTGCAGCAGCAGG - Exonic
1049788396 8:144462224-144462246 GGGGCTGCAGCCCCCGCCGCGGG - Intronic
1049799180 8:144509891-144509913 GCTGCTGTGGGAGCCGCCGCAGG - Exonic
1050324943 9:4490071-4490093 CGTTCTGCAGGTGCCGGCGCTGG + Intergenic
1051690289 9:19705424-19705446 GGTGCTGCATGAGCAGCCCCTGG - Intronic
1054835654 9:69672553-69672575 GGTGCCGCCGCCGCCGCCGCGGG - Intergenic
1055090997 9:72364836-72364858 GGTGGCGCCGCCGCCGCCGCGGG + Intronic
1056752509 9:89362798-89362820 AGTGCTGCAGACCCCACCGCAGG + Intronic
1057025376 9:91731060-91731082 GGTGCTGCAGGGCCCACGGCTGG + Exonic
1059769884 9:117414954-117414976 GGTGCTGCGGGCGGCGGCGGCGG + Exonic
1060389890 9:123268525-123268547 GCCGCCGCAGCCGCCGCCGCTGG - Intronic
1060394409 9:123305412-123305434 GGTGCTGTAGGAGCAGCCGGGGG + Intergenic
1060811700 9:126614138-126614160 GCTGCTGCAGACGGAGCCGCGGG - Intergenic
1060811703 9:126614150-126614172 TCTGCAGCAGCCGCCGCCGCCGG + Intergenic
1061128317 9:128690084-128690106 GGTGCCGGGGGCGCCGCCGCGGG - Intronic
1061258028 9:129464085-129464107 GAGGCTGCAGGCGCTGCCCCCGG - Intergenic
1061779378 9:132986790-132986812 GGTGCAGCAGGCGCCAGCCCGGG - Intronic
1062460105 9:136659430-136659452 GGGGCACCAGGCGCGGCCGCGGG - Exonic
1062560407 9:137139195-137139217 GGAGCCGCCGCCGCCGCCGCCGG + Intronic
1062579073 9:137221686-137221708 GGGGCGGCAGGCTCCGCGGCAGG + Intergenic
1062746626 9:138217075-138217097 GCTGCTGCTGCCGCCGCTGCCGG - Intergenic
1185464539 X:346631-346653 GTTTCTGCAGCGGCCGCCGCGGG - Intronic
1186017525 X:5214414-5214436 GGTGCAGCAGGGGTCTCCGCTGG + Intergenic
1189491316 X:41473548-41473570 GGTGCTGCAGGCGCAGGCGGCGG - Exonic
1193715082 X:84927733-84927755 GGTGCTGCAGCCACCACCACTGG - Intergenic
1199724909 X:150569966-150569988 GGTGCTGCAGGCAGCACCACTGG - Intronic
1200100650 X:153687984-153688006 GCGGCTGCAGCCGCCGCCGCCGG + Intronic
1200151261 X:153952523-153952545 GGTGCTCCAGGCCGCGCAGCAGG - Exonic