ID: 1085597865

View in Genome Browser
Species Human (GRCh38)
Location 11:77826602-77826624
Sequence CAGTGTAGCAGGAGTGTACT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 150
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 136}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085597865 Original CRISPR CAGTGTAGCAGGAGTGTACT TGG (reversed) Intronic
901727260 1:11251563-11251585 CAGTGTAGCTGGCATATACTAGG + Intronic
902618263 1:17635559-17635581 CAGGATGGCAGGAGAGTACTTGG - Intronic
906951001 1:50334439-50334461 CTGTGTGGCAGCACTGTACTAGG + Intergenic
908273156 1:62440074-62440096 CAGTAAAGCAGCAGTGAACTTGG + Intronic
908314658 1:62920915-62920937 CTGTGTGTCAGGACTGTACTGGG + Intergenic
908522227 1:64955515-64955537 CAGTGTAGAAGGAGAGAAATAGG + Intronic
909279730 1:73734207-73734229 CAGTGTAGCAGTAATGGAGTGGG + Intergenic
912509671 1:110180390-110180412 CAGATTAGCAGTAGTGTGCTGGG - Intronic
912557574 1:110527287-110527309 CAGATTAGCAGTAGTGTGCTGGG + Intergenic
916511295 1:165474385-165474407 TAGTGGAGCTGGAGTGTGCTGGG + Intergenic
916573695 1:166048970-166048992 CAGTGTGGCTGGAGTGGAATAGG - Intergenic
917472444 1:175337269-175337291 CAGTTAAGCAGGAGAGTGCTGGG - Intronic
920611407 1:207441512-207441534 AAGTGTAGAAGGAGGGAACTTGG - Intergenic
924800759 1:247328645-247328667 GAGTGTAGCAGGGGTGATCTGGG - Intronic
1067016949 10:42764364-42764386 CAGTGTAGGAGGAGGGTCTTGGG - Intergenic
1067086002 10:43238536-43238558 CAGAGTTGCAGGAGTGTATGTGG - Intronic
1067850549 10:49751302-49751324 GAGTGTGGCAGGAGGGTAGTGGG - Intronic
1068603769 10:58982677-58982699 CAGGGAAGCTGGAGTGTATTAGG + Intergenic
1069605022 10:69733396-69733418 CAGTGTGGCTGGGGTGTAGTTGG + Intergenic
1070960003 10:80492009-80492031 CGGTGTAGCAGGAGGGTGCCGGG + Intronic
1073599625 10:104834101-104834123 CAGAGTAACAGCAGTGGACTGGG - Intronic
1073642519 10:105267602-105267624 CACTGAAGGATGAGTGTACTTGG - Intergenic
1074058393 10:109942941-109942963 CAGTCTAGGAGGGGTGTATTAGG + Intronic
1074260909 10:111852235-111852257 CAGTGGAGCAGGAGAGCCCTGGG - Intergenic
1074973247 10:118560240-118560262 CACTGTATCAAGAGTGTTCTAGG - Intergenic
1075107692 10:119552624-119552646 CAGGGTAACAGGAGTGCAGTGGG + Intergenic
1076609246 10:131710719-131710741 CATCCTAGCAGGAGGGTACTGGG + Intergenic
1076653378 10:132005269-132005291 CAGTGTGCCAGGAGTGTGATTGG - Intergenic
1077185574 11:1234041-1234063 CAGTGTGGCCGGGGTGTCCTGGG + Intronic
1078251071 11:9617010-9617032 CAGTGTGACAGGAGTGGAGTGGG + Intergenic
1079209787 11:18450564-18450586 CAGTGAAGCAGGAGGTGACTGGG - Intronic
1080617526 11:33957680-33957702 AAGTGAAGCATGAGTGTACAAGG - Intergenic
1080925968 11:36756165-36756187 CAGAGTAGCAGGTGTCTTCTTGG - Intergenic
1085597865 11:77826602-77826624 CAGTGTAGCAGGAGTGTACTTGG - Intronic
1085937574 11:81168140-81168162 CCATGTGGCAGGAGTGTACTGGG + Intergenic
1086308480 11:85508338-85508360 CCTTGTGGCAGGAGTGTACATGG - Intronic
1091194580 11:133720126-133720148 CTGTGGAGCGGGAGGGTACTGGG + Intergenic
1091574647 12:1721878-1721900 CAGTGTGGCTGGAATGTAATGGG + Intronic
1095577439 12:43757015-43757037 CAGAGTAGCTGGAGTATAGTGGG - Intronic
1097573816 12:61365586-61365608 CAGTGGAGCAGGAGTGGAATGGG - Intergenic
1099435921 12:82644793-82644815 AAGTGTAGCATGTGTGTACTGGG + Intergenic
1099590697 12:84585279-84585301 CAGTGAAGCAGAGGTGTAGTGGG - Intergenic
1101327792 12:103731896-103731918 GAATGTGGCAGTAGTGTACTAGG + Intronic
1101646881 12:106639365-106639387 CAGAGTAGCAGGAGTGGAGTGGG - Exonic
1106810268 13:33351885-33351907 AAGTGTAGCAGAAGTGTAGAGGG - Intergenic
1108000057 13:45897496-45897518 CAATGTAGTAGGACTGGACTGGG - Intergenic
1111356604 13:87114294-87114316 TTGTGTAGCAGAAGCGTACTTGG - Intergenic
1114068295 14:19085728-19085750 CAGTGTAGGAGGAGGGGTCTGGG + Intergenic
1114093969 14:19314297-19314319 CAGTGTAGGAGGAGGGGTCTGGG - Intergenic
1114450322 14:22821283-22821305 CAGTGAAGCTGGAGTGGAGTGGG - Intronic
1117331158 14:54713128-54713150 TAGTGTAGCCTGAGTTTACTCGG - Intronic
1118688385 14:68314237-68314259 CAGTGGAGTAGGAGTGAACTGGG - Intronic
1120836308 14:89041041-89041063 CAGTGGAGCAGAAGTCTGCTGGG - Intergenic
1121343219 14:93116988-93117010 CAGTTTAGCAGGGGTGTTCGAGG - Intergenic
1121498221 14:94412505-94412527 CAGTATAGCTGGAGTGGAATGGG - Intergenic
1122273876 14:100581246-100581268 CATGGTTGCAGGAGTGTTCTGGG + Intronic
1122340898 14:101027879-101027901 CAGTGGAGCAGGTGTGTTCCTGG - Intergenic
1122868645 14:104623138-104623160 GAGTGCAGCAGGAGTGCAATGGG + Intergenic
1126124993 15:45287159-45287181 CAGTGCAGCGGAAGTGTGCTGGG + Intergenic
1133804386 16:9113468-9113490 CACTGTATCAGAAGTGGACTAGG - Intronic
1134379801 16:13713352-13713374 CAGGGCAGCAGGAGAGTGCTTGG - Intergenic
1138892226 16:61157611-61157633 CATTGTAGCAGCAGTGCAATTGG + Intergenic
1139021756 16:62758985-62759007 CAGTGTAGGAGGACTGACCTGGG - Intergenic
1143595591 17:7911846-7911868 CAGTGTGGGAGGAAGGTACTTGG - Exonic
1144422632 17:15112011-15112033 CACTGTAGCAGGAGGGGAGTGGG + Intergenic
1144774248 17:17776962-17776984 CAGTGTAGAAAGTGTGTACAGGG - Intronic
1145226068 17:21129046-21129068 CAGTGTACCAGCATTGTGCTGGG + Intronic
1155775993 18:29762356-29762378 CAATGTGGCTGGAGTGAACTGGG - Intergenic
1156498496 18:37541673-37541695 CAGTGTGACAGGCGTGTCCTGGG - Intronic
1159173742 18:64807582-64807604 CAGTTTGCCAGAAGTGTACTGGG - Intergenic
1161649419 19:5475118-5475140 CAGTGTGGCTGGAGTGAGCTGGG + Intergenic
1164525571 19:29010875-29010897 CAGGGCACCAGGAGTGTTCTGGG - Intergenic
1166215664 19:41333056-41333078 CAGTGTGGCTGGAGTGGAGTAGG - Intronic
1167496666 19:49823255-49823277 CAGTATGGCAGAAGTGGACTTGG - Intronic
928598026 2:32875190-32875212 CTGTGGAGCAGAAATGTACTTGG - Intergenic
928754207 2:34504223-34504245 GAGGGTAGGAGGAGGGTACTAGG + Intergenic
929768251 2:44868895-44868917 CAGTGTGTCAGGAGAGGACTGGG + Intergenic
930633960 2:53785013-53785035 CAGTGTGGCTGGAGTGTAAGAGG - Intronic
935706374 2:105860934-105860956 CAGTGTAGCAATAGTGCCCTTGG - Intronic
935793454 2:106615522-106615544 CAGAGTGGCAGGAGTGGATTTGG + Intergenic
936381204 2:111988107-111988129 CAGGGAAGCTGCAGTGTACTTGG + Intronic
1168737903 20:159612-159634 CTGTGTACCAGCAGTGAACTGGG + Intergenic
1169325191 20:4670136-4670158 GAGTGGAGCATGAGTGTACGAGG - Intergenic
1173897803 20:46563909-46563931 CATTGGAGAAGGAGTGTTCTAGG - Intronic
1177087049 21:16718832-16718854 TATTGTAGCAGGAGTGGAGTGGG - Intergenic
1178370190 21:32021017-32021039 CAGAGCACCAGGAGTGTCCTGGG - Intronic
1178902608 21:36609367-36609389 CAGTGTGGGAGGAGTGAACTGGG - Intergenic
1180486767 22:15808290-15808312 CAGTGTAGGAGGAGGGGTCTGGG + Intergenic
1182585324 22:31341494-31341516 GAGTGTTGCTGGAGTGTGCTGGG + Intronic
1182869411 22:33633107-33633129 CAGTGTTCCAGGACTGTTCTGGG + Intronic
1183282590 22:36939836-36939858 AAGTGAAGAAGGAGTTTACTAGG - Exonic
1184963530 22:47949438-47949460 CAGAGGAGCAGTAGTGTTCTTGG - Intergenic
1185076053 22:48683209-48683231 CAGTGATGCAGGAGTGACCTCGG + Intronic
950129852 3:10534491-10534513 CAGAGTAGCTGGAATGTAGTAGG - Intronic
952941747 3:38450852-38450874 CAATGTTGCAGTAGTGTACATGG + Intergenic
957936326 3:86948642-86948664 CTGTGTAGCATTTGTGTACTGGG + Intronic
958126456 3:89362607-89362629 CATTGTATAAGGAGTGTACTGGG + Intronic
961100383 3:124193556-124193578 GAGTATAGTAGGAGTGAACTTGG - Intronic
961807660 3:129500915-129500937 CAGTAGAGCAGGAGGGAACTTGG + Intronic
962017648 3:131458829-131458851 GAGTTGAGCAGGAGAGTACTGGG + Intergenic
962731948 3:138291796-138291818 CCCTGAAGCAGGAGTGAACTTGG + Intronic
972632762 4:40856726-40856748 CAGTGCAGCAGGACTGTTCGGGG - Intronic
973152327 4:46903482-46903504 CAGTGTAGCCTAAGTGTACAGGG + Intronic
976035877 4:80820514-80820536 CAGTGTTGCTGGAGCGTAGTGGG + Intronic
976872168 4:89808524-89808546 CAGTGTAGTTAGAGTGTAGTTGG + Intronic
977578762 4:98702279-98702301 GAGTGTAGCAGGAGGGTATAAGG - Intergenic
978535206 4:109754827-109754849 CAGTGTAGCTGAGGTGTACTAGG + Intronic
980032505 4:127846374-127846396 CACTGTAGCAGCAAGGTACTGGG - Intergenic
980164909 4:129214051-129214073 CAGTGTAGAAGCATTATACTGGG - Intergenic
982187700 4:152819340-152819362 CAGCATAGCAGTAATGTACTGGG - Intronic
988159284 5:27498581-27498603 CTGTGTGTCAGGAGTGTATTGGG + Intergenic
989622411 5:43397473-43397495 CTGTGGACCAGGAGGGTACTTGG - Intronic
989717435 5:44480846-44480868 CAGTTTTGCAGGACTGAACTGGG + Intergenic
994316020 5:98334248-98334270 CAGTGTGGCATCAGTGTACTAGG + Intergenic
994647340 5:102486718-102486740 CAGTGAAGCAGAAATGTGCTTGG - Intronic
997676792 5:135719370-135719392 CAGTGTCTCAGGAGTGGGCTGGG + Intergenic
998712720 5:144845423-144845445 CATTCTAACAGGTGTGTACTGGG + Intergenic
998983724 5:147731888-147731910 CAGTGTTGCAGCATTGTTCTGGG + Intronic
1001272774 5:170328033-170328055 TTGTGTAGCAAGAGTGTATTAGG - Intergenic
1001725255 5:173890995-173891017 TATTTTAGCAGGAGTGTAATTGG + Intronic
1005270017 6:24153618-24153640 CTGTGTAGCAGGACTATACTGGG + Intronic
1015311386 6:131770862-131770884 CTCTGAAGCAGGAATGTACTTGG + Intergenic
1020223960 7:6265075-6265097 CACTGAGGCAGGAGTGTGCTTGG + Intronic
1028551421 7:92071272-92071294 CAGTTTAGCAGGAGTGTAGAGGG + Intronic
1028980913 7:96967284-96967306 CCGTGTACCAGGTGTGTGCTAGG - Intergenic
1032560329 7:132884185-132884207 CCGTGAAGCAGGCGTGAACTTGG - Intronic
1032949440 7:136890544-136890566 CAGTCTATCAGGAGTGTTCTAGG + Intronic
1041618325 8:59934433-59934455 CAGTGTGGCAGGAGCATAGTTGG + Intergenic
1041803594 8:61825657-61825679 CAGTGTAGTTGGACTCTACTTGG - Intergenic
1042893751 8:73642880-73642902 CAGTGTGGCTGGAGTGAAGTTGG + Intronic
1046826336 8:118695864-118695886 CAGTGTTGGAGGAGTGGCCTGGG - Intergenic
1047800189 8:128301221-128301243 CAGTGTAGCCAGACTGTAGTTGG + Intergenic
1049653018 8:143784215-143784237 CAGTGTTGCAGGAGGGGCCTGGG + Intergenic
1049673454 8:143879591-143879613 CAGTGTGGCAGGTGTGGACAGGG - Intergenic
1051587947 9:18746944-18746966 CAGTAAAGCAGCAGTGTACTTGG - Intronic
1055755796 9:79555968-79555990 TTGTGTAGTAGGAGTGTGCTAGG - Intergenic
1056408264 9:86297966-86297988 CAGTGTGGCAGGAGTGGAACAGG - Intronic
1057744461 9:97740243-97740265 CAGTGCAACAGGAGTGGAATGGG + Intergenic
1057794116 9:98143453-98143475 CAGTGTAGCAGAGGTGAAGTGGG + Intronic
1059155347 9:111984216-111984238 CAATGTGGCAGGAATGTACAAGG - Intergenic
1059441458 9:114309354-114309376 CCGTGTGGCAGGAGGGCACTGGG + Exonic
1059975275 9:119709557-119709579 CAGTGTAGTTGGAGTGAATTAGG - Intergenic
1060228800 9:121812388-121812410 CAGGGTAGCTGGAGAGGACTTGG + Intergenic
1061789490 9:133051616-133051638 CAGTGTGGCCGGAGTGTAGAGGG - Intronic
1062104859 9:134749686-134749708 GAGTGTAACTGGAGTGTAGTTGG + Intronic
1185710930 X:2303301-2303323 CAGTGTTGGAGGAGTGGCCTGGG + Intronic
1190487622 X:50943571-50943593 CACTGTAGCCTGAGTGTCCTGGG + Intergenic
1194193909 X:90869196-90869218 GAGTGGAGCAGGAGTTTAATGGG - Intergenic
1194213298 X:91096140-91096162 TAGTGTACCAGAAGAGTACTGGG - Intergenic
1200540522 Y:4451580-4451602 GAGTGGAGCAGGAGTTTAATGGG - Intergenic