ID: 1085598517

View in Genome Browser
Species Human (GRCh38)
Location 11:77832803-77832825
Sequence CTGCTGTTACAGAGCACAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 224
Summary {0: 1, 1: 0, 2: 4, 3: 15, 4: 204}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085598517_1085598521 1 Left 1085598517 11:77832803-77832825 CCATTTGTGCTCTGTAACAGCAG 0: 1
1: 0
2: 4
3: 15
4: 204
Right 1085598521 11:77832827-77832849 CCCTAACCTTTTTGGCACAAGGG 0: 1
1: 85
2: 1104
3: 1700
4: 1429
1085598517_1085598518 -7 Left 1085598517 11:77832803-77832825 CCATTTGTGCTCTGTAACAGCAG 0: 1
1: 0
2: 4
3: 15
4: 204
Right 1085598518 11:77832819-77832841 ACAGCAGTCCCTAACCTTTTTGG 0: 11
1: 133
2: 546
3: 1093
4: 1556
1085598517_1085598519 0 Left 1085598517 11:77832803-77832825 CCATTTGTGCTCTGTAACAGCAG 0: 1
1: 0
2: 4
3: 15
4: 204
Right 1085598519 11:77832826-77832848 TCCCTAACCTTTTTGGCACAAGG 0: 2
1: 92
2: 1136
3: 1734
4: 1522

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085598517 Original CRISPR CTGCTGTTACAGAGCACAAA TGG (reversed) Intronic
902791629 1:18772602-18772624 CTGCTATTACATTGCAGAAAAGG - Intergenic
905951719 1:41957514-41957536 ATGCTTTTATAGAGCATAAAGGG - Intronic
906584130 1:46961552-46961574 CTGCTCTTCCTGAGAACAAAGGG + Intergenic
908289710 1:62652108-62652130 CTGCTGTCACTGTGCACACATGG + Intronic
908679087 1:66639579-66639601 CTGCTGTGACACTGCATAAAAGG - Intronic
908689158 1:66757906-66757928 CTGCTGTTACAGTGCGAAAGTGG - Intronic
911108973 1:94163290-94163312 ATGCTGATTCAGAGCACACACGG + Intronic
912272623 1:108226570-108226592 CAGCTGTTGGAGAGAACAAATGG + Intronic
912295596 1:108467752-108467774 CAGCTGTTGGAGAGAACAAATGG - Intronic
913180781 1:116319115-116319137 CAGCCATTCCAGAGCACAAATGG + Intergenic
916158976 1:161889770-161889792 GTGGTGTTACAAAGAACAAAAGG + Intronic
916810070 1:168297642-168297664 CTGGTTTTACAGAAGACAAAGGG + Intronic
918376983 1:183919008-183919030 ATGCTGTTTCAGAGTATAAAGGG - Intronic
918968757 1:191384337-191384359 CTGATGTTTCAGAGATCAAAAGG + Intergenic
919009183 1:191937572-191937594 CTACTGTTTCATAGCACAACAGG + Intergenic
919773619 1:201178977-201178999 CTGCTGTAACAGAACACCACAGG - Intergenic
922672781 1:227525564-227525586 CTGCTGTTTGATAGCACAATAGG - Intergenic
922679493 1:227579931-227579953 CAGCTGATGCAGAGCCCAAAGGG - Intronic
1062767742 10:78705-78727 CTGCTGAGACAGAGTAGAAATGG + Intergenic
1063287023 10:4700719-4700741 TTGCTGTTAGACAGGACAAATGG - Intergenic
1064798288 10:19039086-19039108 CTGCTGTTGATGAGCACACAGGG - Intergenic
1064907933 10:20368259-20368281 CAGCAGTTAAAGAGGACAAAGGG - Intergenic
1065236507 10:23657909-23657931 CTGCTGTGGCAGAACAAAAATGG - Intergenic
1066430965 10:35351127-35351149 CTGCTATTACAGAGCTCAAAGGG + Intronic
1067919146 10:50435160-50435182 CTGCTATTAAACAGCACAGATGG - Intronic
1068014084 10:51492543-51492565 CTGTATTTACATAGCACAAAGGG - Intronic
1068599321 10:58938925-58938947 CTAATGATACAGAGAACAAAAGG + Intergenic
1068987572 10:63121311-63121333 CTGCTGCTACAGAGCATTTAAGG + Intergenic
1069043717 10:63721231-63721253 TTGAAGTTACAGAGCACAGAAGG - Intergenic
1069116390 10:64511674-64511696 CTCCTTTTAAAGAGCACACATGG - Intergenic
1070080414 10:73180820-73180842 CTACTATTTCATAGCACAAAGGG - Intronic
1070240519 10:74675631-74675653 CTGCTGTGACAAAGCACAGCAGG - Intronic
1071015006 10:80986738-80986760 CTGATGGTGCAGAGCAGAAAGGG + Intergenic
1071949299 10:90684612-90684634 CTGCTGTTATGCAGTACAAAGGG - Intergenic
1072556316 10:96516632-96516654 CTGCAGTTATAGACCAGAAAGGG - Intergenic
1074904042 10:117844971-117844993 CTGCAGTTATAGAGCAAAAGGGG + Intergenic
1076142910 10:128093764-128093786 CTGCTGTTAAAGAACAGAAGCGG - Intergenic
1078560190 11:12364439-12364461 CTGCTGTTACAAAGTACAGCAGG + Intergenic
1078599036 11:12714644-12714666 CTGCTGTAACAAAGCACCATAGG + Intronic
1082691383 11:56308551-56308573 CAGATTTTACAGAGCACAGAGGG - Intergenic
1083235405 11:61347780-61347802 CTGATTTTACAGATCCCAAAGGG - Exonic
1085230398 11:74963308-74963330 TTGCTTTTACAGGGCACCAAGGG + Intronic
1085265649 11:75236462-75236484 CTGCTGGGACAGAGGACAAAGGG + Intergenic
1085598517 11:77832803-77832825 CTGCTGTTACAGAGCACAAATGG - Intronic
1085657181 11:78327001-78327023 CTGTGGTTAAAGAGCATAAATGG - Intronic
1086173450 11:83861802-83861824 CTACTGTTTCATAGCACAACAGG + Intronic
1087726811 11:101727995-101728017 CTGCTGTTTCAGAGAAGAACTGG + Intronic
1088710049 11:112499731-112499753 CTGCTGTTCCAGAGGACAAAAGG + Intergenic
1091821077 12:3475632-3475654 CTTCTGTTACAGACCAAAAGTGG - Intronic
1092283105 12:7112247-7112269 CTGCTGGTATAGAGGACAAGGGG + Intergenic
1092799880 12:12153947-12153969 CCCCTGGCACAGAGCACAAATGG - Intronic
1093107412 12:15105361-15105383 CTGCTCTAACACAGCATAAAAGG - Intergenic
1098766083 12:74490946-74490968 GTGCTATTACAGAGAACAAGGGG + Intergenic
1100179838 12:92073314-92073336 CTGCTGTAACAAAGTACATATGG - Intronic
1101534421 12:105604366-105604388 ATGCTGATTCAGAGCATAAATGG + Intergenic
1107136605 13:36951462-36951484 CTGAGGTTACAGAGCAATAATGG + Intronic
1107401579 13:40074491-40074513 CTGCGGTCTCTGAGCACAAAGGG - Intergenic
1109386005 13:61629542-61629564 CCACTGTGCCAGAGCACAAAGGG + Intergenic
1110495667 13:76164570-76164592 CTGCTGTTCCAGAGTGCAATGGG + Intergenic
1112174664 13:97010255-97010277 CTGCTGTTACAAAGTACCACAGG + Intergenic
1113491955 13:110699213-110699235 CTGCTGTAACAGAACACCACAGG - Intronic
1114995643 14:28348709-28348731 CAGCTGTTAAAGAGTACAAAGGG - Intergenic
1118941111 14:70339097-70339119 CATCTGTTACAAAGCACAACAGG + Intronic
1119524210 14:75309429-75309451 CTGCTGTTACACAGCTTCAAAGG + Intergenic
1120594498 14:86417045-86417067 ATGCTGATTCAGAGCACACATGG + Intergenic
1121230996 14:92358358-92358380 TGGCTGTTAGAGAGCACAAGTGG + Intronic
1122766361 14:104073863-104073885 GTTCTGTTACAGAACAGAAAAGG - Intergenic
1123025467 14:105421711-105421733 CAGCTGCCACAGGGCACAAAAGG - Intronic
1124690681 15:31819202-31819224 TTGCTGTTATAAATCACAAATGG + Intronic
1125164967 15:36692140-36692162 CTGCTGTTACGGACCACTAGTGG + Exonic
1126209666 15:46086304-46086326 CTACTGTTTCATAGCACAATAGG + Intergenic
1129696517 15:77743335-77743357 CTCCTTTTACAGAGTACATAGGG - Intronic
1130858395 15:87862787-87862809 CAGCTGTTAAAGAGCACTCAGGG + Intronic
1132580516 16:682660-682682 CTGCTTTTCCAGCCCACAAAGGG - Exonic
1135270130 16:21061994-21062016 GTGCTGTCACTGAGCAGAAATGG + Intronic
1135959175 16:26981515-26981537 CTGCTGCTACACAGCACAGCTGG - Intergenic
1138190639 16:55010843-55010865 CTGATTTTGCAGGGCACAAAAGG - Intergenic
1144648120 17:16989197-16989219 CCGCTGGTGCAGAGCAGAAATGG - Intergenic
1148359847 17:47002738-47002760 CTAGTGTTAGAGAGCACAATAGG - Intronic
1149374819 17:56033333-56033355 ATGCAATTACAGATCACAAACGG - Intergenic
1151952375 17:77362217-77362239 CTGGAGCTACAGAGCCCAAAGGG - Intronic
1153149847 18:2079419-2079441 CTGGTGTTATATTGCACAAATGG + Intergenic
1153602730 18:6797525-6797547 CTGCTATTACAGAAGACAAAAGG - Intronic
1154963649 18:21334802-21334824 CTGCTAAAAGAGAGCACAAAAGG - Intronic
1155735944 18:29222350-29222372 CTTCTGTAACATACCACAAACGG - Intergenic
1156534281 18:37847811-37847833 CTTCTGGTAAAGTGCACAAAAGG - Intergenic
1156656538 18:39295050-39295072 TTCGTGTTACAGAGCACAATTGG + Intergenic
1156758886 18:40562398-40562420 CAACTGTAACAGAGCTCAAAAGG + Intergenic
1157131331 18:45010010-45010032 GTTCTGTTACTGAGCACAACTGG + Intronic
1158126119 18:54101266-54101288 CTGCTGTAACAAAGTACAGATGG + Intergenic
1158250093 18:55478258-55478280 GTGCTGTTACAGACCACATTTGG - Intronic
1158764914 18:60438178-60438200 CTACTGTTAGATAGCACAATAGG + Intergenic
1159558914 18:69973977-69973999 ATGCTGATTCAGAGCACATACGG + Intergenic
1159908653 18:74122338-74122360 TTGATGTTACAGAGCACAAGGGG - Intronic
1162605005 19:11699884-11699906 CTGCTGAAACAGAGGAAAAAGGG - Intergenic
1163713247 19:18859529-18859551 CTGCTGTTACAGCGAGCACAGGG - Intronic
1164398221 19:27884762-27884784 GTGCTGTTACTGAGGATAAAGGG - Intergenic
1164717273 19:30402419-30402441 ATGCTGTTACAGATTTCAAAAGG - Intronic
1165185486 19:34017191-34017213 CTGCTGTCATACAGGACAAATGG - Intergenic
1165507024 19:36239737-36239759 CTGCTGTTACAGAGAGAGAATGG + Intronic
1166268973 19:41701890-41701912 CTCCTGTTAATGAGCAAAAAGGG + Intronic
1166983348 19:46645007-46645029 CTGCTCTTTCCGAGCTCAAAGGG + Intergenic
1166996405 19:46721675-46721697 CTGATGTTACAGAGCTTCAATGG + Intronic
926271644 2:11371296-11371318 ATGCTGTTTCACAGCAGAAATGG + Intergenic
926897432 2:17709629-17709651 GTGCTGTTCCAGAGGATAAAGGG + Intronic
929391517 2:41474001-41474023 CTGCTGTAACAGGGAGCAAATGG - Intergenic
931495741 2:62805027-62805049 CAGCTGTTCTAGAGGACAAATGG + Intronic
934872686 2:97881568-97881590 CTCCTGTTACAGAGTAAAACTGG + Intronic
935580629 2:104753156-104753178 CTGGTGTTCCATAGCACAATAGG + Intergenic
935879339 2:107545317-107545339 CTGATGTGAAATAGCACAAATGG + Intergenic
935975232 2:108571893-108571915 CTGCTCTTCCAGAGCTCAACTGG + Intronic
936485429 2:112921385-112921407 CTGTTGTTACAGAACAAAGAAGG + Intergenic
936485652 2:112923336-112923358 CTGTTGTTACAGAACAAAGAAGG - Intergenic
937178365 2:119965956-119965978 ATTTTGTTACATAGCACAAATGG - Intronic
940033696 2:149291153-149291175 CTGCTGTTCCAGAGACCAACTGG + Intergenic
940144425 2:150530953-150530975 CTGCTGTTTCAGACCTCAAAGGG - Intronic
940324704 2:152412906-152412928 CTGCTGTTATAGGTCAGAAATGG + Intronic
941885061 2:170519519-170519541 CTGCTGTCACAGAGAAAAATGGG + Exonic
942956905 2:181783955-181783977 CTGCTGTTACAGGGGAGGAAAGG - Intergenic
943596149 2:189859479-189859501 CTGCTGTCACAGAGCTCCATAGG - Intronic
943916586 2:193643331-193643353 ATGATCTTACAGAGCTCAAAGGG - Intergenic
944347185 2:198683650-198683672 CTGCTGTTATAGATCATAAATGG - Intergenic
945027655 2:205634442-205634464 CATATGTTACATAGCACAAAGGG + Intergenic
945538765 2:211055981-211056003 CTGCTGTTTCAGGGTACACAAGG - Intergenic
1168982830 20:2022569-2022591 CAGCTTTTACTGAGCATAAAAGG - Intergenic
1170898194 20:20435460-20435482 CAGCTAATACAGAGCAAAAAAGG + Intronic
1172634644 20:36401767-36401789 CTGCTGTGACAGAGAAAAAGAGG + Intronic
1173983595 20:47243864-47243886 CTGTTGTTGCAGAGAACAATAGG - Intronic
1174257223 20:49265992-49266014 CAGCTGGGACAGATCACAAACGG + Intronic
1174736364 20:52969534-52969556 CTGAAGTGACAGAGCTCAAATGG + Intergenic
1175856659 20:62124119-62124141 CAGCTGTAACAGAAAACAAAGGG - Intronic
1178195973 21:30345644-30345666 TTCCTTTTACAGAGCACAAGTGG - Intergenic
1178296168 21:31412342-31412364 CTGCTGTTATGGAGTACCAATGG - Intronic
1178593668 21:33933551-33933573 GTGCTGTCACACATCACAAAAGG - Intergenic
1182313731 22:29427833-29427855 CTGCTCTTACACAGAACAACAGG - Intergenic
949506036 3:4728657-4728679 CTGCTATTTCATAGCACAATAGG - Intronic
951384712 3:22028905-22028927 ATGCTGATTCAGAGCACACATGG - Intronic
951547438 3:23841951-23841973 CTGCTGTTAGAGGGCAAAATGGG + Intronic
954665575 3:52249689-52249711 ATGCTGATACACAGCACACAGGG + Exonic
955169762 3:56551756-56551778 CTCCTGATACAAAGCACGAAGGG - Intergenic
955976914 3:64488756-64488778 CTGCTTTTACAGAGGAAGAAAGG - Intergenic
956026474 3:64987966-64987988 CTGCTGTTACAGTGCTCAACTGG + Intergenic
957710040 3:83844714-83844736 CTACTGTTTCACAGCACAACAGG - Intergenic
958934494 3:100241997-100242019 ATGCTGATTCAGAGCACACATGG - Intergenic
962480568 3:135794616-135794638 CTTCTGCTACAGAGCTCAAATGG - Intergenic
964515323 3:157501359-157501381 ATGTTTTTACAGAGCAGAAATGG + Intronic
965980189 3:174681070-174681092 CTGCTGTGACAGGGCACTACTGG - Intronic
966373119 3:179268850-179268872 CTGCTTTTCCAGAGTAAAAAGGG + Intergenic
966423951 3:179761095-179761117 CTGATGCTACAGAGCACAACAGG - Exonic
966461438 3:180181318-180181340 CAGCTGCTACAGAGCAGAGAAGG + Intergenic
967215113 3:187203180-187203202 TGGCTTTTACAGAACACAAAAGG - Intergenic
970342689 4:15123037-15123059 CTACTGTTTCATAGCACAATAGG - Intergenic
970868508 4:20785592-20785614 ATGCTATTTCAGAGCACAATGGG + Intronic
971967801 4:33583923-33583945 CTGCTCTTGCAGAGTACAAATGG + Intergenic
972857347 4:43122415-43122437 CTACTGTTAGACAGCACAACAGG + Intergenic
973855208 4:55004431-55004453 CTGCTGCTACAGAGCTGAAACGG + Intergenic
979340251 4:119514112-119514134 CTGCTGTCAGTGAGCACTAATGG + Intronic
979438511 4:120722807-120722829 CTGTTGATACAGACCACATAAGG + Intronic
980617905 4:135256578-135256600 CTGCTATTCCAGAGGACACAAGG - Intergenic
981896100 4:149801819-149801841 CTGCTGTTTGATAGCACAACAGG + Intergenic
982540678 4:156666230-156666252 CTGCTGTTCCAGAGGACAGGAGG + Intergenic
982570512 4:157045095-157045117 CTACTGTTACCTAGAACAAAAGG + Intergenic
986903607 5:12467579-12467601 CTGCTGCTGCAGAGCACAGGGGG + Intergenic
989985555 5:50692813-50692835 GTGCTGTAACAGATCACACAAGG - Intronic
990700038 5:58464917-58464939 CAGCTGTGACAGAGACCAAATGG + Intergenic
990772198 5:59261022-59261044 CTGCTGTAACTGCACACAAATGG + Intronic
992174333 5:74134570-74134592 GTTCTGTTACAGAACACAGAGGG - Intergenic
992639372 5:78755597-78755619 CATCTGTTGAAGAGCACAAATGG - Intronic
993307928 5:86293418-86293440 CAGCTGTTGGAGAGAACAAATGG - Intergenic
994840258 5:104914968-104914990 CTGCAGTTATATAGCAAAAAAGG + Intergenic
996018744 5:118569257-118569279 ATGCTGATGCAGAGCATAAACGG - Intergenic
996257213 5:121418947-121418969 CTGCTATTTCATAGCACAACAGG - Intergenic
997866485 5:137468221-137468243 CTGCAGTTAAAGAGAACAGAGGG + Intronic
999106421 5:149075126-149075148 CTGCAGTTGCACAGCCCAAAGGG - Intergenic
1003365492 6:5471031-5471053 CTGCTCTTACTGATCAGAAAAGG + Intronic
1005235289 6:23754773-23754795 CTCCTCTTTCAGAGCACATATGG + Intergenic
1006360813 6:33586029-33586051 CTGCTGTGACAGAGCCCCAGAGG + Intergenic
1008831240 6:55765372-55765394 CTGCTGTTTCAAAGCAAAAGAGG + Intronic
1010324389 6:74548390-74548412 CTGCTATTAGATAGCACAATTGG - Intergenic
1011260237 6:85462606-85462628 CTGGTGTCACAGAGAACATAGGG - Intronic
1014242020 6:119028266-119028288 CTGCTGTTAAAGAACAGAACTGG - Intronic
1016771980 6:147861853-147861875 CTGCTGTCACAGAGCCAGAAAGG - Intergenic
1022379370 7:29845318-29845340 CTGCTGTCACTGAGCTCAAGGGG - Intronic
1028347341 7:89798787-89798809 CAGCTGGTACAGAGCCCAGAGGG - Intergenic
1029202314 7:98847338-98847360 CTGCAGAGACAAAGCACAAAGGG + Exonic
1029715007 7:102320865-102320887 CTGCTGGGACCGAGCACTAAGGG + Intronic
1030368949 7:108675428-108675450 ATGCTGATTCAGAGCACATATGG - Intergenic
1031883113 7:127218924-127218946 CTGCTTCCACAAAGCACAAAGGG + Intronic
1033448837 7:141444952-141444974 CTCCTTTCACAAAGCACAAAGGG + Intronic
1036532528 8:9607518-9607540 GTGATGTTACAGAGTGCAAAAGG - Intronic
1040773924 8:51015821-51015843 CTCCTGGTAGAGAGCACAGAAGG + Intergenic
1041742869 8:61175835-61175857 CTGCTGTAACAAATCACAAATGG - Intronic
1042478848 8:69280723-69280745 TTGCTGGGACAGAGCACAAGGGG + Intergenic
1042661864 8:71163289-71163311 CTGCTGGTACAGTCCAAAAAAGG + Intergenic
1043738243 8:83774772-83774794 CAGCTCTTACAGACCACAGAGGG + Intergenic
1043747034 8:83887366-83887388 CTGCTATTTCATAGCACAACAGG - Intergenic
1044607289 8:94058304-94058326 CTGCTGGGACAGAGCAGGAAAGG - Intergenic
1045691946 8:104768439-104768461 CTTCTGTTACAAACCTCAAACGG + Intronic
1046496875 8:115025495-115025517 CTGCAGTTACAGAGCATAAATGG + Intergenic
1046537729 8:115537016-115537038 ATGCTGTTACAGAGCAACAGAGG + Intronic
1046724904 8:117663692-117663714 CAGCTGTGACAGAGCAGAAAGGG - Intergenic
1046773671 8:118141230-118141252 CTTCTGTTACATTGAACAAAGGG - Intergenic
1048583737 8:135753067-135753089 CTGCTATTACAGAGAACAAAGGG - Intergenic
1054921130 9:70543406-70543428 CTGCTGTTTGATAGCACAATAGG - Intronic
1055229896 9:74049712-74049734 CAGCTGTTACAGAAAAAAAATGG + Intergenic
1055252077 9:74319749-74319771 CTGCTGTTTGATAGCACAAGAGG + Intergenic
1059018763 9:110550890-110550912 CTGGTGTTACAAAGCATCAATGG - Intronic
1059546844 9:115184529-115184551 CTGCTGTTTAAGAACACCAAAGG - Intronic
1059555597 9:115277093-115277115 CTGCTGTGACAGGGCAACAATGG + Intronic
1061925673 9:133805003-133805025 CTGAAGCTACAGAGCACACAGGG + Intronic
1185473366 X:398407-398429 CTGTGGTTTCAGAGCACAAGTGG + Intergenic
1188606936 X:32042932-32042954 CTACTGTTTCATAGCACAATAGG + Intronic
1188951104 X:36376317-36376339 CTGCTGCTTCAGAGGACTAATGG - Intronic
1191663328 X:63672622-63672644 CTGATGTCCCAGAGCACACAGGG + Intronic
1191996108 X:67096681-67096703 CTGATGTCACAGAGCCCAAGGGG - Intergenic
1193268466 X:79501342-79501364 CTGCTATTTGATAGCACAAAGGG + Intergenic
1194922264 X:99780666-99780688 CTGCTGTATCAGAGGGCAAAAGG - Intergenic
1195028207 X:100899658-100899680 CTGATCTTACACAGCACAACAGG - Intergenic
1195804484 X:108748232-108748254 CTGCTGATACACTGGACAAAGGG - Intergenic
1196231730 X:113232091-113232113 CTACTGTTAGATAGCACAACAGG - Intergenic
1196659788 X:118257791-118257813 CTGCTGTTTGATAGCACAATAGG - Intergenic
1198314251 X:135450654-135450676 CTGCTGTTACAGAGAATAATAGG + Intergenic
1198634152 X:138676874-138676896 CTCCTGCTACAAAGCATAAATGG + Intronic
1200753425 Y:6967887-6967909 CTGCTGTAACAGAGCACCACGGG + Intronic