ID: 1085599524

View in Genome Browser
Species Human (GRCh38)
Location 11:77842599-77842621
Sequence ACTTGGGATTGGAGAGAAAC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 307
Summary {0: 1, 1: 0, 2: 0, 3: 38, 4: 268}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085599513_1085599524 15 Left 1085599513 11:77842561-77842583 CCTATAAGGACTGCAAAGTATGG 0: 1
1: 0
2: 2
3: 6
4: 106
Right 1085599524 11:77842599-77842621 ACTTGGGATTGGAGAGAAACAGG 0: 1
1: 0
2: 0
3: 38
4: 268
1085599522_1085599524 -8 Left 1085599522 11:77842584-77842606 CCAGGGGGTAGTCGGACTTGGGA 0: 1
1: 0
2: 0
3: 3
4: 60
Right 1085599524 11:77842599-77842621 ACTTGGGATTGGAGAGAAACAGG 0: 1
1: 0
2: 0
3: 38
4: 268

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085599524 Original CRISPR ACTTGGGATTGGAGAGAAAC AGG Exonic
903042220 1:20539867-20539889 TCTTGGGAATGGAGAGAGAGAGG + Intergenic
905713158 1:40124883-40124905 AACTGGGATTGGAGACGAACAGG + Intergenic
906181251 1:43821590-43821612 AATATGGTTTGGAGAGAAACAGG + Intronic
906451243 1:45950063-45950085 ACTTGGGGGTGGAGAGAGAGAGG + Intronic
906822603 1:48945062-48945084 ACTTGAGAGTGGAGAGGCACTGG + Intronic
908425566 1:64003811-64003833 ACTAGGGAGAGGAAAGAAACAGG + Intronic
909413687 1:75381370-75381392 CCTTGGGAATGGGGAGAAAAAGG + Intronic
909796490 1:79744589-79744611 ATTTAGGATAGGAGAGAAACGGG + Intergenic
910132702 1:83927548-83927570 AGTTTGGGTTGGAGAGAAACAGG + Intronic
913122229 1:115752972-115752994 CCTTGGTTTTGGAGAGAAAAGGG + Intronic
913332222 1:117677089-117677111 ACTTAGGAATGAAGAGAAAGAGG - Intergenic
913535803 1:119770981-119771003 TCTTGGGATGGGAGAGCAAATGG - Intergenic
914885593 1:151581834-151581856 GCTTGGGAATGGTGAGACACAGG - Exonic
915179432 1:154045208-154045230 ACTTGGAATTGGGGAAGAACTGG - Intronic
915401957 1:155628732-155628754 CCTTGGGAATGGGGAGAAAAAGG - Intergenic
915674297 1:157516019-157516041 AGTTGGGAATGGAGAGGGACTGG - Intronic
916203672 1:162295197-162295219 AGATGGGATTGGAAGGAAACAGG - Intronic
917506516 1:175632280-175632302 CCTTGGGAACAGAGAGAAACTGG - Intronic
918739095 1:188104250-188104272 ACTAGGTAATGGACAGAAACTGG - Intergenic
920263199 1:204703561-204703583 ACTTGGGAGTAGGGAGACACGGG - Intergenic
921326016 1:213987189-213987211 AATTTGGACTGGAGATAAACTGG + Intronic
921701479 1:218273406-218273428 ATTTGGGGTGGGAGAGAAATGGG + Intergenic
923001931 1:230013341-230013363 ACTTTGGATTAGAAAGAAAAGGG + Intergenic
923851975 1:237805944-237805966 ACTAGAGATTGGGGAGAAAAAGG - Intronic
924026407 1:239837732-239837754 ATTGGTGATTGGAGATAAACAGG - Intronic
924238093 1:242015787-242015809 ACTTAGGAATGGAGAAAAAGGGG + Intergenic
924863568 1:247952996-247953018 CCCTGGGATTGGAGATAAAGAGG + Intronic
1063530481 10:6826244-6826266 CCTTGGGAATGGGGAGAAAAAGG - Intergenic
1065740409 10:28792046-28792068 ACTTGGCAGTGGAGGGGAACAGG + Intergenic
1067665092 10:48270861-48270883 TGGTGGGGTTGGAGAGAAACAGG - Intronic
1069578918 10:69551872-69551894 ACTTAGAATTCAAGAGAAACTGG - Intergenic
1069767040 10:70870107-70870129 ACTTGGGACTTGAGAGACACTGG + Intronic
1071201284 10:83222510-83222532 ACGTGGGGTGGGAGAGAACCAGG - Intergenic
1072707994 10:97695992-97696014 ACTTGGGAGGCGAGAGAAAGGGG - Intergenic
1073117150 10:101097620-101097642 ACATGAGACTGGAGAGAAGCTGG - Intronic
1073553737 10:104427924-104427946 AGTGGGGATCGTAGAGAAACTGG + Intronic
1075464592 10:122642203-122642225 ACTTGGTATTTGAGAGAATCTGG + Intronic
1078612125 11:12830007-12830029 CCTTGGGAGTGGAGAGATAGAGG + Intronic
1079317987 11:19426118-19426140 GTTTGGGATTGGAGAGATTCTGG + Intronic
1080310933 11:30891075-30891097 ACTTGGGAATGTAGAGAAATGGG - Intronic
1081075729 11:38671047-38671069 ACTTGAGATTGGAGAGGTACTGG + Intergenic
1081238486 11:40675649-40675671 ACTTGGTATTGAAGATAAAGTGG - Intronic
1083393182 11:62370546-62370568 CCTTGGGAATGGGGAGAAAAAGG - Intronic
1085599524 11:77842599-77842621 ACTTGGGATTGGAGAGAAACAGG + Exonic
1085717886 11:78889325-78889347 CCCTGGGCTTGGAGGGAAACTGG - Intronic
1085743060 11:79093369-79093391 TCTTGGGATTGGAAAGTGACAGG + Intronic
1087670815 11:101104535-101104557 ACTTCGGAATGAAGAGAAATTGG - Intronic
1087724504 11:101702440-101702462 CCTTGGGAATGGGGAGAAAAAGG + Intronic
1089021855 11:115223996-115224018 ACTGGAGATCAGAGAGAAACAGG + Intronic
1089471368 11:118723078-118723100 CCTTGGGAATGGGGAGAAAAAGG - Intergenic
1089869285 11:121657672-121657694 ACTTGGCCTTGGAGGGAAATAGG + Intergenic
1090348159 11:126087672-126087694 ACCAGGTTTTGGAGAGAAACCGG - Intergenic
1090974656 11:131671095-131671117 GCTTTTGCTTGGAGAGAAACAGG - Intronic
1091088410 11:132746126-132746148 ATTTGGGATTGGTGAGACAAGGG - Intronic
1091613750 12:2033404-2033426 GCCTGGGTTTGGAGAGAAAATGG - Intronic
1091793501 12:3284580-3284602 GCTGGGCATGGGAGAGAAACGGG + Exonic
1093556157 12:20476625-20476647 AGTTGGCATTGGAGAGGAACTGG + Intronic
1095441596 12:42243503-42243525 AATTGGAATTTGAGAGAAAATGG + Intronic
1097330673 12:58329525-58329547 CCTTGGGAATGGGGAGAAAAAGG - Intergenic
1098124382 12:67274957-67274979 ACTTGTGCTTGGAGAAAAGCAGG + Intronic
1099213949 12:79831184-79831206 GTTTTGGATTAGAGAGAAACAGG + Intronic
1101745656 12:107539460-107539482 ACATGAGAATGGAGAGAAAAAGG + Intronic
1102373927 12:112405786-112405808 ACCTGGGAGTGAAAAGAAACAGG - Intronic
1103304010 12:119950008-119950030 TCTTGGGAGTTGAGAGAAAAGGG - Intergenic
1103880009 12:124158843-124158865 GCTTTTGCTTGGAGAGAAACAGG - Intronic
1104680543 12:130748224-130748246 ACATGGGATGGCAGAGAACCAGG + Intergenic
1110480008 13:75962840-75962862 ACTGGGGATTTGATACAAACTGG + Intergenic
1110655197 13:77989534-77989556 ACTTCTGAGTGGAGACAAACGGG - Intergenic
1111247737 13:85562946-85562968 AGTTGGGGATGGAGAGAAATGGG + Intergenic
1113304489 13:109062335-109062357 ACTTGGCATTGGAGATTAAGTGG + Intronic
1113556245 13:111238010-111238032 CCTTGGGCTTGGAGAGTGACGGG + Intronic
1114813294 14:25926703-25926725 TCTTGGCATTGCAGAGAAGCAGG - Intergenic
1115882657 14:37937481-37937503 ACTAAGAATTGGAGAGAAAGAGG - Intronic
1117043215 14:51786800-51786822 AATTGGTATTGGAGACAAAAAGG - Intergenic
1117556692 14:56893564-56893586 ATTTTGGATTAGAGAGACACAGG + Intergenic
1118314723 14:64718939-64718961 ACTGGGAGCTGGAGAGAAACAGG - Intronic
1118855323 14:69616937-69616959 AGGTGGGATTGTAGAGAAATAGG - Intronic
1118891801 14:69916221-69916243 ATTTGGGATATGAGAGAAAGAGG - Intronic
1118926231 14:70192187-70192209 ACTTAAGATGGGAGAGAAGCAGG - Intergenic
1119380689 14:74226277-74226299 ACTTGGGGTAGGAGAGAAGATGG - Intergenic
1119424208 14:74525175-74525197 ACAGGGGATTGCAGAGATACAGG - Exonic
1120366214 14:83573796-83573818 AATTGGGATGAGAGAGAAAAGGG + Intergenic
1120381670 14:83788726-83788748 ACATGGGATTGATTAGAAACTGG - Intergenic
1121822045 14:96978380-96978402 CCTTGGGCTTGGAGTGAAAAGGG - Intergenic
1123218355 14:106832936-106832958 GCTTGGGAAGAGAGAGAAACTGG + Intergenic
1124094148 15:26633117-26633139 ACTTGGGATTTGAGAGCAAAGGG - Intronic
1126307268 15:47274207-47274229 GCTTGAGATTTGAGAGAAAAGGG + Intronic
1127332082 15:57949385-57949407 GCCTGGGATTAGAGAGAAAGAGG + Intergenic
1128128023 15:65207161-65207183 AGAGGGGATTGGAGAGATACTGG - Intronic
1129432364 15:75509066-75509088 ACTTGGGCTTGAAGAGTCACAGG - Intronic
1131502447 15:92982206-92982228 ACTTGGCCTTGGAAAGAAAAAGG + Intronic
1132072398 15:98790079-98790101 ACTTGGGTTTGGAAAGAGGCCGG + Intronic
1134780171 16:16888216-16888238 AGCTGGGACTGGAGAGCAACTGG + Intergenic
1136930520 16:34414115-34414137 CCTTGGGAATGGGGAGAAAAAGG - Intergenic
1136974054 16:34997693-34997715 CCTTGGGAATGGGGAGAAAAAGG + Intergenic
1137357279 16:47778772-47778794 ATCTGGGATGGGAGAGAAAGAGG + Intergenic
1138506379 16:57480294-57480316 GCCTGGGGCTGGAGAGAAACAGG - Intronic
1138939747 16:61775971-61775993 ACTTGGGCTTAGAGAGAAAGAGG - Intronic
1139761566 16:69187847-69187869 ACCCGGGTTTGGAGAGAGACGGG - Intronic
1140429096 16:74886196-74886218 AGTTGTGATTGTGGAGAAACTGG + Intronic
1144594238 17:16553562-16553584 ACTTGGGAAAGGAGACAAAGAGG + Intronic
1144802910 17:17943465-17943487 ACTTGGGTATGGAGAGAATGTGG + Intronic
1146558118 17:33844602-33844624 ATCTGGGAATGGAGAGTAACCGG + Intronic
1146771244 17:35570454-35570476 ACATTGGATGGGAGAGAAACTGG + Intergenic
1147211071 17:38872722-38872744 ATGGGGGATTGTAGAGAAACGGG - Intronic
1147288784 17:39424738-39424760 ACTGGGGATAGGAAAGAAAAAGG + Exonic
1147441583 17:40450848-40450870 ACTGGGGAGTGGAGAGAAAAAGG - Intronic
1148481183 17:47960437-47960459 ACTTGGGAAGGGAGAGCCACAGG - Intergenic
1148569946 17:48660233-48660255 AATTTGGAGTGGAGAAAAACTGG + Intergenic
1149285688 17:55161655-55161677 ACTAGGTATTTGACAGAAACAGG - Exonic
1151481160 17:74370705-74370727 ACTTGGGCTTGGCCAGAAATGGG + Intronic
1154388577 18:13917364-13917386 TCTTGGGATGAGAGAGAGACTGG - Intergenic
1154439297 18:14373328-14373350 CCATGGGATTGGAGAGCAAGAGG - Intergenic
1155595424 18:27480579-27480601 ATTTGGGAATGGAGGGAAACCGG + Intergenic
1160620761 18:80169061-80169083 TCTGGGGAAGGGAGAGAAACAGG + Exonic
1161527886 19:4768809-4768831 AATTGGGAATGGGAAGAAACAGG + Intergenic
1161753981 19:6117979-6118001 ACCTGGGTTTGGAGTTAAACAGG + Intronic
1162553772 19:11373855-11373877 AGGTGGGATTGATGAGAAACAGG - Intergenic
1163920515 19:20284371-20284393 ACTTGGGAATGGGGAGAAAAAGG + Intergenic
1164370510 19:27639683-27639705 CCTTGGGAATGGGGAGAAAAAGG - Intergenic
1165232075 19:34393523-34393545 GCCTAGGATAGGAGAGAAACAGG - Intronic
1165606402 19:37108695-37108717 CCTTGGGAATGGGGAGAAAAAGG - Intronic
1166444206 19:42844771-42844793 GCTTGTGATTGGGGAGAAACAGG - Intronic
926803628 2:16684513-16684535 ACTTGGATTTGCAGAGAAAATGG + Intergenic
927608931 2:24516692-24516714 ACATGGGAGAGGAGAGAAAAGGG - Intronic
927895006 2:26775929-26775951 ATTTGGGAGTGGAAAGGAACAGG + Intronic
928457423 2:31435126-31435148 ATTTGGTAGTGGAGAGAAACAGG + Intergenic
929531202 2:42754081-42754103 TTTTGTGGTTGGAGAGAAACTGG + Exonic
930547945 2:52793485-52793507 AGTTGGAGTTGGAGAGAAAAAGG + Intergenic
931270038 2:60693508-60693530 ATAAGGGATTGGAGAGAAAGAGG + Intergenic
931911226 2:66902348-66902370 AGTTGGGATGGGAGAGAAAATGG + Intergenic
931911366 2:66903606-66903628 AGTTGGGATGGGAGAGAAAGTGG - Intergenic
932638424 2:73414922-73414944 ACCTGGAATTGGAGAGTAATGGG - Intronic
933231000 2:79806989-79807011 ATTTGGGAATAAAGAGAAACAGG - Intronic
936029601 2:109060455-109060477 ACTGGGGAGGGGAGAGAATCAGG + Intergenic
937653305 2:124344949-124344971 ACTTGGAAGTGGGGAGAAGCAGG + Intronic
937940576 2:127282362-127282384 ACTTGGCACTGGAGACAAAGTGG - Intronic
939451528 2:142380608-142380630 ACTTGGAAAAGGAGAGAAACTGG + Intergenic
940699662 2:157024736-157024758 ACTTGCGACTGGAAAGAAAAAGG - Intergenic
941489614 2:166127109-166127131 ATTTGGCATTGGATAGAAAAGGG + Intronic
941712295 2:168726979-168727001 ACTTGGGATTTGTGAGAATATGG - Intronic
943670601 2:190656235-190656257 ACTTCAGATTGGAGAGAGGCAGG + Intronic
943906921 2:193511117-193511139 ACTTGCGATTGGAGACACTCAGG + Intergenic
944291182 2:198006936-198006958 ACTTGGTATTGCAGAGATATAGG - Intronic
944713974 2:202360786-202360808 GCTTGGGGTTGGGGAGAAACAGG - Intergenic
945069354 2:205975494-205975516 AGATGGGGTTGGGGAGAAACAGG - Intergenic
945842575 2:214905498-214905520 ACTTGGCATTGGGGAGAGATAGG + Intergenic
946189579 2:218001334-218001356 AATGAGGATTGCAGAGAAACAGG - Intronic
946539303 2:220666301-220666323 AGATGGGATTGGGGAGAAAAGGG - Intergenic
946918395 2:224550978-224551000 ACTTGGTAATGGAGAGGAATGGG - Intronic
947156361 2:227165448-227165470 ACTTGGAATTTGAGTGAAACTGG + Intronic
947282114 2:228466869-228466891 ACTTGGGATTTAATAGAGACGGG + Intergenic
948618148 2:239214841-239214863 GCATGGGACTGGAGAGAAATAGG + Intronic
1169229801 20:3880420-3880442 CCTAGGGAATGGATAGAAACAGG + Intergenic
1172716680 20:36969447-36969469 ACTTGGCCTTGGAGTGTAACAGG + Intergenic
1173128104 20:40358918-40358940 ACTTGGGGTGGGAGAGCTACTGG + Intergenic
1173692185 20:44969401-44969423 ACTTGTGTTTGGAAAGATACAGG + Intronic
1173710321 20:45149919-45149941 TGTTGTGATTGGAGAGAAAAAGG + Intergenic
1173887736 20:46476230-46476252 ACCTGGGACAGGAGAGAGACTGG + Intergenic
1174227993 20:49020405-49020427 ACTGGGCATTGGAGAGAAGCTGG - Intronic
1175390125 20:58621845-58621867 ACTTGTGAGTGGAGAGCAATGGG - Intergenic
1178587381 21:33881506-33881528 CCATGGAATTGGAGAGAGACGGG + Intronic
1178880005 21:36441930-36441952 ACTTGGGCTGAGAGGGAAACAGG - Intergenic
1179055591 21:37929141-37929163 ACCTGAGAATGGAGAGAAATAGG + Intergenic
1180740279 22:18048777-18048799 ACTTGGAATAGGAGGGGAACAGG - Intergenic
1180838489 22:18945764-18945786 CCTTGGGAATGGGGAGAAAAAGG + Intergenic
1183054501 22:35295312-35295334 AATTGGGAATACAGAGAAACAGG + Exonic
1183506562 22:38212519-38212541 ACTTGGTAATGGGGAGAAAAAGG - Intronic
1184085208 22:42258110-42258132 TCCTGGGATTTTAGAGAAACTGG - Intronic
1184262132 22:43324420-43324442 CCTGGGGATTGGAGAGGAACTGG - Intronic
1184640702 22:45868487-45868509 ACGTGAGACTGGAGAGAAAGAGG - Intergenic
949192566 3:1267583-1267605 ACTTGATATTGGAGAAAAATTGG + Intronic
951246225 3:20344716-20344738 ACTTGGGGAGGGAGAGAAAAGGG + Intergenic
952042945 3:29281803-29281825 ACTTGGGATGGGAAACAGACAGG + Intronic
952698279 3:36296309-36296331 ACATGGGCTTGGAAAGAGACTGG - Intergenic
952899523 3:38100224-38100246 ACTTGGAATTGCAGAGGAACTGG - Intronic
953493088 3:43366046-43366068 GCTTGGGCTTGCAGAGAAAAGGG - Exonic
954112929 3:48445815-48445837 ATTTGGCAATGGAGAGTAACAGG - Intergenic
955545134 3:60019824-60019846 AGTTGGGATTGGAGCTCAACTGG + Intronic
955650948 3:61193243-61193265 TCCTGGTATTGGAGAGAAGCTGG + Intronic
955662776 3:61319020-61319042 ACTGGGGAATGATGAGAAACTGG - Intergenic
955765678 3:62341922-62341944 CCTGGGGAGTGGAGAGGAACGGG + Intergenic
956312979 3:67902600-67902622 TCTAGGCAGTGGAGAGAAACAGG - Intergenic
956518082 3:70072603-70072625 ACTTGGGAAAGAAGAGAAAAGGG + Intergenic
958650765 3:96932956-96932978 ACTTGGTATGGGAAAGATACAGG + Intronic
959070626 3:101698930-101698952 CCTTGGGAATGGGGAGAAAAAGG + Intergenic
960027586 3:113026336-113026358 CCTTGGGAATGGGGAGAAAAAGG - Intergenic
960179065 3:114553015-114553037 ACGTGGATTTGGAGAGAAAAGGG - Intronic
963692368 3:148519999-148520021 AGTTGGGAGTGGAGTGACACAGG - Intergenic
966656568 3:182364958-182364980 TCATGCGATTGGAGAGAAAAGGG + Intergenic
967026016 3:185564614-185564636 CCTTGGGAATGGGGAGAAAAAGG - Intergenic
967873825 3:194252832-194252854 AACTGGGAATGGAGAGAAACCGG + Intergenic
968073237 3:195801304-195801326 AGTTGATATTGGAGAGAAACAGG + Intronic
968614929 4:1573484-1573506 GCTGGGGATTGGAGAGGATCTGG - Intergenic
970744040 4:19273784-19273806 AATTGGGATTGTTGACAAACAGG + Intergenic
972673045 4:41232289-41232311 ATTTGGGATGTGAGAGAAAGAGG + Intergenic
973030174 4:45327737-45327759 ACATGGGAGTGGAGAGAACATGG + Intergenic
973030263 4:45328930-45328952 ACATGGGAGGGGAGAGAAAACGG + Intergenic
974981495 4:68963269-68963291 TCTTGAGACTGGAGAGAAAGAGG - Intergenic
975571769 4:75825261-75825283 AGGTGGGATGGGAGAGAGACAGG + Intergenic
976308151 4:83582091-83582113 ACTTGAGGATGGAGAGAAAAGGG + Intronic
977277564 4:94996654-94996676 CTTTGGGATTAGAGAGAACCTGG + Intronic
977724315 4:100277187-100277209 ACTTGGGATGGGAGAGCAGAAGG + Intergenic
978227954 4:106361259-106361281 ACTTGGGAAGGGAGACAGACAGG + Intergenic
978343419 4:107740678-107740700 ACTTGGGGTTGGAGTGGAAGAGG - Intergenic
983139653 4:164134271-164134293 CCTTGGGATTGTAGAAACACTGG - Intronic
986881846 5:12183921-12183943 ACTGGGGAATGAAGAGAAGCAGG + Intergenic
987139374 5:14929714-14929736 ACTTTGGATTGGTGGGAAAGAGG + Intergenic
987461635 5:18218595-18218617 GGTTGGGATGGGAGTGAAACAGG - Intergenic
987924673 5:24325166-24325188 GCTTGGGAATGAAGAGGAACAGG + Intergenic
988380140 5:30488711-30488733 CCTTGGGAATGGGGAGAAAAAGG - Intergenic
988895377 5:35666728-35666750 AATAGGGATCGGAGAGAAACAGG - Intronic
990057183 5:51597822-51597844 ACTTGGGATTGCAGGGATGCAGG + Intergenic
990122798 5:52476075-52476097 ACTTGGGCATGGAGGGACACTGG + Intergenic
992259393 5:74954489-74954511 GCTTGGGATCAGAGAGAACCAGG + Intergenic
993639498 5:90384377-90384399 GCTTGGGATTGGAGGCAAAGAGG - Intergenic
995400520 5:111735950-111735972 ACATGGACTTGGAGAGAATCTGG - Intronic
996967190 5:129320506-129320528 ACATGGGATTTGAGAGAAGCCGG - Intergenic
997494541 5:134311027-134311049 ATTTGGGCTTTGAAAGAAACAGG - Intronic
998456532 5:142278146-142278168 ACTAGGGAGTGGGGAAAAACAGG + Intergenic
999951862 5:156659772-156659794 CCTTGGGAATGGGGAGAAAAAGG - Intronic
1000610226 5:163365556-163365578 AGTTGGCAGTGGAGAGAAATGGG - Intergenic
1001713624 5:173797263-173797285 GCATGTGATTGGAGAGAAGCAGG + Intergenic
1002066038 5:176652210-176652232 ACCTGGGAATGGAGCCAAACGGG - Intronic
1002172506 5:177383390-177383412 ACGGGGGAATGGAGAGAAACAGG + Intronic
1003287637 6:4748492-4748514 ACTTGGAATAGGAGCAAAACAGG + Intronic
1004269696 6:14183763-14183785 AGTTGGGTTTGAAGAGATACTGG + Intergenic
1005056732 6:21736419-21736441 ATTTTGGATTGGAGGGAAATGGG + Intergenic
1006745005 6:36335479-36335501 ACTTGGGACAGGAGAAATACAGG - Intronic
1008228238 6:48950341-48950363 GCTTGGTATTGGAGAGGAAGAGG - Intergenic
1008808854 6:55467431-55467453 AGTTGGGATTGGATATAAAGTGG - Intronic
1008890487 6:56483242-56483264 ACTAGTGATTTGAGAGAAATTGG - Intronic
1010591615 6:77719003-77719025 CCTTGGGAATGGGGAGAAAAAGG - Intronic
1010897506 6:81382469-81382491 ACGTGGGATTGAAGAGAATCTGG - Intergenic
1011215600 6:85002521-85002543 ACTCAGCATTGGAAAGAAACTGG + Intergenic
1011348835 6:86400642-86400664 ACTGGGTAATGGATAGAAACTGG - Intergenic
1015553624 6:134438224-134438246 ACTGGGGATTAGAGAGAGAACGG + Intergenic
1015872552 6:137791694-137791716 CCTTGGGACTGGATAGAGACAGG + Intergenic
1017560726 6:155625485-155625507 CCTGGGGAAAGGAGAGAAACTGG - Intergenic
1019976289 7:4584492-4584514 CCTTGGGAATGGGGAGAAAAAGG - Intergenic
1019977225 7:4592996-4593018 CCTTGGGAATGGGGAGAAAAAGG - Intergenic
1020876141 7:13696868-13696890 TGGTGGGAATGGAGAGAAACAGG - Intergenic
1023335489 7:39164888-39164910 ACTTGGGAATGGAGTGAATGAGG - Intronic
1023579352 7:41664611-41664633 AGATGAGATTGGAGAGATACGGG - Intergenic
1026155723 7:67823999-67824021 ACGTGGGATATGAGAGAAAGAGG - Intergenic
1026212058 7:68314423-68314445 ACTTGGGATTGGCCAGCAAAGGG + Intergenic
1026223313 7:68419143-68419165 ACTGGGGACTGGGGAGAAACTGG - Intergenic
1028793471 7:94878750-94878772 AGTGGGGAATGGGGAGAAACAGG + Intergenic
1029007645 7:97227252-97227274 ACTGGGGAATGGAGAGAATATGG + Intergenic
1029673434 7:102049733-102049755 ACATAGGAAGGGAGAGAAACTGG + Intronic
1030287181 7:107838600-107838622 CCTTGGGATTGGAGACAAGACGG + Intergenic
1030823645 7:114127070-114127092 ACGTGAGATTGGAATGAAACAGG - Intronic
1031413559 7:121468299-121468321 ATTTGGAAATGGAGAGAAAGTGG + Intergenic
1033726345 7:144122842-144122864 ACTTGGGATTGGACAGGGACAGG - Intergenic
1034220279 7:149439078-149439100 CCCTGAGATTGGAGAGAAAAGGG - Intronic
1034586172 7:152094397-152094419 ACTTGGGCCTCGAGTGAAACGGG - Exonic
1035636719 8:1152664-1152686 ACTTGGGTTTGGGGAGAAATGGG + Intergenic
1036533304 8:9618724-9618746 ATTTGGAAATTGAGAGAAACAGG + Intronic
1037456032 8:19065303-19065325 ACTTGGTGATGGAGAGAAAGAGG - Intronic
1037608671 8:20458477-20458499 ACTTGGGGTTGGAGAGATCAAGG + Intergenic
1037709923 8:21347438-21347460 ACTAGGGGGTGGAGAGAAAAAGG - Intergenic
1037828697 8:22176099-22176121 ACTAGTGAGTGGAGAGAAAGAGG - Intronic
1041283991 8:56241759-56241781 ACTGTGGATTTGAAAGAAACAGG + Intergenic
1044588164 8:93887222-93887244 ACTTGGGATTTGAGACAATGAGG - Intronic
1045434621 8:102149584-102149606 ACTTGGGATTGCATTGAATCTGG - Intergenic
1045795622 8:106040051-106040073 ACTTGGCATTGTAGAGATAGAGG + Intergenic
1046421727 8:113993837-113993859 ACTGGGGATTGAAGATCAACTGG - Intergenic
1047350929 8:124072858-124072880 ACTTGGGTTTTGGGAGAAACAGG + Intronic
1047736242 8:127767734-127767756 ACCTGGGATGGGAGAGCTACTGG - Intergenic
1047825137 8:128565144-128565166 CCCTGGGGTTGGAGAGAATCTGG + Intergenic
1048499242 8:134960784-134960806 ATGTGGGATGGGAGACAAACAGG + Intergenic
1048799314 8:138181534-138181556 GCCTGGGATTGGAGAGGACCAGG - Intronic
1049971719 9:827280-827302 ACTTAGGATTGGAGCGGGACGGG - Intergenic
1050700487 9:8333089-8333111 ATTTGGGGATGGAGATAAACAGG + Intronic
1050772765 9:9223677-9223699 ACTTGGTACTTGAGAAAAACAGG + Intronic
1050981153 9:12017779-12017801 ACTTGGGCTTTGAGAGTCACAGG - Intergenic
1051834286 9:21317574-21317596 AAATGGGAGAGGAGAGAAACTGG - Intergenic
1051834291 9:21317598-21317620 AAATGGGAGAGGAGAGAAACTGG - Intergenic
1054769365 9:69069562-69069584 ACTTGGCAGTGGAGGGGAACAGG + Intronic
1055599245 9:77898156-77898178 ACTTCAGATTGTAGAGAAAGAGG - Intronic
1055784335 9:79856326-79856348 AATTGGGAGTGGGGAGAAAGAGG - Intergenic
1057250132 9:93494385-93494407 ACTTGGCAATGGAGGGGAACAGG - Intronic
1058136741 9:101316089-101316111 ACTTTGGAGTGGAGAGACCCAGG - Intronic
1058469320 9:105261038-105261060 ACTTGCCAATGGAGAGAAATGGG + Intronic
1059374007 9:113867521-113867543 TCTTGAGATTGAAGAGAAGCTGG + Intergenic
1060992293 9:127856090-127856112 AGTTGGGATTGGGGAGAAGAAGG + Intergenic
1062574881 9:137201351-137201373 ACTAGGGATTTCTGAGAAACTGG - Intronic
1203785237 EBV:123927-123949 ACTTGGGATTGGGCATAAACAGG + Intergenic
1186218038 X:7321268-7321290 ACTTGAGAGTGGAGGGAAAGAGG + Intronic
1186592692 X:10947941-10947963 ACTTGTGATTGGATAGAAAATGG + Intergenic
1186961619 X:14742994-14743016 ACTGAGGCTTTGAGAGAAACTGG - Intergenic
1187193377 X:17057854-17057876 TCTTGGGATTGGAGACACATGGG + Intronic
1189558068 X:42165832-42165854 ACTTGGGGTTGGGGACAAAGGGG + Intergenic
1189818184 X:44845071-44845093 ACTTTGGGTTGGAAAGAACCGGG - Intergenic
1192881345 X:75286810-75286832 ACTTGGAATTGGAGAGCTCCAGG + Intronic
1195117805 X:101717158-101717180 ACAGGGGAATGGAGAGAAACAGG - Intergenic
1195520397 X:105822648-105822670 AGTTGGGAGTGGAGGGAAACCGG - Exonic
1196669989 X:118355788-118355810 ACTGGAGATTGGAGAGAACCAGG - Intronic
1197110766 X:122771541-122771563 AGTGGGGATGGGGGAGAAACAGG + Intergenic
1197599062 X:128506158-128506180 AGGAGGGATTGGAGAGACACAGG - Intergenic
1197766395 X:130061906-130061928 ACTTGGAGTAGGAAAGAAACTGG + Intergenic
1197829298 X:130624840-130624862 ACTGGGGATTGGAAAGACAATGG + Exonic
1198437325 X:136629963-136629985 CCTTGGGTTGGGAAAGAAACAGG - Intergenic
1201646896 Y:16243604-16243626 ACATGGAATTGGAATGAAACTGG - Intergenic
1201655915 Y:16341698-16341720 ACATGGAATTGGAATGAAACTGG + Intergenic
1201867201 Y:18668297-18668319 GCTTGGAATTGGAGAGACATGGG + Intergenic
1201873277 Y:18733516-18733538 ACTTAGCACTGGAGAAAAACTGG + Intronic