ID: 1085603249

View in Genome Browser
Species Human (GRCh38)
Location 11:77874561-77874583
Sequence GTGCACCAGGTTCCAAAGTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 111
Summary {0: 1, 1: 0, 2: 2, 3: 12, 4: 96}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085603249_1085603254 11 Left 1085603249 11:77874561-77874583 CCCTACTTTGGAACCTGGTGCAC 0: 1
1: 0
2: 2
3: 12
4: 96
Right 1085603254 11:77874595-77874617 TGGAAATATGTAGAGCTTGAAGG 0: 1
1: 0
2: 0
3: 17
4: 518
1085603249_1085603253 -9 Left 1085603249 11:77874561-77874583 CCCTACTTTGGAACCTGGTGCAC 0: 1
1: 0
2: 2
3: 12
4: 96
Right 1085603253 11:77874575-77874597 CTGGTGCACATGGTTAACGATGG 0: 1
1: 0
2: 0
3: 4
4: 47
1085603249_1085603255 12 Left 1085603249 11:77874561-77874583 CCCTACTTTGGAACCTGGTGCAC 0: 1
1: 0
2: 2
3: 12
4: 96
Right 1085603255 11:77874596-77874618 GGAAATATGTAGAGCTTGAAGGG 0: 1
1: 1
2: 0
3: 17
4: 186

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085603249 Original CRISPR GTGCACCAGGTTCCAAAGTA GGG (reversed) Intronic
901093352 1:6658606-6658628 GTGTACAAGGTTCAAAAGTCAGG - Intronic
906143358 1:43546338-43546360 GAGCACCAGGTACCAAAGAGAGG + Intronic
907585460 1:55612999-55613021 GTGTACAATGTTCAAAAGTAAGG + Intergenic
909640304 1:77864877-77864899 GTGCACCTGGAAGCAAAGTAGGG + Intronic
913262635 1:117013609-117013631 GAGCTCCAGGTTTCAAAGTTAGG + Exonic
920390200 1:205595298-205595320 GTTCACCACGTGCCAAAGTAGGG - Intronic
1063940358 10:11122275-11122297 GTGCATGAGGTTGCAAAGCAAGG - Intronic
1063965330 10:11342058-11342080 GGGCCCCAGGTTCCAAATTAGGG + Intergenic
1068974137 10:62989961-62989983 GAGCACCTGGTCCCTAAGTAAGG + Intergenic
1070276706 10:75014005-75014027 GTGCACATGGTCTCAAAGTATGG + Intronic
1071743653 10:88390581-88390603 GTGCACCAAGTTTCAAAGAAAGG - Intronic
1071893122 10:90034201-90034223 TTGCAGAAGGTGCCAAAGTAAGG - Intergenic
1073922143 10:108471144-108471166 GGGCACCAAGTTCCAAGGCAAGG + Intergenic
1074528207 10:114279181-114279203 GAGCACCAGTTTCCACATTATGG + Intronic
1076045302 10:127288497-127288519 CTGCACCAGGATGTAAAGTAAGG + Intronic
1076139987 10:128070993-128071015 GTGCACCAGGGTCAAAAGCAGGG + Intronic
1076342771 10:129760878-129760900 GTGCAACAGGTGCAAAAGGAAGG - Intronic
1084976382 11:72801503-72801525 GGGTATCAGGTTCCAATGTATGG - Intergenic
1085603249 11:77874561-77874583 GTGCACCAGGTTCCAAAGTAGGG - Intronic
1093384582 12:18536492-18536514 GTGAACCAGGTTTCAAATCATGG - Intronic
1098748479 12:74267989-74268011 GTCCTCCAGGTGCCAAAGCAGGG - Intergenic
1101029404 12:100644937-100644959 GTCCACCAGGTCCCGAAGCAGGG + Intergenic
1114066904 14:19068092-19068114 GTCCTCCAGGTTCAACAGTATGG + Intergenic
1114095362 14:19331935-19331957 GTCCTCCAGGTTCAACAGTATGG - Intergenic
1115853970 14:37610196-37610218 GTGCATCAGTCTCCAAAGCAAGG + Intronic
1118393225 14:65314122-65314144 GTGCAGCAGGCTCCACATTAGGG + Intergenic
1121092001 14:91189387-91189409 GTCCACCAGGCTCCAAAGCATGG + Intronic
1122080078 14:99261040-99261062 GTTCACCCGATTCCAAAGAACGG + Intronic
1202919937 14_KI270723v1_random:21674-21696 ATGCACCAGGTTCCAGGGCAAGG - Intergenic
1123458482 15:20446614-20446636 GTGTACCAAGTTCCAGACTAAGG - Intergenic
1123659581 15:22553795-22553817 GTGTACCAAGTTCCAGACTAAGG + Intergenic
1124313442 15:28648290-28648312 GTGTACCAAGTTCCAGACTAAGG + Intergenic
1138680488 16:58680368-58680390 GTGCACTGGGTGCCAGAGTATGG + Intronic
1146239472 17:31204644-31204666 GTGCACCTGGTACCACAATACGG + Intronic
1146741872 17:35292623-35292645 GTGGACCTGGGTCCAGAGTATGG + Intergenic
1149578677 17:57732004-57732026 GTAGAACAGGTTCCAAAGTCTGG - Intergenic
1149660640 17:58332502-58332524 GTGCTCCAGGCTCCGAAGTGGGG + Intergenic
1149991871 17:61387948-61387970 GTTCTCCAGGCCCCAAAGTAGGG - Intronic
1150855427 17:68747662-68747684 TTCCACCATGTTCCAAATTATGG - Intergenic
1152215487 17:79029364-79029386 TTGCCCCAGGTTCCACAGTGGGG - Intronic
1152444326 17:80332353-80332375 TTGCACCAGGATCTAAAGTCAGG + Exonic
1156374755 18:36503562-36503584 GTGCACCAGGTTCAAAACCATGG - Intronic
1158521722 18:58176687-58176709 GTGAACAAGGTTCCACAGTAGGG - Intronic
1160329878 18:77981395-77981417 TAGCACAAGGTTCCAGAGTAGGG + Intergenic
1163622975 19:18371786-18371808 GGGCACCAGGCTCCAAGTTAAGG - Intergenic
1165261414 19:34622338-34622360 GAGCCCCAGGTTCCCAAGTCAGG + Intronic
924969707 2:114523-114545 GTAAACCAGGATCCAAACTAGGG + Intergenic
925349604 2:3191617-3191639 TTGCCCCAGGTTCCAGAGGAAGG - Intronic
927014955 2:18950029-18950051 GTTCCTCAGGTTCCAACGTATGG - Intergenic
928985626 2:37178636-37178658 ATGCTCCAGGTGCTAAAGTAGGG - Intronic
929130319 2:38561669-38561691 GTGCTTCAGATTCCTAAGTATGG + Intergenic
931095326 2:58933651-58933673 GTGCAGCAGTTTCCAAAGTGAGG + Intergenic
931114735 2:59152334-59152356 GTGCACCTGGTGACAAAGCAAGG - Intergenic
932353277 2:71048644-71048666 GTCCTCCAGGTGCCAGAGTAGGG - Intergenic
936998015 2:118435645-118435667 GTGCACCAGGGCCCTGAGTAGGG - Intergenic
938484303 2:131688181-131688203 GTCCTCCAGGTTCAACAGTATGG + Intergenic
945276745 2:207995459-207995481 GACCACTAGCTTCCAAAGTAAGG + Intronic
947579762 2:231307721-231307743 GTCAACCAGGTTCCAGAGCAGGG + Intronic
948898209 2:240938209-240938231 GTGCAGCAGGATCCCAAGGAGGG - Intronic
1169123634 20:3111901-3111923 GGGCACCAGGCACCAAAGAAGGG + Intronic
1171408394 20:24929161-24929183 GTCCTCCAGGTGCCAGAGTAGGG - Intergenic
1174133709 20:48364009-48364031 GTCCACCAGGTTCCATAACAAGG - Intergenic
1175834620 20:61985654-61985676 GAGAACCAGGTTCCCATGTAAGG + Intronic
1180485383 22:15790676-15790698 GTCCTCCAGGTTCAACAGTATGG + Intergenic
952011275 3:28903365-28903387 GTGCACCGGGTCCCACAGCAGGG - Intergenic
954396341 3:50295337-50295359 GTGCCCCTGGGTCCAAAGTAGGG + Exonic
956713704 3:72060241-72060263 ATGCACCAGGTTCTAAAATCCGG - Intergenic
958678294 3:97293902-97293924 GTTCATCAGTTCCCAAAGTATGG + Intronic
966322569 3:178717225-178717247 GGCCACCTGTTTCCAAAGTATGG + Intronic
969024509 4:4162683-4162705 GTCCTCCAGGTGCCAATGTAGGG + Intergenic
972532842 4:39976898-39976920 GAGCACCAGGGTCCGAAGTTTGG + Intronic
976704421 4:88006836-88006858 GTGAAGCAGGTTCCAGAGAAGGG + Intergenic
978886551 4:113772482-113772504 GTGCACCGGGTCCCACAGCACGG + Intergenic
980014519 4:127633314-127633336 TTGCACCACGTTCCATTGTATGG + Intronic
981016250 4:139977503-139977525 GGGCAGAATGTTCCAAAGTAGGG - Intronic
985033438 4:185814856-185814878 GTGCACCAAGTTACAAGGGAGGG - Intronic
985097698 4:186429212-186429234 GTGCACCAGAATCGAAGGTAAGG + Intronic
985926953 5:3026373-3026395 GGGCACCAGGCTCAAAAGCAAGG - Intergenic
990939790 5:61190034-61190056 ATGCACCAGGTGCCATACTAAGG + Intergenic
1000923564 5:167166959-167166981 TGGCACCAGGTTCCAAAGCATGG - Intergenic
1001099330 5:168801208-168801230 GAGCACCAGGTTTCCATGTAAGG - Intronic
1002865438 6:1118003-1118025 ATGCACCAGGTTCCAAAGTGGGG - Intergenic
1002950491 6:1805441-1805463 GGGCAGCAGTTCCCAAAGTATGG + Intronic
1004378381 6:15111148-15111170 ATGCAATAGTTTCCAAAGTAGGG + Intergenic
1006420820 6:33932795-33932817 CTGATCCAGGTTCAAAAGTAGGG + Intergenic
1013507617 6:110815409-110815431 GCCCACCAGGTTCCAAAACAAGG - Intronic
1014541625 6:122682998-122683020 CTGAAACAGGTTACAAAGTAAGG - Intronic
1014546907 6:122745554-122745576 GTCCTCCAGGTGCCAAAGCAGGG + Intergenic
1014984592 6:127987347-127987369 ATGCACCATGTTCCAGAATATGG - Intronic
1023393877 7:39734456-39734478 GTGCCCCAGGTCCCACAGTGAGG + Intergenic
1024642629 7:51342747-51342769 GTGTTCCAGGATCCAAACTAGGG + Intergenic
1026231471 7:68487866-68487888 GTGCACAAGGATACAAAGAAGGG + Intergenic
1027714511 7:81653201-81653223 GTCCACCAGCTTCCACAGGAAGG + Intergenic
1030064325 7:105647771-105647793 GTGCACCAGGTCCCAACATTTGG + Intronic
1032532328 7:132632500-132632522 ATGCACCTGGTTCCAGAGTTAGG + Intronic
1033034722 7:137863540-137863562 GTCCACCAAGTTCCAAGGTTTGG + Intergenic
1036490400 8:9219996-9220018 GTGCACAAGTTTGCAAAGTCGGG + Intergenic
1037342752 8:17863950-17863972 CTGCTCCAAGTTACAAAGTAGGG - Intergenic
1040303615 8:46200835-46200857 GGGCACCAAGCTCCAAAGCATGG - Intergenic
1041208843 8:55525900-55525922 GGGCACCAACTTGCAAAGTAGGG - Exonic
1042323143 8:67499365-67499387 AAGCACCTGGTTCCAAAGAATGG + Intronic
1042482307 8:69317973-69317995 GTGAACCTGGTGCTAAAGTAAGG + Intergenic
1047826074 8:128577071-128577093 GTGAACCAGGTTCTAAAAGAGGG + Intergenic
1055988043 9:82073358-82073380 GTGAACCAGGTTCCATAGACTGG + Intergenic
1058664302 9:107296187-107296209 GTGCACCTGGTTCCAAAGTCTGG + Intronic
1187009490 X:15265515-15265537 GTGCAGTAGTTTTCAAAGTATGG + Intronic
1187918990 X:24182821-24182843 GTGGAGCAGGTTCCAGAGAAGGG + Intronic
1189254283 X:39625550-39625572 GTCCACCAGGTGCAAATGTAGGG + Intergenic
1190425999 X:50335022-50335044 GTCCTCCAGGTGCCAAAGCAGGG + Intronic
1191036178 X:56028509-56028531 GTCCTCCAGGTGCCAAAGTAGGG + Intergenic
1191214776 X:57922946-57922968 GTCCTCCAGGTGCCAAAGTAGGG - Intergenic