ID: 1085604212

View in Genome Browser
Species Human (GRCh38)
Location 11:77882690-77882712
Sequence CCACCACTAGAACCCCAAAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 143
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 131}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085604203_1085604212 24 Left 1085604203 11:77882643-77882665 CCTGGGTAGCAGAACTGCTGGAT 0: 1
1: 0
2: 0
3: 7
4: 179
Right 1085604212 11:77882690-77882712 CCACCACTAGAACCCCAAAGGGG 0: 1
1: 0
2: 0
3: 11
4: 131
1085604205_1085604212 -2 Left 1085604205 11:77882669-77882691 CCCTCAACTACACCAGGCCTACC 0: 1
1: 0
2: 0
3: 5
4: 121
Right 1085604212 11:77882690-77882712 CCACCACTAGAACCCCAAAGGGG 0: 1
1: 0
2: 0
3: 11
4: 131
1085604206_1085604212 -3 Left 1085604206 11:77882670-77882692 CCTCAACTACACCAGGCCTACCA 0: 1
1: 0
2: 0
3: 5
4: 109
Right 1085604212 11:77882690-77882712 CCACCACTAGAACCCCAAAGGGG 0: 1
1: 0
2: 0
3: 11
4: 131

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085604212 Original CRISPR CCACCACTAGAACCCCAAAG GGG Intronic
902147038 1:14410809-14410831 CGGCCACCAGAACCCGAAAGAGG + Intergenic
902773768 1:18661282-18661304 CCACCTCATGGACCCCAAAGCGG - Intronic
906098706 1:43241902-43241924 CCAGCACAAGTACCCCAAGGAGG - Intronic
906857192 1:49320660-49320682 TCACCACTATCACCCCAAACAGG + Intronic
909927339 1:81453467-81453489 CCACCACTAGAACTCTTAAGTGG - Intronic
916017236 1:160761031-160761053 CCAACACTAGGACCCCAATATGG - Intergenic
1063273674 10:4539996-4540018 CCACCACTTGAAACTCACAGAGG - Intergenic
1065628820 10:27657322-27657344 CCACCAGTATGACCCCACAGAGG - Intergenic
1067785484 10:49242599-49242621 CCACCCCTGGGCCCCCAAAGAGG - Intergenic
1070346004 10:75542693-75542715 CCATCACTACACCCCCAATGGGG + Intronic
1071431969 10:85613406-85613428 CCACCAGGAGACCCCCAAGGAGG - Exonic
1073800191 10:107033242-107033264 CCATCACGAGAACAGCAAAGGGG + Intronic
1073888407 10:108068353-108068375 CCATCACTTTAAGCCCAAAGTGG - Intergenic
1074962916 10:118464007-118464029 CCACCCCCAGAACCCCAAATGGG - Intergenic
1078143339 11:8707232-8707254 CCACCGCCAGCAGCCCAAAGAGG + Intronic
1078765414 11:14292215-14292237 TGCCCACTAGAACCCCAAAGAGG - Intronic
1081509722 11:43757934-43757956 CCACCATTATACCCCCAAATGGG - Intronic
1083413435 11:62509606-62509628 TCAACAATTGAACCCCAAAGAGG + Intronic
1085604212 11:77882690-77882712 CCACCACTAGAACCCCAAAGGGG + Intronic
1087188954 11:95232009-95232031 CCAGCACTAAAAGGCCAAAGGGG + Intronic
1088648585 11:111937669-111937691 TCGCCCCCAGAACCCCAAAGGGG + Intronic
1089338116 11:117739607-117739629 TACCCACTAGAACCCCACAGTGG + Intronic
1090262988 11:125335065-125335087 CCTCCCCTTGAGCCCCAAAGCGG + Intronic
1093213720 12:16337936-16337958 CCTCCACTAGAAACCCTTAGTGG - Intergenic
1095098573 12:38160486-38160508 CCACGACGGGCACCCCAAAGCGG + Intergenic
1099639519 12:85268436-85268458 CCACCACCAGGATCCCAAAGTGG + Intergenic
1100703617 12:97176895-97176917 CAACCACTAGAAGTTCAAAGAGG - Intergenic
1104870218 12:131989488-131989510 CCACCAACAGAACCTCAAATGGG - Intronic
1116592073 14:46790084-46790106 CCACTATTCAAACCCCAAAGTGG - Intergenic
1120076248 14:80161934-80161956 TCTTCACTAGAACCCCAAAATGG - Intergenic
1122322458 14:100863487-100863509 CCAGCCCTAGAACATCAAAGAGG - Intergenic
1124685658 15:31779743-31779765 CCACCCCTAGGGCTCCAAAGTGG - Intronic
1127787014 15:62364702-62364724 CCACAACTAAAAACCCAATGAGG + Intergenic
1131897427 15:97048828-97048850 CCACCACGACAGGCCCAAAGTGG + Intergenic
1131912731 15:97225109-97225131 CCACAACCACAACCCCAAACTGG - Intergenic
1132033567 15:98459438-98459460 CCACCACAAGAACCGCTAAAAGG + Intronic
1133987057 16:10676593-10676615 CCACCACCAGAAACACAACGTGG + Intronic
1136140228 16:28283645-28283667 CCACCATTGGAACCCCTAATGGG + Intergenic
1138522429 16:57578551-57578573 CCACCACCAGAAATCCCAAGGGG + Intronic
1139001632 16:62518090-62518112 CAGCCACCAGAACCCGAAAGAGG + Intergenic
1139301910 16:65952525-65952547 CCACCAATAGAATCTCAAAAGGG - Intergenic
1141517980 16:84559204-84559226 CCACCACTCCAGGCCCAAAGGGG + Intergenic
1142053042 16:87972909-87972931 CCACCAGGAGAACCACACAGGGG - Intronic
1144013937 17:11175833-11175855 CTTCCGCTAGAACCCCAAAGTGG + Intergenic
1149599608 17:57885122-57885144 CCACCACTGGAACCTCTAAGAGG - Intronic
1149656875 17:58314581-58314603 CCTCCCCTAGAGCCCCCAAGGGG + Intronic
1152583532 17:81179335-81179357 GCACCACTACAAGCCCCAAGGGG + Intergenic
1154219285 18:12437886-12437908 CCACCACTAGAACCCAAGTCGGG - Intergenic
1156549851 18:38004093-38004115 CCACCACTCAAACCCCTGAGGGG - Intergenic
1164616765 19:29671777-29671799 CCACCAGTAGAAAGCCAGAGTGG - Intronic
1167616264 19:50535868-50535890 CCACCACCAGGAGCCCAGAGAGG + Intronic
934658973 2:96133080-96133102 CCACCACTCGCACCCCAGAGGGG + Intronic
935047130 2:99492341-99492363 CCATCTCTAGACCCCCAGAGTGG - Intergenic
935742914 2:106166661-106166683 CCAACTCTAGACCCCAAAAGAGG - Intronic
937167913 2:119837743-119837765 GGAACACAAGAACCCCAAAGAGG - Intronic
938321766 2:130370943-130370965 CCACTACCAGAACATCAAAGAGG + Exonic
938934628 2:136117407-136117429 CCACCACTCGATCCCCTCAGAGG + Intronic
938982544 2:136540209-136540231 CCATCACAAGAACAGCAAAGGGG - Intergenic
939607865 2:144274559-144274581 CCTCCATAAAAACCCCAAAGGGG + Intronic
940770303 2:157832436-157832458 GCATCACTGGAATCCCAAAGAGG - Intronic
944047637 2:195431252-195431274 CCATCACAAGAACACCAAGGGGG - Intergenic
947487466 2:230565412-230565434 GCACCACTAAAACCTCCAAGGGG - Intergenic
947690677 2:232133151-232133173 CCACAACAAGAAACCCAAAATGG + Intronic
948868441 2:240786669-240786691 CCACCACCAGGACCCCTGAGGGG + Intronic
1168773909 20:432995-433017 CCACCAGCAGAACACCAGAGGGG + Intergenic
1170189008 20:13626086-13626108 CCACCCCTAAAGCCCCATAGGGG + Intronic
1174594643 20:51674250-51674272 CCACCACCAGGGCACCAAAGAGG + Exonic
1175477541 20:59287661-59287683 GAACCACTAGAACCTGAAAGAGG + Intergenic
1176868948 21:14071992-14072014 CCACGACGGGCACCCCAAAGCGG - Intergenic
1179006416 21:37519280-37519302 CCCTCTCTAGAATCCCAAAGAGG + Intergenic
1179954446 21:44730452-44730474 TCACCCCTCCAACCCCAAAGTGG + Intergenic
1183507341 22:38216571-38216593 CCGCCACCAGAAGCCCTAAGGGG - Intergenic
1183583672 22:38739940-38739962 CCACCTATAGGAACCCAAAGGGG + Exonic
1184477460 22:44729374-44729396 CCACAGCGAGAACCCCAGAGTGG + Intronic
1184632086 22:45789664-45789686 CCACCACCACCACCACAAAGGGG - Intronic
950787030 3:15445443-15445465 ATACCCCTAGATCCCCAAAGAGG + Intronic
951638813 3:24811029-24811051 CCACTACAAGTTCCCCAAAGAGG - Intergenic
953854659 3:46491970-46491992 CCACCCCTGGAACCCCAGACTGG + Intergenic
954556218 3:51519658-51519680 CCACCACCATCTCCCCAAAGGGG + Intergenic
954951726 3:54480696-54480718 CCACCAAAAGAACCCCCAAATGG - Intronic
955213423 3:56963055-56963077 CCACTATTAGAACCCCAAGCTGG - Intronic
957030587 3:75236141-75236163 GCTCCACTAGAACCCCAGTGGGG - Intergenic
958837339 3:99160424-99160446 CCACAATGAGAACACCAAAGGGG + Intergenic
964748148 3:160030903-160030925 GAATCACTTGAACCCCAAAGGGG - Intronic
966343362 3:178950390-178950412 CCACCACTAGAGCTAGAAAGAGG - Intergenic
966548411 3:181178080-181178102 CTACTAATAGAACCCAAAAGTGG + Intergenic
967180728 3:186901401-186901423 CCACCACCAGAAACTCAGAGAGG - Intergenic
968853380 4:3100266-3100288 CCACTACTGGATCCTCAAAGTGG + Intronic
970354529 4:15238903-15238925 CCACCTCTACCACTCCAAAGGGG + Intergenic
974390765 4:61264350-61264372 CCACAATTGGAACCCCAAATCGG + Intronic
975280426 4:72555789-72555811 CTATCACGAGAACACCAAAGGGG - Intronic
978062228 4:104352155-104352177 CTGCCCCTAGACCCCCAAAGAGG + Intergenic
984064637 4:175033027-175033049 CCACCACTGGCAACCCAAATGGG + Intergenic
985340176 4:188942782-188942804 CCATCACCAGAACAGCAAAGGGG - Intergenic
985545947 5:509199-509221 CCACCATTAGCCTCCCAAAGTGG - Intronic
985867085 5:2522491-2522513 CCACCACCAGAACAGCAAGGGGG - Intergenic
986586036 5:9319598-9319620 GCACCAGCAGCACCCCAAAGAGG + Intronic
986758729 5:10860670-10860692 CCTGCACTAGAGCCCCAAAGGGG + Intergenic
987341911 5:16946826-16946848 CCATCACAAGAACAGCAAAGGGG - Intergenic
991574606 5:68089953-68089975 CCACCACCAGAAGCCAAAAGAGG - Intergenic
993180075 5:84541350-84541372 CTACCACGAGAACAGCAAAGGGG - Intergenic
994340587 5:98622656-98622678 CCACAACCACAACCCCACAGGGG + Intergenic
1002047203 5:176548894-176548916 CCTCCACGAGAACCTCACAGGGG + Intronic
1002788134 6:419345-419367 CCCCCACTAGCACCCCAATATGG + Intergenic
1005813578 6:29533218-29533240 CCACCACCAGACCACCAATGGGG + Intergenic
1006099946 6:31680390-31680412 CCACCAATATAAGCCCAAACTGG - Intronic
1006686094 6:35835429-35835451 TCTCCACTAGAACCTCAAAAAGG + Exonic
1007381166 6:41491238-41491260 CCAGCCCTGGAATCCCAAAGGGG + Intergenic
1007748043 6:44055222-44055244 CCAGCCCCAGAACCCCACAGAGG + Intergenic
1008487088 6:52048083-52048105 CCACCACCAGAAGCCAGAAGAGG + Intronic
1009462716 6:63933505-63933527 CCACCATAAAAACCCAAAAGAGG - Intronic
1010165519 6:72910879-72910901 CCACCACAAGAACCCATAAATGG + Intronic
1011780536 6:90784703-90784725 CTATCACTAGAACAGCAAAGGGG + Intergenic
1011934459 6:92757730-92757752 CCACCACCAAAACAACAAAGGGG + Intergenic
1015680451 6:135801922-135801944 CCACCATGAGAATCCCTAAGTGG + Intergenic
1017613101 6:156213114-156213136 CCAATTCTAGAACCTCAAAGTGG + Intergenic
1026517885 7:71088323-71088345 CTACCACAAGAACACCAAGGGGG - Intergenic
1034120732 7:148625177-148625199 CCACCACTACAATCCCCAAAAGG + Intergenic
1034491273 7:151394332-151394354 CTACCCCTACAACCCCAAATGGG + Intronic
1036208531 8:6823524-6823546 CAACCACAAAAACCCAAAAGTGG + Exonic
1037042690 8:14257079-14257101 CTAGCACTAGAAGGCCAAAGTGG + Intronic
1037591216 8:20313539-20313561 CCTCCAGGAGAACCTCAAAGAGG - Intergenic
1038853110 8:31299569-31299591 GCATCACTAAAACCCCAAATGGG + Intergenic
1041309950 8:56506434-56506456 ACACCCCTTGAACCACAAAGAGG - Intergenic
1045763413 8:105637900-105637922 CCACCACTTGAAAACAAAAGAGG - Intronic
1051028293 9:12641427-12641449 CCACCACTAGGACCAAAGAGAGG + Intergenic
1052017647 9:23487845-23487867 GCACCACTATAACCTCAGAGTGG - Intergenic
1052262941 9:26539104-26539126 CTACAACTAGAACACCCAAGTGG + Intergenic
1052585754 9:30425493-30425515 CCACCACTACAAGTCCACAGAGG - Intergenic
1057935626 9:99236328-99236350 CTACCACAAGAACACCAAAGGGG - Intergenic
1058335824 9:103827870-103827892 CCACCTCTAGAACTCTAAGGAGG + Intergenic
1190663764 X:52679020-52679042 CCAGCCCTAGAACCCGAAAATGG - Intronic
1190675659 X:52779402-52779424 CCAGCCCTAGAACCCGAAAATGG + Intronic
1190901042 X:54673270-54673292 CCACCACTAGAAACCCCAGGAGG - Intergenic
1190991169 X:55552066-55552088 CCTCAACTAGACCACCAAAGGGG - Intergenic
1191255619 X:58278351-58278373 CCACCAAAGGCACCCCAAAGTGG - Intergenic
1191256358 X:58281299-58281321 CCACCGACAGCACCCCAAAGCGG - Intergenic
1191256597 X:58282198-58282220 CCACCAAAGGCACCCCAAAGTGG - Intergenic
1194473798 X:94334356-94334378 ACACCATTAGAACCACAGAGTGG - Intergenic
1195588206 X:106591333-106591355 CAACCACTAGAAGCCAGAAGAGG - Intergenic
1196916230 X:120537627-120537649 TCACTACTAAAACCCAAAAGAGG + Intronic
1198506174 X:137303348-137303370 CCTCCAGAAGATCCCCAAAGGGG - Intergenic
1198664429 X:139004788-139004810 CCACCACTACAGGCCCACAGAGG - Intronic