ID: 1085608305

View in Genome Browser
Species Human (GRCh38)
Location 11:77922842-77922864
Sequence TTTTCCAGTGACTGGTTTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 235
Summary {0: 3, 1: 0, 2: 3, 3: 32, 4: 197}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085608295_1085608305 29 Left 1085608295 11:77922790-77922812 CCAAGAGCTGAACCACTATTGGT 0: 3
1: 0
2: 0
3: 9
4: 92
Right 1085608305 11:77922842-77922864 TTTTCCAGTGACTGGTTTGCTGG 0: 3
1: 0
2: 3
3: 32
4: 197
1085608298_1085608305 1 Left 1085608298 11:77922818-77922840 CCCATCATGGCAATCCCATTCCC 0: 2
1: 4
2: 6
3: 37
4: 209
Right 1085608305 11:77922842-77922864 TTTTCCAGTGACTGGTTTGCTGG 0: 3
1: 0
2: 3
3: 32
4: 197
1085608293_1085608305 30 Left 1085608293 11:77922789-77922811 CCCAAGAGCTGAACCACTATTGG 0: 3
1: 0
2: 0
3: 7
4: 95
Right 1085608305 11:77922842-77922864 TTTTCCAGTGACTGGTTTGCTGG 0: 3
1: 0
2: 3
3: 32
4: 197
1085608299_1085608305 0 Left 1085608299 11:77922819-77922841 CCATCATGGCAATCCCATTCCCA 0: 2
1: 1
2: 2
3: 20
4: 211
Right 1085608305 11:77922842-77922864 TTTTCCAGTGACTGGTTTGCTGG 0: 3
1: 0
2: 3
3: 32
4: 197
1085608296_1085608305 17 Left 1085608296 11:77922802-77922824 CCACTATTGGTCTAAACCCATCA 0: 3
1: 0
2: 0
3: 9
4: 70
Right 1085608305 11:77922842-77922864 TTTTCCAGTGACTGGTTTGCTGG 0: 3
1: 0
2: 3
3: 32
4: 197

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085608305 Original CRISPR TTTTCCAGTGACTGGTTTGC TGG Intronic
900569088 1:3349581-3349603 TTTCCCACTGGCTGGTGTGCTGG + Intronic
901177951 1:7318320-7318342 TTGGTCAGTGACTGGTTGGCTGG + Intronic
905240352 1:36577010-36577032 TTTTCCAGGGCCTGGCCTGCTGG + Intergenic
905688945 1:39928646-39928668 TTTTCCACAGACTGGGGTGCGGG - Intergenic
905938102 1:41840740-41840762 TCGTCCAGTGACTGGCTGGCTGG - Intronic
907711540 1:56887213-56887235 TTTTCCAGTAATGGGATTGCTGG + Intronic
908742356 1:67341966-67341988 TTTTCCAGTGAGGGGATTTCAGG + Intronic
908797584 1:67846379-67846401 TTTTCCTGTGAGTGGTATGAAGG + Intergenic
909280508 1:73745900-73745922 TTTTCCAGTCACTGTTTTGTTGG - Intergenic
911124605 1:94329519-94329541 TTTTGGAATGAATGGTTTGCTGG + Intergenic
912157666 1:106942029-106942051 TCTTCCAGTGACTGGTGAACAGG - Intergenic
912909767 1:113745941-113745963 TTTTCCATGGACTGGTGTGGGGG - Intronic
913488436 1:119355650-119355672 TCCTCCAGTGACTGCCTTGCTGG + Intergenic
916866516 1:168865473-168865495 TTTTCCAATAACTGGTTAGAGGG - Intergenic
918436003 1:184513651-184513673 TTTTCCAAGAGCTGGTTTGCTGG + Intronic
919637026 1:200013028-200013050 CTTCCCAGTGACTGGTTTATGGG + Intergenic
919653408 1:200173617-200173639 TTCTCCAGGGACTCATTTGCTGG + Intronic
923693972 1:236228177-236228199 TTTTCCAGGTCCTGGTTTGTAGG - Intronic
924641598 1:245838333-245838355 GTTTCCAGTGGCTGGTGTCCTGG + Intronic
1064271848 10:13872393-13872415 TTTCCCAGTAACTGGTTCCCAGG + Intronic
1066177462 10:32923726-32923748 TTTTCAAGTCACTGATTGGCTGG - Exonic
1069640178 10:69949830-69949852 TTTTCAGCTGGCTGGTTTGCAGG - Intronic
1071216107 10:83403726-83403748 TCTTCTAGTGACAGCTTTGCAGG + Intergenic
1074437172 10:113444048-113444070 TTTCCAAGGGCCTGGTTTGCTGG + Intergenic
1074450745 10:113557628-113557650 TTTTCCTGGAACTTGTTTGCGGG - Intronic
1074802481 10:117015086-117015108 TTTTTCCCTGACTGATTTGCAGG + Intronic
1077315999 11:1919625-1919647 TTGGCCAGTGACTGGGTGGCCGG - Exonic
1078055951 11:8009039-8009061 TTTTCCATTGACTCTATTGCTGG - Intergenic
1078380542 11:10836110-10836132 TTTTCCAGGGACTGGTTTCATGG - Intronic
1078980546 11:16527811-16527833 TTTTTCAGTGATGGGTTTGCAGG - Intronic
1081070943 11:38607418-38607440 TTTTCCATGGACAGGTTTGGTGG + Intergenic
1081311963 11:41585365-41585387 TTTCCCAGTGATTGGATGGCTGG + Intergenic
1081613663 11:44578242-44578264 TAGTGCAGTGCCTGGTTTGCTGG + Intronic
1082095577 11:48126861-48126883 TTTTCAAGTGACTAGTTAGGTGG + Intronic
1082936153 11:58658898-58658920 TTGTCCAGTGGCTGGATTTCAGG - Intronic
1083734120 11:64669989-64670011 TCTTCCAGCGACTGGTCTCCAGG + Intronic
1084344115 11:68532514-68532536 TGCTCCACTGACTGGTTTGTTGG + Intronic
1085211386 11:74782538-74782560 TTTTCCACTGACTGGTGTAGGGG - Intronic
1085608305 11:77922842-77922864 TTTTCCAGTGACTGGTTTGCTGG + Intronic
1086486071 11:87303351-87303373 TTTTCCACTGACTGGGTGGCTGG - Intronic
1086536987 11:87858799-87858821 GTTTGCAGTGACGGATTTGCAGG + Intergenic
1086872830 11:92059977-92059999 TTGTTCAGTATCTGGTTTGCTGG + Intergenic
1088467413 11:110156043-110156065 TGTTCCAGGGACTGGCATGCTGG - Intronic
1089706781 11:120283825-120283847 TATTCCACTGACTGGTGGGCAGG - Intronic
1090372556 11:126266879-126266901 TTCTGCAGGGACTGGTTTGCTGG + Exonic
1091574444 12:1720324-1720346 TTTTCCATGGACTGGTGGGCAGG + Intronic
1093179794 12:15954022-15954044 TTCTCCAGTAGATGGTTTGCAGG + Intronic
1093628960 12:21385902-21385924 TTTTCCAGTGGCTTTTCTGCAGG - Intronic
1093879151 12:24383746-24383768 TTTTCCAAGGACTGGTTGGGGGG + Intergenic
1094073026 12:26440083-26440105 TTTGCCACTGACTGGTGTGGTGG + Intronic
1095666716 12:44810676-44810698 TCATCCAGTCAGTGGTTTGCTGG - Intronic
1096223340 12:49846864-49846886 TATTCCTGTGTCTGGGTTGCAGG + Intergenic
1097345368 12:58485781-58485803 TTTCCCAGAGATTGGCTTGCTGG - Intergenic
1098144051 12:67480648-67480670 TTTTCCTGTTCCTGGTTTTCTGG + Intergenic
1099541841 12:83920102-83920124 TTTTCTCATGACTGGTTTGAAGG - Intergenic
1099977478 12:89561126-89561148 TTCTCCAATGAAAGGTTTGCTGG - Intergenic
1100268642 12:93002437-93002459 CTTGCCAGTGACTGGTTTGGAGG - Intergenic
1100917563 12:99443056-99443078 TTTTCCAGTAGGCGGTTTGCAGG - Intronic
1102748710 12:115273153-115273175 TTTTCCAGGGACTGATTGGGAGG - Intergenic
1104568563 12:129905346-129905368 TTTTCCAGTGACTCTCCTGCTGG - Intergenic
1105762043 13:23524286-23524308 TTTGCCAGTGATTGGTTTAAGGG + Intergenic
1106684399 13:32042774-32042796 TTTGCCAGTGACTGGTCTAAGGG - Intronic
1108704851 13:52975655-52975677 TTTTCAAGTGAATGGTTGGATGG - Intergenic
1109520509 13:63504512-63504534 TTTTCCAGTGAGTGATTATCTGG - Intergenic
1117282299 14:54253166-54253188 TTTTCCAGTTAATGGTTCCCTGG - Intergenic
1117425820 14:55595852-55595874 TTTAATAGTGACTGGTTTGGCGG + Intronic
1118187976 14:63554779-63554801 TTTTCCACTGACTGGGGTGTGGG + Intergenic
1119648458 14:76366137-76366159 TTTGACAGTGATTGGTTTGGGGG + Intronic
1119948771 14:78722920-78722942 TTTTCCCCTGCCTGGTCTGCCGG - Intronic
1121858069 14:97288745-97288767 TTGTCCAGTGCCTGGCATGCAGG + Intergenic
1124234155 15:27972359-27972381 ATACCCAGTGACTGGATTGCTGG + Intronic
1124440253 15:29680491-29680513 TTTTCCATGGACTGGGTTGCAGG + Intergenic
1125062187 15:35437741-35437763 TTTGCCACTGACTGGTTTGCTGG - Intronic
1135855148 16:26002960-26002982 TTCTCCTGTGACTTGTTTTCAGG - Intronic
1137630739 16:49942291-49942313 TTATCAAGTGTGTGGTTTGCAGG - Intergenic
1141078311 16:81029018-81029040 GGTTCCAGTGGCTGGTTTCCAGG + Intronic
1141118134 16:81329234-81329256 TTTTCCAGTGCCTGGCGTGTAGG + Intronic
1141929481 16:87192398-87192420 TTTTCCCTTGATGGGTTTGCAGG - Intronic
1142558932 17:798585-798607 TTATACAGTGACTGCTTTGCGGG - Intergenic
1144720513 17:17466395-17466417 TTGGCCAGTGACTGGTCTACAGG - Intergenic
1145106335 17:20121000-20121022 ATTTCCAGTTTCTGGTTTCCAGG + Intronic
1148575737 17:48709710-48709732 TTTTCCAGTGGCTGGGCTGAGGG - Intergenic
1148979764 17:51562364-51562386 TTTTCCATGGACCGGTTTGGAGG + Intergenic
1151427514 17:74040651-74040673 TTTTCCAGAGCCTGGTGTTCAGG + Intergenic
1152013205 17:77733525-77733547 GTTTCCAGGGTCTGCTTTGCTGG - Intergenic
1152494779 17:80663223-80663245 GTTTCCAGTGACTGGCTTTTAGG + Intronic
1153148934 18:2067865-2067887 TTTTCAGCTGACTGGGTTGCAGG - Intergenic
1154034542 18:10787184-10787206 TTTTTCAATGTCTGATTTGCAGG - Exonic
1155028486 18:21963674-21963696 TTTCCCAGTGTCTTGTTTGTAGG - Intergenic
1155263434 18:24067672-24067694 TTTTCCATGGACTGGGTTGAGGG - Intronic
1155680147 18:28477637-28477659 TTTTCCAGTGTCTCCATTGCTGG + Intergenic
1156726223 18:40130833-40130855 TTTTCCAGTCATTACTTTGCTGG - Intergenic
1159396229 18:67860267-67860289 TTTTCCAGTCACTGGCTTGTGGG - Intergenic
1159945926 18:74444919-74444941 TTATCCAGTTACTGGTTTGTGGG - Intronic
1160972068 19:1773949-1773971 TTTGCAAGTGTCTGGTCTGCAGG + Intronic
1164393415 19:27844584-27844606 ACTTCCATTGACTGGTTTGTTGG + Intergenic
1164404298 19:27929122-27929144 TTCACCAGTGGCTGATTTGCAGG + Intergenic
1165335521 19:35167157-35167179 TTCTCCAGTTAATCGTTTGCAGG - Intronic
1166351787 19:42202316-42202338 TTTTCTTGTGACTGGAGTGCAGG - Intronic
1168217312 19:54935897-54935919 TTTTCCACAGACGGGTTTGGGGG - Intronic
925530224 2:4851008-4851030 TTCCCCAGTGATTGGTCTGCTGG + Intergenic
925589261 2:5493629-5493651 GTTTCCAGTGGGTGGTGTGCAGG + Intergenic
926861836 2:17317947-17317969 TTGTCCAGGGACTGTTTTTCAGG - Intergenic
928834047 2:35522188-35522210 TTTGCCACTGACCAGTTTGCTGG + Intergenic
929343311 2:40849742-40849764 TTTCTCAGTCACTGGTTTGCTGG + Intergenic
932020724 2:68083426-68083448 TTTTCCATGGACTGGGTTGGTGG - Intronic
932550704 2:72766637-72766659 TTTTCAATTGACTTATTTGCTGG - Intronic
932560246 2:72861675-72861697 TTTTCACGTGGCTGGTTTTCAGG + Intergenic
935880923 2:107564458-107564480 TTTTCCAGTGATTGATTTGGAGG + Intergenic
937158825 2:119741135-119741157 TTTGCCAGTGACTGGTCTAGGGG - Intergenic
939646567 2:144706788-144706810 TTTTCAAGTGACTGCTTTGGGGG - Intergenic
940009879 2:149041451-149041473 TTTGCCAATGACTGGTTTCAGGG - Intronic
940023265 2:149178719-149178741 TATACCACTGACTGGTTTCCAGG - Intronic
940647427 2:156406318-156406340 TTTTGCAGTGACAGCTTTCCAGG - Intergenic
943405895 2:187484202-187484224 TTTTCCAGCGAATGGTTTCCAGG - Exonic
944893384 2:204140137-204140159 CTTTCCAGTGACTGGTGTACTGG - Intergenic
944976687 2:205061366-205061388 TTGACCACTGACTGATTTGCTGG + Intronic
945308431 2:208282815-208282837 TTTTCCATGGACTGGTGTGGGGG + Intronic
945984218 2:216341082-216341104 AGTTCCAGTGACTGCTTTCCTGG - Intronic
1172072817 20:32270951-32270973 ATTTACAGTGATTGCTTTGCTGG + Intergenic
1172957168 20:38769205-38769227 TTTCTCAGTGGCTGGTTTCCTGG + Intronic
1174668785 20:52285930-52285952 TTCTCCAGTGACTGGCTTGGAGG - Intergenic
1174680906 20:52407304-52407326 CTTGCCAGTGACTGGCTTGGGGG + Intergenic
1177022527 21:15880889-15880911 ATATCCAGTTACGGGTTTGCTGG + Intergenic
1177895456 21:26851874-26851896 TTTACCAGTGCCTGTTTTGAAGG + Intergenic
1178914128 21:36697667-36697689 TTTTCCAGGGACTCCTTTGAAGG - Intergenic
1179287931 21:39994315-39994337 TTTCCCAGGGTCTGGATTGCAGG - Intergenic
1179439320 21:41382094-41382116 TTTTCCAGTGAGTGCTGTGGTGG - Intronic
1181431376 22:22883753-22883775 GTCTCCAGAGACTGGTTTCCTGG + Intronic
1182936509 22:34227761-34227783 TCTTCCAGCATCTGGTTTGCTGG + Intergenic
1183384404 22:37506736-37506758 TTCTCCACTGACTGGGATGCTGG - Intronic
951875553 3:27420910-27420932 TTTTTCAGTGATTGGTGTGGGGG - Intronic
952177779 3:30885101-30885123 ATTTCCAGTCACTGATTTCCTGG + Intronic
952419595 3:33119078-33119100 TTTTCAAGTGAATAATTTGCTGG + Intronic
953755274 3:45640782-45640804 TGTTCTAGGGCCTGGTTTGCTGG - Intronic
954375089 3:50189867-50189889 TCTTCCAGAGAATGTTTTGCAGG - Intergenic
954807662 3:53229791-53229813 GTTTCCAGAGACTGCTCTGCAGG - Intronic
957304772 3:78442347-78442369 TCTTCCAGGGGCTGGTATGCTGG - Intergenic
957337087 3:78844858-78844880 TTTTCTAGAGACTGCTTTGGAGG - Intronic
958194560 3:90227030-90227052 TTTTCCAGTGTCTACTTTTCTGG - Intergenic
958417924 3:93898067-93898089 TTTTCCAGTGTCTACTTTTCTGG - Intronic
959599056 3:108158578-108158600 TTTTATAGTCATTGGTTTGCTGG - Intergenic
960198532 3:114801655-114801677 CTTTCCAGTGACTGAATTGCTGG + Intronic
960251544 3:115461079-115461101 TTTCCCAGTGACTTGTGTGGGGG + Intergenic
960804906 3:121574278-121574300 TTTTCCACGGACTGGTTGGGGGG + Intronic
961955273 3:130795170-130795192 TTTTTAAGTGATAGGTTTGCAGG - Intergenic
962399478 3:135045248-135045270 TTTTTCAGTGACTGGTGTAAAGG - Intronic
962464225 3:135641823-135641845 TTTCCAGGTGACTGGTCTGCAGG - Intergenic
965967520 3:174512495-174512517 TTTTCCAGTGATTCTTTTTCTGG + Intronic
966334156 3:178849846-178849868 TTTTCCAGTGGCTGCTTTTCAGG - Intergenic
969894118 4:10286994-10287016 TTTTCCAGTGAGTGGAATGCAGG - Intergenic
970255723 4:14167909-14167931 TATTCCAGTCACTGTTTTACAGG + Intergenic
970459799 4:16262033-16262055 TTTCCCAGTGTCTGTTATGCTGG + Intergenic
972396006 4:38660492-38660514 TTTGCCAGTGACTGGTTGGAGGG - Intergenic
972915716 4:43876093-43876115 CTTTCCAATGACTGGTTTACAGG - Intergenic
975307133 4:72863141-72863163 TTTTTCATTCACAGGTTTGCAGG - Intergenic
975474575 4:74808586-74808608 TTTTTCAGTGGCTGGTTTCATGG - Intergenic
976468674 4:85401618-85401640 TATTCCAGTGGCTGCCTTGCTGG + Intergenic
979509336 4:121534309-121534331 TTATGTAGTGTCTGGTTTGCAGG + Intergenic
980851986 4:138394288-138394310 TTTACCACTGACTGGTTTGATGG + Intergenic
981963059 4:150565007-150565029 TTATCCAGTAACGGGATTGCTGG - Intronic
982010774 4:151104155-151104177 ATTTACTGTTACTGGTTTGCAGG + Exonic
982893050 4:160880312-160880334 TTTTCCACTCACTGCTATGCTGG + Intergenic
983102785 4:163645437-163645459 TTATCCATAGACTCGTTTGCTGG - Intronic
987380088 5:17276703-17276725 TTTTCCAATGAGTGGTGTGTTGG - Exonic
989747478 5:44847239-44847261 TTTTCCACGGACGGGTTTCCGGG + Intergenic
990153132 5:52843171-52843193 TTTTACAGTGAATGGTTTTAGGG - Intronic
990490849 5:56301351-56301373 TTTGCCAGTGACTGGTTTAAGGG + Intergenic
991120710 5:63010023-63010045 TTTTTGAATGACAGGTTTGCAGG + Intergenic
991315311 5:65297107-65297129 TTTTCCGGCGACGGCTTTGCAGG - Intronic
992037417 5:72793837-72793859 TTTTCCAGGGACTGGAGTGGGGG - Intergenic
993032319 5:82719290-82719312 TTATTCAGTAACTAGTTTGCTGG + Intergenic
993692347 5:91017719-91017741 TTTTCCAGTGTGTGGTTTCCAGG + Intronic
995399307 5:111722241-111722263 TTTTTCTGTGACTGGTTTTCTGG - Intronic
999186871 5:149717698-149717720 TTTTCCAGTGTCTGGGTAGAGGG + Intergenic
999981573 5:156962937-156962959 TTATCCAGAGACTGGTCTGGGGG - Intronic
1003272682 6:4621254-4621276 TTTGCCAGTGACTGCTTAGTGGG + Intergenic
1003288004 6:4751899-4751921 CTTTCCTGCGACTGTTTTGCTGG + Intronic
1003371430 6:5531203-5531225 TTTTCCAGTGACTGGCTGAGGGG - Intronic
1004051819 6:12089648-12089670 TCTTCCACTGACTGGTATTCAGG - Intronic
1004799875 6:19134667-19134689 TGTTCCACTGTCTGGTCTGCTGG - Intergenic
1007041689 6:38727849-38727871 TTTTCCAGTGACTGGGTGGCAGG + Intronic
1009334464 6:62469381-62469403 TTTTCCTGTTAATGGATTGCAGG + Intergenic
1009442931 6:63703805-63703827 CTTTCGTGTGACTGGTTTTCTGG + Intronic
1012356868 6:98325005-98325027 TTTTCCTGTGATAGGTTTCCAGG + Intergenic
1013385489 6:109625679-109625701 TTTTCCACAGACTGGGTTGTGGG - Intronic
1013597978 6:111678172-111678194 TTTTCCACTGAATGTTTTCCAGG + Intronic
1013858419 6:114604302-114604324 TTATCCAGTCATTGGTTGGCAGG - Intergenic
1014783004 6:125586464-125586486 TTTTCTTGTGACTGGTGAGCAGG - Intergenic
1015599060 6:134894651-134894673 CTTCCCAGTGAGTGGTTTCCAGG - Intergenic
1016596721 6:145811548-145811570 TTTTCCAGTAATTGATCTGCAGG - Intronic
1017093780 6:150785933-150785955 TTTTCCACAGACTGGATTGTGGG - Intronic
1017481688 6:154862878-154862900 TTTTCCGGTTACCGGTTTTCTGG + Intronic
1017983621 6:159423623-159423645 TTTTCCTGTACCTGCTTTGCTGG + Intergenic
1018326105 6:162671110-162671132 TCTTCCATTAACTGGTTTTCTGG - Intronic
1018363174 6:163093307-163093329 CTTTCCAGTGACTGCTTTGAGGG + Intronic
1019105014 6:169660603-169660625 TTTTCCTTTGACTGGTATGTGGG - Intronic
1020350655 7:7215165-7215187 TTTGCCACCGACTGCTTTGCTGG + Intronic
1021132071 7:16923340-16923362 GTCTCCAGTGACTGGCTTCCTGG + Intergenic
1022539808 7:31125137-31125159 TTTTCCAGGGACTGGGTGGCAGG + Intergenic
1023554221 7:41403455-41403477 TTTTCCAGGGGTTGGTTTGCAGG - Intergenic
1023906516 7:44526234-44526256 TTTTTAAGTGACAGTTTTGCTGG - Intronic
1024951584 7:54866692-54866714 TTGTGCAGTGGCTGGTTTGATGG - Intergenic
1025844594 7:65184997-65185019 TTTTCCAGTGACTGGTTTGCTGG - Intergenic
1025875728 7:65478406-65478428 ACTTCCAGTGACCGGTTTGTTGG - Intergenic
1025894922 7:65691335-65691357 TTTTCCAGTGACTGGTTTGCTGG - Intergenic
1026795946 7:73366141-73366163 TTTTCCAGAGACTGGCCTCCTGG - Intergenic
1031428816 7:121640016-121640038 TTTACCAGTGAATGGTTAGGAGG + Intergenic
1033282609 7:140016840-140016862 TTTCCCAGTGACTGGGTCGTAGG - Intronic
1033805526 7:144950308-144950330 ATTTCCAGTGATGGGTTTTCAGG + Intergenic
1038008950 8:23458440-23458462 TTTTAAAGTGGCTGGATTGCTGG - Intergenic
1038124777 8:24660695-24660717 TTTATCAGTGACTAGTTTGCTGG - Intergenic
1040010648 8:42658480-42658502 TTTTCCAGGGACTGGGTTGGGGG + Intergenic
1042221699 8:66480675-66480697 TTTTCCAATCTCTGGTTTACTGG - Intronic
1043699049 8:83260743-83260765 TTTTCCATTGACTTGTTTCTTGG + Intergenic
1045174936 8:99712474-99712496 GAATCCAATGACTGGTTTGCCGG - Intronic
1046025965 8:108724266-108724288 TATTCCAGTTACTGGTTTATAGG + Intronic
1046130068 8:109955729-109955751 TTTACCAGAGCCTGATTTGCTGG - Intergenic
1058879167 9:109271749-109271771 GTTTCCAGTGACTGGTTTAATGG - Intronic
1059631367 9:116126660-116126682 ATATCCAGTGATGGGTTTGCTGG + Intergenic
1059980387 9:119765141-119765163 CTTTCCAGTGGCTGGTTGGTAGG - Intergenic
1187181084 X:16945021-16945043 TTTTCCAGTGGCTTCTTTTCTGG + Intergenic
1187615561 X:20990178-20990200 CTTTCCAGTGATTGGTTTGGAGG - Intergenic
1189629052 X:42932340-42932362 TTTTCCAGTGACTGTTTAGCGGG + Intergenic
1190218210 X:48493871-48493893 TTTTCCAGAGACTGGGGTGGAGG + Intergenic
1190970647 X:55344004-55344026 TTTTCCAGTGCCTGGCTCGGTGG + Intergenic
1191012448 X:55774703-55774725 ATTTCCTGTGCCTGGTTTACTGG - Intergenic
1191204086 X:57816239-57816261 ATATCCAGTGCCTGGTTTGGCGG - Intergenic
1192048203 X:67698825-67698847 TTAACCAGTGAATGGCTTGCAGG - Intronic
1192777049 X:74256010-74256032 TTTGCCACTGACCGCTTTGCTGG - Intergenic
1194221228 X:91194195-91194217 ATATCCAGTGATGGGTTTGCTGG - Intergenic
1195423274 X:104699127-104699149 TTTACCAGGGACTGGTTTTGTGG + Intronic
1199432360 X:147776084-147776106 ATTTCCCGTGACTCCTTTGCGGG + Intergenic
1200899496 Y:8414721-8414743 TTTTGAAGTTTCTGGTTTGCTGG + Intergenic
1201235200 Y:11902630-11902652 TCTTCCAGTTACTGGTTATCTGG - Intergenic