ID: 1085609359

View in Genome Browser
Species Human (GRCh38)
Location 11:77933261-77933283
Sequence TCTGATGCCGAGCCCGAAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 60
Summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 59}

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085609350_1085609359 14 Left 1085609350 11:77933224-77933246 CCACAGTCTCCCTCTCCCTCTCT 0: 63
1: 582
2: 471
3: 1088
4: 7012
Right 1085609359 11:77933261-77933283 TCTGATGCCGAGCCCGAAGCTGG 0: 1
1: 0
2: 0
3: 0
4: 59
1085609343_1085609359 28 Left 1085609343 11:77933210-77933232 CCATCCCCCTCTCCCCACAGTCT 0: 3
1: 77
2: 525
3: 436
4: 1506
Right 1085609359 11:77933261-77933283 TCTGATGCCGAGCCCGAAGCTGG 0: 1
1: 0
2: 0
3: 0
4: 59
1085609349_1085609359 15 Left 1085609349 11:77933223-77933245 CCCACAGTCTCCCTCTCCCTCTC 0: 66
1: 562
2: 258
3: 344
4: 2011
Right 1085609359 11:77933261-77933283 TCTGATGCCGAGCCCGAAGCTGG 0: 1
1: 0
2: 0
3: 0
4: 59
1085609348_1085609359 16 Left 1085609348 11:77933222-77933244 CCCCACAGTCTCCCTCTCCCTCT 0: 65
1: 567
2: 316
3: 2412
4: 3355
Right 1085609359 11:77933261-77933283 TCTGATGCCGAGCCCGAAGCTGG 0: 1
1: 0
2: 0
3: 0
4: 59
1085609353_1085609359 4 Left 1085609353 11:77933234-77933256 CCTCTCCCTCTCTCTCCACGGTC 0: 71
1: 673
2: 312
3: 201
4: 955
Right 1085609359 11:77933261-77933283 TCTGATGCCGAGCCCGAAGCTGG 0: 1
1: 0
2: 0
3: 0
4: 59
1085609355_1085609359 -2 Left 1085609355 11:77933240-77933262 CCTCTCTCTCCACGGTCTCCCTC 0: 74
1: 808
2: 398
3: 155
4: 1011
Right 1085609359 11:77933261-77933283 TCTGATGCCGAGCCCGAAGCTGG 0: 1
1: 0
2: 0
3: 0
4: 59
1085609352_1085609359 5 Left 1085609352 11:77933233-77933255 CCCTCTCCCTCTCTCTCCACGGT 0: 74
1: 664
2: 298
3: 201
4: 1258
Right 1085609359 11:77933261-77933283 TCTGATGCCGAGCCCGAAGCTGG 0: 1
1: 0
2: 0
3: 0
4: 59
1085609347_1085609359 21 Left 1085609347 11:77933217-77933239 CCTCTCCCCACAGTCTCCCTCTC 0: 68
1: 696
2: 316
3: 293
4: 1488
Right 1085609359 11:77933261-77933283 TCTGATGCCGAGCCCGAAGCTGG 0: 1
1: 0
2: 0
3: 0
4: 59
1085609346_1085609359 22 Left 1085609346 11:77933216-77933238 CCCTCTCCCCACAGTCTCCCTCT 0: 68
1: 766
2: 318
3: 318
4: 1228
Right 1085609359 11:77933261-77933283 TCTGATGCCGAGCCCGAAGCTGG 0: 1
1: 0
2: 0
3: 0
4: 59
1085609354_1085609359 -1 Left 1085609354 11:77933239-77933261 CCCTCTCTCTCCACGGTCTCCCT 0: 72
1: 703
2: 382
3: 147
4: 906
Right 1085609359 11:77933261-77933283 TCTGATGCCGAGCCCGAAGCTGG 0: 1
1: 0
2: 0
3: 0
4: 59
1085609345_1085609359 23 Left 1085609345 11:77933215-77933237 CCCCTCTCCCCACAGTCTCCCTC 0: 2
1: 80
2: 208
3: 929
4: 1368
Right 1085609359 11:77933261-77933283 TCTGATGCCGAGCCCGAAGCTGG 0: 1
1: 0
2: 0
3: 0
4: 59
1085609344_1085609359 24 Left 1085609344 11:77933214-77933236 CCCCCTCTCCCCACAGTCTCCCT 0: 3
1: 38
2: 51
3: 286
4: 1897
Right 1085609359 11:77933261-77933283 TCTGATGCCGAGCCCGAAGCTGG 0: 1
1: 0
2: 0
3: 0
4: 59

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085609359 Original CRISPR TCTGATGCCGAGCCCGAAGC TGG Intronic
900013603 1:135164-135186 TGTGAGGCCGAGGCCGAGGCTGG + Intergenic
900043671 1:491147-491169 TGTGAGGCCGAGGCCGAGGCCGG + Intergenic
900065109 1:726150-726172 TGTGAGGCCGAGGCCGAGGCCGG + Intergenic
902633466 1:17719671-17719693 TCTGCTGCAAAGCCCGAGGCTGG - Intergenic
902834177 1:19036068-19036090 TGTGATGCCGAGCGCCAGGCAGG - Intergenic
904817584 1:33217060-33217082 CCTGATGCTGAGCTGGAAGCTGG - Intergenic
908035257 1:60044627-60044649 TCTGAAGCCCAGCCTGCAGCTGG - Intronic
909022858 1:70451663-70451685 TCTGTTGCCGAGGCTGAGGCTGG + Intergenic
922100216 1:222472987-222473009 TGTGAGGCCGAGGCCGAGGCCGG + Intergenic
1064410605 10:15100649-15100671 TCTGATTCAGAGCCGGAATCAGG - Intronic
1066733275 10:38451740-38451762 TGTGAGGCCGAGGCCGAGGCCGG - Intergenic
1067442029 10:46313987-46314009 TCCCAGGCCGAGCCAGAAGCAGG - Intronic
1076969945 11:127378-127400 TGTGAGGCCGAGGCCGAGGCCGG + Intergenic
1085609359 11:77933261-77933283 TCTGATGCCGAGCCCGAAGCTGG + Intronic
1089480431 11:118800460-118800482 TGGGAGGCCGAGCCCGAGGCGGG - Intergenic
1092758685 12:11789454-11789476 GCTGAAGCCCAGACCGAAGCAGG - Intronic
1101874619 12:108590069-108590091 TCTGACGCCCAGCCTGGAGCAGG - Exonic
1121337238 14:93084925-93084947 TCTGATGCTGAGCATGGAGCAGG - Intronic
1132662069 16:1066048-1066070 CCTGATGCGGAGCCCGAGGGTGG + Intergenic
1134094596 16:11411187-11411209 CCAGATGCCCAGCCCGAGGCAGG - Intronic
1136498799 16:30659543-30659565 TCTGCTGCCCAGCCCGGACCCGG - Exonic
1142450735 16:90171754-90171776 TGTGAGGCCGAGGCCGAGGCCGG - Intergenic
1142456830 17:61937-61959 TGTGAGGCCGAGGCCGAGGCCGG + Intergenic
1142982922 17:3681716-3681738 ACTGCTGCCGAGGCCGAATCCGG + Intronic
1144818579 17:18054609-18054631 TCTCATGCCAGCCCCGAAGCCGG - Intronic
1145011056 17:19368111-19368133 TCTGAGGCAGAGCCCGAGGTGGG + Intronic
1153233135 18:2959920-2959942 TGGGAGGCCGAGGCCGAAGCCGG + Intronic
1157666412 18:49491480-49491502 TCTTATGCCAAGCCCCAAGTAGG + Intronic
1160646747 19:197296-197318 TGTGAGGCCGAGGCCGAGGCCGG + Intergenic
1161208053 19:3052289-3052311 TCTGATGCCTAGCCCAGAGAGGG - Intergenic
926975682 2:18514694-18514716 TCTGGTGCTGAGCCCCAGGCTGG - Intergenic
927768493 2:25836131-25836153 CCTCATGCCGAGGCCAAAGCAGG + Intronic
936368690 2:111884308-111884330 ACTGATGCGAACCCCGAAGCCGG + Exonic
938540001 2:132278087-132278109 TCTGACGCCCAGGCTGAAGCTGG - Intergenic
941649341 2:168076770-168076792 TCTGATGCCAAGCCCAAAAGAGG - Intronic
1171437726 20:25136043-25136065 TCTGAGGCCGAGCAGGAAGATGG + Intergenic
1171868929 20:30511105-30511127 TCTGATGCCCAGGCTGGAGCTGG - Intergenic
1173622748 20:44449169-44449191 TCAGATGCCCAGGCAGAAGCCGG - Intergenic
1175801777 20:61805135-61805157 TCATATGCCCAGCCGGAAGCCGG + Intronic
950055906 3:10024198-10024220 TCTGTTGCCCAGGCTGAAGCTGG - Intergenic
953273138 3:41466177-41466199 TCTAATGCCCAGTCAGAAGCAGG - Intronic
954036381 3:47853264-47853286 TCTGAGGCAGCGCCTGAAGCTGG - Exonic
960963498 3:123089114-123089136 TCTGGGGCCCAGCCAGAAGCTGG + Intronic
968370934 3:198222226-198222248 TGTGAGGCCGAGGCCGAGGCCGG - Intergenic
972538653 4:40020394-40020416 CCCAATGCCGAGCCGGAAGCTGG - Intergenic
979259620 4:118634714-118634736 TGTGAGGCCGAGGCCGAGGCCGG - Intergenic
979328753 4:119405910-119405932 TGTGAGGCCGAGGCCGAGGCCGG + Intergenic
984206276 4:176792175-176792197 TCGGACGCGGAGCCCGACGCGGG - Exonic
1002730172 5:181327782-181327804 TGTGAGGCCGAGGCCGAGGCCGG - Intergenic
1023709114 7:42973259-42973281 TCTGCTGCTGAGCCAAAAGCAGG + Intergenic
1026883526 7:73922242-73922264 GCTGCTGGCGAGCCCGATGCTGG + Intergenic
1033173919 7:139108456-139108478 TCTGATGCCTGGCGCGTAGCAGG - Intronic
1034512277 7:151545726-151545748 CCTGCTGCCCAGCCAGAAGCTGG - Intergenic
1050794044 9:9514213-9514235 GCTGATGCAGAGCCCTAACCAGG - Intronic
1051161549 9:14214004-14214026 CCTGATGCATAGCCCGAAGGTGG - Intronic
1061548820 9:131320504-131320526 TCTGATGCTGAGCCCTGGGCCGG + Intergenic
1061820698 9:133225890-133225912 TCTGTTGCAGAGACCGAGGCCGG + Intergenic
1062578888 9:137221184-137221206 TCTGACCCCGGGCCCGAGGCGGG - Exonic
1062754583 9:138280296-138280318 TGTGAGGCCGAGGCCGAGGCCGG - Intergenic
1203578489 Un_KI270745v1:24456-24478 TGTGAGGCCGAGGCCGAGGCCGG - Intergenic