ID: 1085610703

View in Genome Browser
Species Human (GRCh38)
Location 11:77945970-77945992
Sequence CTGTGGCTATGTAGGGAAAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 274
Summary {0: 1, 1: 0, 2: 5, 3: 22, 4: 246}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085610703_1085610712 6 Left 1085610703 11:77945970-77945992 CCCATTTCCCTACATAGCCACAG 0: 1
1: 0
2: 5
3: 22
4: 246
Right 1085610712 11:77945999-77946021 CCAGCAGGCCACCGCGGCAAAGG 0: 1
1: 0
2: 0
3: 8
4: 94
1085610703_1085610707 -9 Left 1085610703 11:77945970-77945992 CCCATTTCCCTACATAGCCACAG 0: 1
1: 0
2: 5
3: 22
4: 246
Right 1085610707 11:77945984-77946006 TAGCCACAGAGCTGCCCAGCAGG 0: 4
1: 0
2: 0
3: 48
4: 427
1085610703_1085610709 0 Left 1085610703 11:77945970-77945992 CCCATTTCCCTACATAGCCACAG 0: 1
1: 0
2: 5
3: 22
4: 246
Right 1085610709 11:77945993-77946015 AGCTGCCCAGCAGGCCACCGCGG 0: 1
1: 0
2: 0
3: 31
4: 303

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085610703 Original CRISPR CTGTGGCTATGTAGGGAAAT GGG (reversed) Intronic
900425260 1:2575444-2575466 GTGTGACTATGTTTGGAAATGGG - Intergenic
901064449 1:6488319-6488341 CTGCTGCTACGTAGGGAAATGGG + Intronic
902189329 1:14750637-14750659 CTCAGGCTATGTAGAGAAAATGG - Intronic
902197397 1:14807839-14807861 CTGTGTCTGGGTGGGGAAATAGG - Intronic
905002214 1:34681579-34681601 CTGTTGCTCTGCAGGTAAATGGG - Intergenic
906162388 1:43659935-43659957 CTGTGGATATGTAGGGACCTTGG + Intronic
906246628 1:44280365-44280387 CAGTGGAAATGTAGAGAAATGGG - Intronic
906414109 1:45606148-45606170 TTTTGGCTATTTAGAGAAATCGG + Intronic
907235937 1:53047733-53047755 CTGAGGCAGTGTGGGGAAATGGG - Intronic
908096571 1:60745686-60745708 CTCTGGCTAGGAAGGGAAACAGG + Intergenic
912346154 1:108965137-108965159 CAGTGGAGATGTGGGGAAATTGG - Intergenic
912474313 1:109925832-109925854 CTGTGGCTAGGCAGGGAGCTGGG - Intronic
916119490 1:161514989-161515011 CTGTGACTTTCTAGAGAAATAGG + Intronic
916129254 1:161596646-161596668 CTGTGACTTTCTAGAGAAATAGG + Intronic
916198217 1:162244955-162244977 CTATGGCTATATAGGGTGATGGG + Intronic
916813943 1:168332545-168332567 CTGTGCTTTTCTAGGGAAATGGG + Intergenic
918754013 1:188313058-188313080 CTTTGGCTATATACAGAAATAGG - Intergenic
919198798 1:194324497-194324519 GTGTGACTATGTTGGGAGATAGG + Intergenic
919684146 1:200466328-200466350 CTGTGGCTATGTGAGTACATGGG - Intergenic
919697208 1:200589841-200589863 CAGGGGCAATGTAGGGAAACCGG - Intronic
922910319 1:229210353-229210375 CTGTGGCTATGTAGTGACCTCGG - Intergenic
923264114 1:232296707-232296729 TTGAGACTAGGTAGGGAAATAGG + Intergenic
923369338 1:233295274-233295296 CTGTGGGTATGGAGGGAAGAAGG - Intronic
924814563 1:247430480-247430502 ATGTGGCTGTTTTGGGAAATGGG - Intronic
924950687 1:248880110-248880132 CTGTGACAATATAGGAAAATGGG - Intergenic
1063118861 10:3090479-3090501 GTGTGGCCAGGTAGGGAAACGGG + Intronic
1065105671 10:22381407-22381429 GTGTTGCTATGTAGGAATATAGG - Intronic
1066036102 10:31486358-31486380 CTGTGGCCATGTAGAGAAAGTGG - Intronic
1067177902 10:43962948-43962970 TTGTGGTTATGTAAGGAATTTGG - Intergenic
1069522034 10:69129950-69129972 TTGTGGCTATGTAGGGCACAAGG - Intronic
1072508465 10:96093740-96093762 CTGTGGCTATATCTGGAGATGGG - Intergenic
1072689225 10:97560538-97560560 CTGTAACTATGTATGGAAACTGG + Intronic
1076502936 10:130951104-130951126 CTGTGGCTATGTTGAGAATTAGG + Intergenic
1078645223 11:13135906-13135928 CTGTGTTTATGCAGGGAAATGGG - Intergenic
1079453882 11:20620554-20620576 CAGTGGCTTTGTTGGGAGATTGG + Intronic
1079710833 11:23680424-23680446 CTGCAGCTATGAAGGGAAGTGGG + Intergenic
1079712591 11:23705119-23705141 GTGTGGCAATGTTGGGAGATGGG - Intergenic
1080953877 11:37069524-37069546 CTGTAAGTATGTAGTGAAATGGG - Intergenic
1081371898 11:42314308-42314330 CTGTGGCCATGTAGGATAATGGG - Intergenic
1082704812 11:56480312-56480334 CAGTGGCTATGTAGACAAAAAGG + Intergenic
1083085328 11:60136683-60136705 CTGTGGGTATTTCTGGAAATGGG - Intergenic
1084067885 11:66715802-66715824 CTGTGGTCATGAAGGGAAGTGGG - Intronic
1084404182 11:68961455-68961477 CTGTGGCCAGGAAGGGAAATGGG - Intergenic
1085272206 11:75277085-75277107 CTTTGGTTATGGAAGGAAATGGG - Intronic
1085610703 11:77945970-77945992 CTGTGGCTATGTAGGGAAATGGG - Intronic
1087071521 11:94086140-94086162 TTGTGGCCATGTGGGGAAACAGG - Exonic
1088821956 11:113464153-113464175 CTGTAGCTATGGAGAGGAATGGG + Intronic
1089060688 11:115623583-115623605 GTGGGGCTGTGTATGGAAATGGG - Intergenic
1089799383 11:121012760-121012782 CTGTGGCTATATTTGGACATGGG - Intergenic
1090882931 11:130850077-130850099 ATGTGGCTATGTTTGGAGATAGG + Intergenic
1092023230 12:5219942-5219964 CCGTGGCTAGGTAGGTAACTTGG - Intergenic
1092085793 12:5758416-5758438 GTGGGGCTGTGGAGGGAAATAGG - Intronic
1092310918 12:7351571-7351593 CTGTGGCTATATTTGGAGATAGG - Intronic
1093385231 12:18544987-18545009 TTGTGGTTATGTATGGAAAATGG - Intronic
1095662639 12:44755548-44755570 CTGTGGCTATACAGGTAAAGTGG - Intronic
1095739735 12:45593617-45593639 CTATGGATATGTGGGGACATGGG + Intergenic
1096478823 12:51924583-51924605 CTTTGTCTAGATAGGGAAATTGG - Intergenic
1098880057 12:75907919-75907941 CTGTGGCTTTATTTGGAAATAGG - Intergenic
1100849706 12:98696473-98696495 CTGTGGCAGTGTTGGGAAGTAGG - Intronic
1101712863 12:107284698-107284720 CTGTGGCTATATTTGGACATTGG + Intergenic
1106551866 13:30778971-30778993 ATGTGGCAATGTTGGGAAAGGGG + Intergenic
1106552108 13:30780974-30780996 CTGTGGCTGTGTTGGGAGTTGGG + Intergenic
1107379880 13:39845399-39845421 GTGTGGATCTGTAGGGAAAATGG + Intergenic
1108044262 13:46368033-46368055 CAGTGGCTATGAAGGCAAGTTGG - Exonic
1111458071 13:88509104-88509126 CTGAGGCTGTGCAGGGCAATGGG + Intergenic
1112107882 13:96261764-96261786 CTGTGGCTCTGTAGAGAATATGG + Intronic
1112610770 13:100952658-100952680 GAGTTTCTATGTAGGGAAATGGG + Intergenic
1116674381 14:47886962-47886984 CTGTGGCTATATTTGGACATGGG - Intergenic
1116870546 14:50065712-50065734 GTGTGACTGTGTGGGGAAATGGG - Intergenic
1118073466 14:62271450-62271472 CTGGGGCTAAGTGGGGAAACTGG - Intergenic
1118494147 14:66291510-66291532 CTCTGGCTATTAAGGGAAAGGGG + Intergenic
1119464200 14:74841503-74841525 TTGTGGCCATGTGGGGATATAGG + Intronic
1119524924 14:75315247-75315269 CTGTGGCTATTCTGGGAATTTGG + Intergenic
1120515447 14:85464834-85464856 CTGAGGCTAAGCAGGGAAGTGGG - Intergenic
1121766879 14:96495338-96495360 ATGTGGCAATGTAGAGAGATGGG - Intergenic
1124356195 15:28996582-28996604 CAGCGGCTTTGTAGGGAAACTGG + Intronic
1126464615 15:48950609-48950631 CAGTGGGGATGGAGGGAAATGGG + Intronic
1129163000 15:73757660-73757682 CTGTGGCCATGGAGGGGAAGTGG + Intergenic
1129321239 15:74776239-74776261 CAGTTGCTAGGTAGGGAAACAGG + Intergenic
1132524981 16:409985-410007 CTGTGGCCTTGTTTGGAAATGGG - Intronic
1133411472 16:5572778-5572800 CTGTGGATATTTAGGGCAATCGG + Intergenic
1133439444 16:5808113-5808135 ATGTGACTATGTATGGAGATAGG + Intergenic
1134045271 16:11096391-11096413 CTGTGGTTATCCAGGGAAGTGGG - Intronic
1134883108 16:17764772-17764794 CTGTGGCAAAGCAGAGAAATAGG - Intergenic
1136784735 16:32927594-32927616 CTATGGCTGTGTAGGAAAAAGGG - Intergenic
1136885048 16:33926212-33926234 CTATGGCTGTGTAGGAAAAAGGG + Intergenic
1137579374 16:49623870-49623892 CTGTGGCTAGGTAGGGACCAGGG + Intronic
1137737556 16:50736200-50736222 CTGGGCCTGTGTAGGGAACTAGG + Intergenic
1138137160 16:54533060-54533082 CAGGGGCTAGGTAGGGAAACAGG + Intergenic
1139278798 16:65751916-65751938 CTATGACTATGGAGGGAGATGGG - Intergenic
1203087393 16_KI270728v1_random:1191600-1191622 CTATGGCTGTGTAGGAAAAAGGG - Intergenic
1143900591 17:10171618-10171640 CTGTGATTATTTAGGGAGATGGG - Intronic
1144713211 17:17416521-17416543 CTGTGGCTCTGTGGGGAGATGGG + Intergenic
1146841905 17:36162106-36162128 CTGTGGCCATGTTGGGATCTGGG + Intergenic
1146854216 17:36250066-36250088 CTGTGGCCATGTTGGGATCTGGG + Intronic
1146870119 17:36373958-36373980 CTGTGGCCATGTTGGGATCTGGG + Intronic
1146877476 17:36425039-36425061 CTGTGGCCATGTTGGGATCTGGG + Intronic
1147073000 17:37974582-37974604 CTGTGGCCATGTTGGGATCTGGG + Intergenic
1147084522 17:38054120-38054142 CTGTGGCCATGTTGGGATCTGGG + Intronic
1147100469 17:38178086-38178108 CTGTGGCCATGTTGGGATCTGGG + Intergenic
1147145037 17:38479736-38479758 CTATGGCTGTGTAGGAAAAAGGG - Exonic
1147814813 17:43201496-43201518 CTGTGGCTAAAGAGGAAAATGGG + Intronic
1148385601 17:47232467-47232489 CTGTGGTTATGTTGGCAAAGAGG + Intergenic
1149544897 17:57496259-57496281 CTGTGGCTCTGTAGGGCACACGG - Intronic
1150083410 17:62261132-62261154 CTGTGGCCATGTTGGGATCTGGG + Intergenic
1151498994 17:74476967-74476989 GTGTGTGTATGTGGGGAAATTGG + Intronic
1151737443 17:75953044-75953066 CTGTGGCTATGAATGCAAAAGGG + Intronic
1152548031 17:81012742-81012764 CTGAGGCTGTATAGGGAAGTGGG - Intergenic
1153663731 18:7349689-7349711 CTGTGTCTATATTTGGAAATAGG - Intergenic
1155186393 18:23390538-23390560 CTCTGGCTATAAAGAGAAATTGG + Intronic
1157243773 18:46035693-46035715 TGGTGGCTATCTAGGGAGATGGG - Intronic
1157446106 18:47748024-47748046 CTGTGGGTCCATAGGGAAATGGG - Intergenic
1158051120 18:53221322-53221344 CTATGACTGTGTGGGGAAATGGG - Intronic
1158067784 18:53433811-53433833 CTGTGAGTATGTAAGGAAGTAGG - Intronic
1158981537 18:62766553-62766575 CTGTGACTAGGTAGAGAAACTGG + Intronic
1161067462 19:2245767-2245789 CTGTGGCTCAGCTGGGAAATGGG - Intronic
1167581657 19:50347738-50347760 CTGAGGCCATGTTTGGAAATTGG - Intronic
926252333 2:11162195-11162217 CTGTGTCTATGGAGGGAGCTGGG + Intronic
929003991 2:37378010-37378032 CTGTGCTTATGTAGTGGAATGGG + Intergenic
929111466 2:38408560-38408582 CTGTGGCTAAAAGGGGAAATCGG + Intergenic
930213871 2:48672703-48672725 CTGTGATTATGTAGTCAAATGGG + Intronic
931092053 2:58896704-58896726 GTGTGGGTGTGGAGGGAAATGGG - Intergenic
931775975 2:65540743-65540765 CTGTGGCTTGGTAGTGAAAAAGG - Intergenic
933282816 2:80351242-80351264 CTCTGCCTATGTGGGGAAAGAGG - Intronic
936918130 2:117660977-117660999 CTGTTGCTATGTAACCAAATAGG - Intergenic
936966583 2:118133180-118133202 CTGTGGCTATGCAGGTTGATTGG + Intergenic
938000951 2:127736555-127736577 CTTTGCCTATGTAGGTAAAATGG + Intronic
938341150 2:130537526-130537548 CAGTTGCTATCCAGGGAAATGGG - Intergenic
938348680 2:130583183-130583205 CAGTTGCTATCCAGGGAAATGGG + Intronic
940166596 2:150780473-150780495 CTGTGGCAAAGCAGGGAAAAAGG - Intergenic
940407216 2:153318814-153318836 ATATGGCTATGTAGTAAAATGGG + Intergenic
941399663 2:165015087-165015109 TTGGTACTATGTAGGGAAATTGG - Intergenic
942602278 2:177653501-177653523 ATGTGGCCATGTTTGGAAATAGG + Intronic
943275201 2:185857957-185857979 ATGTGGCTTTATTGGGAAATAGG - Intergenic
944539610 2:200743167-200743189 CTGTGGCTGAGTTGGGAAAGCGG - Intergenic
946134656 2:217635962-217635984 CTGTGACTATGTTGGGTTATAGG - Intronic
946532423 2:220585889-220585911 CTGTGGCTGGGTAGAGAATTGGG - Intergenic
947698920 2:232216463-232216485 ATGTGGCTTTGCAGGGAAAGGGG - Intronic
948559480 2:238842039-238842061 CTAGGGATATGTAGGGAAATGGG - Intergenic
1172050128 20:32110638-32110660 GTGTGGCCATGTTGGGGAATGGG - Intronic
1172392998 20:34578977-34578999 CTGAGGCTCTGAAGGGAAAGTGG - Intronic
1173306988 20:41860194-41860216 CTGTGGCCATGCAGGGTAAGGGG + Intergenic
1173801204 20:45895612-45895634 ATGTGGCTACGTAATGAAATGGG - Intronic
1174504080 20:51005367-51005389 CTCTGGCTATGTGTGGAAAATGG - Intronic
1177354906 21:19995901-19995923 CTGGGGCTATGTTTGGAAAATGG - Intergenic
1177529465 21:22340962-22340984 CTGAGGCTGTGTAGGGCAGTGGG + Intergenic
1178464671 21:32836191-32836213 CTTTGGCTCTGTAGGAAAGTTGG - Intergenic
1178563822 21:33664512-33664534 CTGTGGCAGTGTAGGGAGGTGGG - Intronic
1182847072 22:33440073-33440095 CTGTGGCTAGGTAGGCAGAATGG - Intronic
1185243440 22:49759708-49759730 TGGTGGCGATGTGGGGAAATTGG + Intergenic
949226043 3:1697578-1697600 CTCTGGATATGAAGGGAAAGAGG + Intergenic
949534190 3:4983179-4983201 CAGTGGCTATGGAGGAGAATCGG + Exonic
949582077 3:5398571-5398593 ATGTGGCTATGTTTGGAGATAGG - Intergenic
951317949 3:21209266-21209288 ATGTGGCTCTGTAGGTGAATTGG - Intergenic
952685773 3:36146754-36146776 CTGTGTCTATGTGGAGAAATTGG + Intergenic
955688788 3:61570044-61570066 GTGTGGTAATGGAGGGAAATAGG + Intronic
956621466 3:71225239-71225261 CTGTGGCTATCCAGGCAAAGGGG - Intronic
959084405 3:101835706-101835728 ATGTGGCTATGTTTGGAGATGGG - Intronic
959647312 3:108717825-108717847 TTGTGGATGTGTAAGGAAATGGG - Intergenic
959734280 3:109640094-109640116 CTGTGGCCATGTAGGCCAATTGG + Intergenic
960810815 3:121625829-121625851 TTGTTGCTATGTAGGAAAAGTGG - Intronic
962387541 3:134944120-134944142 CTGGGGCCATAGAGGGAAATGGG - Intronic
966226044 3:177599181-177599203 CTATGGCTATTGTGGGAAATAGG + Intergenic
967798264 3:193623148-193623170 CTTTTGCTATGTAAGGATATAGG - Intronic
968849275 4:3067602-3067624 CTGGGTATTTGTAGGGAAATTGG + Intergenic
969889051 4:10242801-10242823 CTTGGACTATGTAGGGAAATAGG - Intergenic
970325796 4:14924471-14924493 CTGTACCTATGTAGGGCAAGGGG + Intergenic
970372174 4:15418878-15418900 CTGAGACTGTGTAGGGAATTGGG + Intronic
972351279 4:38238304-38238326 CTGTAGAAATGTAGGGAATTTGG - Intergenic
972901515 4:43690876-43690898 CAGTGGCTAGGAAGGGTAATGGG - Intergenic
972976607 4:44643668-44643690 CTGAGGCTATGAAGGGAAGAGGG - Intronic
974666496 4:64969236-64969258 CTGTGGCTTTGTAGGGTACAGGG + Intergenic
976260305 4:83139122-83139144 CTGTGGCTTTGTAAGGGAAGAGG - Intergenic
976830234 4:89307377-89307399 CTCTGGCTTTGAAGGTAAATGGG - Intronic
976969622 4:91089749-91089771 CTGGGGCCATGTTTGGAAATTGG - Intronic
976989959 4:91353856-91353878 CTGTAGCCATGTTTGGAAATTGG - Intronic
977246726 4:94640100-94640122 CTGTGACTATGTAGGTAAATGGG - Intronic
977411247 4:96668044-96668066 CAGTGGGTGTGTTGGGAAATGGG + Intergenic
977972798 4:103230728-103230750 CTGGGGCTATGTTTGGAAAATGG + Intergenic
978206898 4:106090321-106090343 CTGAGGCTGTGCAGGGAAGTGGG + Intronic
978497636 4:109377320-109377342 CTGTGAGTATGTAGAGAGATGGG + Intergenic
979027928 4:115600469-115600491 CTGTGGCTACTTAGGAAAAGTGG + Intergenic
980007134 4:127555518-127555540 CTGTGGAAATGGAGAGAAATTGG + Intergenic
981639121 4:146915207-146915229 AGGAGGCAATGTAGGGAAATGGG - Intronic
984588533 4:181590391-181590413 CTGTGACTGGGTAGGTAAATCGG - Intergenic
985315736 4:188657261-188657283 CTGTGTATATGTGGTGAAATGGG - Intergenic
985643614 5:1074869-1074891 CTGTGGCTGTGGAGGGAACGAGG + Intronic
986333940 5:6738855-6738877 CTGTGGTTACAGAGGGAAATTGG + Intronic
987206080 5:15627439-15627461 CTGGGTCCATGTAGGGAAAATGG + Intronic
987930278 5:24392548-24392570 CTGGGGCCATGTTTGGAAATTGG - Intergenic
988399742 5:30747516-30747538 CTGTGGCAATAGAGGGAAATAGG - Intergenic
990059546 5:51630400-51630422 CTGTGGAGATGTGGAGAAATAGG + Intergenic
993878023 5:93330772-93330794 CTGTGTCTATGTTGGTAAACTGG - Intergenic
995048083 5:107672002-107672024 CTGTGCCTAAGGAGGGAAAGAGG - Intergenic
995385563 5:111585092-111585114 CTGTGAGAATGCAGGGAAATAGG + Intergenic
995947970 5:117672906-117672928 CTTTGGCTGTGAAGGGAAAAGGG - Intergenic
998106559 5:139472743-139472765 CGGTGGCTCTGTAGGGAGAGTGG - Intergenic
999816218 5:155178964-155178986 GTGTGGCTATGTAGGAAATATGG - Intergenic
1001003016 5:168025573-168025595 ATGTGGCTACATTGGGAAATAGG + Intronic
1001106613 5:168859972-168859994 GTGTGGATAGGTAGGGAAAGAGG - Intronic
1001450592 5:171821431-171821453 CTGTGGCTATGTTTGGAAGCTGG + Intergenic
1002407745 5:179049266-179049288 CTGGGGCCATGTTTGGAAATTGG - Intergenic
1002642682 5:180637901-180637923 CTGTGGCCATGAAGGGGGATAGG - Intronic
1005252477 6:23963287-23963309 CTGTGTCTTTGTTGGGAAAGAGG - Intergenic
1006986313 6:38178023-38178045 CTGTGGCTCTGCAAGGAACTGGG + Intronic
1009200477 6:60738548-60738570 CTGTGGTTATCTATGGTAATTGG - Intergenic
1015172330 6:130267224-130267246 CTGGGGCCATGTTTGGAAATTGG + Intronic
1015928742 6:138335309-138335331 CTCTGACTTTGGAGGGAAATCGG - Intronic
1016633023 6:146254073-146254095 CTTTGGCTAATTAGGAAAATAGG + Intronic
1017000773 6:149995782-149995804 CTGTGACTGTGCAGGGACATAGG - Intergenic
1018665419 6:166132443-166132465 TTCTGGCTATGGAGGGAGATGGG - Intergenic
1020145164 7:5636728-5636750 CTGTGGCTATCAGAGGAAATTGG + Intronic
1020466951 7:8490948-8490970 CTGTGTCTATGAATGTAAATAGG + Intronic
1021309694 7:19078588-19078610 CTGTGGGTGTGTAGGGAGAGGGG + Intronic
1022922727 7:35032883-35032905 CTGTGGAGATGGAGAGAAATTGG - Intronic
1023321282 7:39000508-39000530 CTGTGGGTATGTTGAGAAAATGG - Intronic
1023538456 7:41238931-41238953 ATGTGGCTGTGCAGGGAAACAGG - Intergenic
1024454638 7:49589896-49589918 CAGTGGAGATGTAGAGAAATTGG + Intergenic
1025171746 7:56764555-56764577 CTGTGGCTATTTAGGAAAATGGG - Intergenic
1025213064 7:57032210-57032232 CTTTGCATATGGAGGGAAATTGG + Intergenic
1025658888 7:63544614-63544636 CTTTGGATATGGAGGGAAATTGG - Intergenic
1025700118 7:63810983-63811005 CTGTGGCTATTCAGGAAAATGGG + Intergenic
1025842403 7:65163084-65163106 CTGTGGCTACGTAGGGAGATGGG + Intergenic
1025872261 7:65446186-65446208 CAGTAGATATGTGGGGAAATGGG - Intergenic
1025880642 7:65532885-65532907 CTGTGGCTACGTAGGGAGATGGG - Intergenic
1025892795 7:65669719-65669741 CTGTGGCTACGTAGGGAGATGGG + Intergenic
1026223786 7:68423137-68423159 CTGTGGATAGGTAAGCAAATGGG + Intergenic
1028727063 7:94100209-94100231 ATGTGAGTATGTAGGAAAATGGG + Intergenic
1029526488 7:101097782-101097804 CCATGGCAATGTAGAGAAATGGG - Intergenic
1029676186 7:102070588-102070610 CTTTGGGTACGGAGGGAAATTGG + Intronic
1031171664 7:118299345-118299367 ATGTGGCTATATTTGGAAATGGG - Intergenic
1034885135 7:154793521-154793543 CTCTAGCTAATTAGGGAAATTGG - Intronic
1035582120 8:747009-747031 CAGTGGCTAGGAAGGGAAATGGG + Intergenic
1036504323 8:9341643-9341665 ATGTGGCTTTGTTTGGAAATAGG + Intergenic
1037716706 8:21407314-21407336 CTGTGGCTCTGGGAGGAAATTGG - Intergenic
1039200696 8:35090190-35090212 CTGTGTCAATGAAGAGAAATAGG + Intergenic
1042745875 8:72104846-72104868 CAGGGGCTATGTAGGGGAAGTGG + Intronic
1044282531 8:90373194-90373216 ATGTGGCTGTGTTGGGAGATAGG + Intergenic
1047773464 8:128049453-128049475 CTGTGGCTCTGTAGGGTGAAGGG + Intergenic
1048140537 8:131790058-131790080 CTGTGGCTGATTGGGGAAATGGG + Intergenic
1048300149 8:133245372-133245394 CTGTGGCTATACTTGGAAATAGG + Intronic
1048377257 8:133833654-133833676 GTGTGGGTATGGAGGGAATTGGG - Intergenic
1048898198 8:139013652-139013674 CTGGGGCTATGAAGGGAACCTGG + Intergenic
1049393742 8:142386239-142386261 GTGTGGCTATCTGGGGAAATGGG + Intronic
1050046996 9:1557259-1557281 CTGTGGCTTTGTTTGGAAATAGG + Intergenic
1050430015 9:5552822-5552844 TTGTGGATAGGTAGGGAAGTGGG - Intronic
1052129252 9:24821782-24821804 CTCTGGCTCTGTAGGAAACTGGG - Intergenic
1052137358 9:24929588-24929610 TTGTGTCTATGTAGGCATATGGG + Intergenic
1055178457 9:73351347-73351369 CTGTGGGTAGGAAGGTAAATTGG - Intergenic
1055937213 9:81614361-81614383 CTTTGGTTATGTAGGCAAGTGGG - Intronic
1056406340 9:86279427-86279449 TTCTAGATATGTAGGGAAATAGG + Intronic
1056592178 9:87972638-87972660 CTGTGGCTATGGAGAGCAGTGGG + Intronic
1056699743 9:88892330-88892352 ATGTGGCCATGTTTGGAAATAGG + Intergenic
1057533678 9:95876975-95876997 CTCTTGGTATTTAGGGAAATTGG + Intronic
1058428337 9:104895785-104895807 CTCAGGCTAGGGAGGGAAATGGG - Intronic
1058763564 9:108160219-108160241 ATGTGGCTTTGTGGGGAAAGGGG - Intergenic
1188473868 X:30569345-30569367 GTGTGGGTATGTAGGGGAAATGG + Intronic
1188562747 X:31488252-31488274 CCGTGGCCATTTAGGGAATTAGG + Intronic
1189268501 X:39734230-39734252 CTCTGGCTATCTGGAGAAATTGG + Intergenic
1189671857 X:43419427-43419449 TTGTGGGTATGTTGGCAAATGGG - Intergenic
1189854690 X:45212187-45212209 CTGTGCCTTTCTAGAGAAATGGG - Intergenic
1192963803 X:76156449-76156471 CTGTGGCTATTTGAGGAAAGTGG + Intergenic
1194149625 X:90307930-90307952 ATGTGGCACTGTAGAGAAATTGG + Intergenic
1195160112 X:102162578-102162600 CTGAGGCTATGTGGGGCAGTTGG + Intergenic
1198486550 X:137093023-137093045 CTGGGGCTATGTCAGAAAATAGG - Intergenic
1198703397 X:139420965-139420987 ATGAGGCTAGGAAGGGAAATTGG - Intergenic
1199675511 X:150185957-150185979 CTGGGGCTATGTGGGAAAATCGG + Intergenic
1199827830 X:151516903-151516925 CTGTGGCTAGGCAGGGACCTTGG + Intergenic
1199900309 X:152166375-152166397 TTGTGGATATGTGGGGATATGGG - Exonic
1199996372 X:153029101-153029123 CTGGGGCTATGCAGGGAAACTGG - Intergenic
1200034812 X:153320348-153320370 CTGGGGCTGTGCAGGGAAACTGG + Intergenic
1200496002 Y:3884665-3884687 ATGTGGCACTGTAGAGAAATTGG + Intergenic
1200947803 Y:8864007-8864029 AAGTGGCTATGTATGGAAACTGG - Intergenic
1201680140 Y:16636805-16636827 CTGAGGCCATGTTTGGAAATTGG - Intergenic