ID: 1085610707

View in Genome Browser
Species Human (GRCh38)
Location 11:77945984-77946006
Sequence TAGCCACAGAGCTGCCCAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 479
Summary {0: 4, 1: 0, 2: 0, 3: 48, 4: 427}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085610704_1085610707 -10 Left 1085610704 11:77945971-77945993 CCATTTCCCTACATAGCCACAGA 0: 1
1: 1
2: 6
3: 16
4: 266
Right 1085610707 11:77945984-77946006 TAGCCACAGAGCTGCCCAGCAGG 0: 4
1: 0
2: 0
3: 48
4: 427
1085610699_1085610707 19 Left 1085610699 11:77945942-77945964 CCAAAGCAACAGCCAACCAGGCA 0: 4
1: 0
2: 1
3: 16
4: 202
Right 1085610707 11:77945984-77946006 TAGCCACAGAGCTGCCCAGCAGG 0: 4
1: 0
2: 0
3: 48
4: 427
1085610698_1085610707 20 Left 1085610698 11:77945941-77945963 CCCAAAGCAACAGCCAACCAGGC 0: 4
1: 0
2: 0
3: 13
4: 157
Right 1085610707 11:77945984-77946006 TAGCCACAGAGCTGCCCAGCAGG 0: 4
1: 0
2: 0
3: 48
4: 427
1085610696_1085610707 25 Left 1085610696 11:77945936-77945958 CCTAGCCCAAAGCAACAGCCAAC 0: 4
1: 0
2: 3
3: 27
4: 236
Right 1085610707 11:77945984-77946006 TAGCCACAGAGCTGCCCAGCAGG 0: 4
1: 0
2: 0
3: 48
4: 427
1085610703_1085610707 -9 Left 1085610703 11:77945970-77945992 CCCATTTCCCTACATAGCCACAG 0: 1
1: 0
2: 5
3: 22
4: 246
Right 1085610707 11:77945984-77946006 TAGCCACAGAGCTGCCCAGCAGG 0: 4
1: 0
2: 0
3: 48
4: 427
1085610702_1085610707 -8 Left 1085610702 11:77945969-77945991 CCCCATTTCCCTACATAGCCACA 0: 1
1: 0
2: 3
3: 27
4: 325
Right 1085610707 11:77945984-77946006 TAGCCACAGAGCTGCCCAGCAGG 0: 4
1: 0
2: 0
3: 48
4: 427
1085610700_1085610707 7 Left 1085610700 11:77945954-77945976 CCAACCAGGCAGTAGCCCCATTT 0: 1
1: 3
2: 0
3: 8
4: 120
Right 1085610707 11:77945984-77946006 TAGCCACAGAGCTGCCCAGCAGG 0: 4
1: 0
2: 0
3: 48
4: 427
1085610701_1085610707 3 Left 1085610701 11:77945958-77945980 CCAGGCAGTAGCCCCATTTCCCT 0: 1
1: 3
2: 1
3: 15
4: 201
Right 1085610707 11:77945984-77946006 TAGCCACAGAGCTGCCCAGCAGG 0: 4
1: 0
2: 0
3: 48
4: 427

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085610707 Original CRISPR TAGCCACAGAGCTGCCCAGC AGG Intronic
900391813 1:2436929-2436951 TGGCCCCAGAGCTCCCCAGGAGG - Intronic
900986112 1:6073604-6073626 TGGCCACAGAGCAGCACAGAGGG + Intronic
901084024 1:6599795-6599817 GAGCCACAGAGCTTGTCAGCAGG + Intronic
901261425 1:7874612-7874634 GAGCCGCAGAGCTGCCCGCCTGG + Intergenic
901848305 1:11998784-11998806 TCACCACAGAGCTGGACAGCTGG + Exonic
902511944 1:16971488-16971510 GAGCCACAGCCCGGCCCAGCTGG + Exonic
902577227 1:17386084-17386106 TCCTCACAGAGCTGCCCAGGAGG - Intronic
902892525 1:19454623-19454645 GGGCCACAGAGCTGCCAAGCAGG + Intronic
903685773 1:25130825-25130847 GAGCCAGAGAGCAGCCCAGCAGG - Intergenic
904710092 1:32423744-32423766 TAGTCAAGGAGCAGCCCAGCAGG - Intergenic
905214977 1:36400580-36400602 TAGCCACAGAGGTTTCCAGATGG - Intergenic
905856374 1:41317337-41317359 TACACACAGAGCAGACCAGCAGG + Intergenic
905961430 1:42045706-42045728 GAGGCACAGCGTTGCCCAGCGGG - Intergenic
907519579 1:55014317-55014339 AAGTCACAGAGCTGGCCAGTAGG - Intergenic
908322811 1:62994549-62994571 GGGCCTCAGAGCTCCCCAGCAGG - Intergenic
909054430 1:70805662-70805684 TGGCCACAGAGGTTTCCAGCTGG - Intergenic
909975881 1:82045857-82045879 CAGCCACAGAGGTGCACTGCTGG + Intergenic
910485188 1:87705351-87705373 TAGGAACAGGGCTGCACAGCAGG + Intergenic
910601972 1:89042506-89042528 TGGCCACAGAGGTTTCCAGCTGG - Intergenic
911025611 1:93433574-93433596 TGGCCACAGAGGTTTCCAGCAGG - Intergenic
911267097 1:95754709-95754731 TAGCTACAGAGGTTTCCAGCTGG + Intergenic
912353231 1:109034524-109034546 TAGGAACTGAGCTGCACAGCAGG + Intronic
912639606 1:111332674-111332696 CAGACACAGGGCTGCTCAGCTGG + Intergenic
912934876 1:113994099-113994121 TAGGCACATAGTTGCTCAGCCGG - Intergenic
916605686 1:166340183-166340205 GACCCACAGAGCTGACCAACTGG + Intergenic
917633271 1:176910754-176910776 TAGGAACCGAGCTGCACAGCAGG + Intronic
918810394 1:189110927-189110949 TAGGAACAGGGCTGCACAGCAGG - Intergenic
919615251 1:199799273-199799295 TAGCAACTGGGCTGCACAGCAGG + Intergenic
920662078 1:207923685-207923707 TAGCCACAGAGCTGTGCTCCAGG + Intergenic
921050233 1:211505897-211505919 TGTCCACAGAACTGCCCAGTGGG + Intergenic
921328899 1:214015863-214015885 TAGCCACTGAGGGGCCCAGGAGG - Intronic
923855034 1:237837433-237837455 GAGCAACAGAGCTGTTCAGCAGG + Intergenic
1063787937 10:9407220-9407242 TACACACAGAGCGCCCCAGCGGG + Intergenic
1063787943 10:9407247-9407269 TACACACAGAGCGCCCCAGCGGG + Intergenic
1063787949 10:9407274-9407296 TACACACAGAGCGCCCCAGCGGG + Intergenic
1063787959 10:9407328-9407350 TACACACAGAGCGCCCCAGCGGG + Intergenic
1063787974 10:9407409-9407431 TACACACAGAGCGCCCCAGCGGG + Intergenic
1063787980 10:9407436-9407458 TACACACAGAGCGCCCCAGCGGG + Intergenic
1063787990 10:9407490-9407512 TAGACACAGAGCACCTCAGCGGG + Intergenic
1063788004 10:9407571-9407593 TAGACACAGAGCGCCTCAGCGGG + Intergenic
1063788009 10:9407598-9407620 TAGACACAGAGCGCCTCAGCGGG + Intergenic
1063788119 10:9408217-9408239 TAGATACAGAGCGGCTCAGCGGG + Intergenic
1065436392 10:25707543-25707565 TGACCACACAGCTCCCCAGCTGG + Intergenic
1066369064 10:34804547-34804569 TAGCCAGATTCCTGCCCAGCAGG - Intronic
1067272538 10:44804655-44804677 TAGCCAGAGAGGTGACCAGAAGG + Intergenic
1067553847 10:47254143-47254165 AAACCACAGGGCTGCCCTGCTGG + Intergenic
1068283514 10:54908063-54908085 TGGCCACAGAGGTTTCCAGCTGG - Intronic
1068938588 10:62658839-62658861 TGGCCACAGAGGTTTCCAGCTGG + Intronic
1069749770 10:70737609-70737631 AAGCCCCAGAGCTGCTCAGCAGG - Intronic
1070803222 10:79255483-79255505 TATACACAGAGGTGCCCAGACGG - Intronic
1073767488 10:106699165-106699187 AAGCCACAGCAGTGCCCAGCTGG - Intronic
1074529255 10:114285979-114286001 TGCCCGCAGAGCTGTCCAGCAGG - Exonic
1074895642 10:117775232-117775254 CAGCAACAGTGCTCCCCAGCTGG + Intergenic
1075203535 10:120426492-120426514 TACCCTCTGAGCTGCCGAGCTGG + Intergenic
1075831630 10:125417018-125417040 TAGGAACTGAGCTGCACAGCAGG + Intergenic
1076449322 10:130545308-130545330 AAGCCACACAGCTGGTCAGCAGG + Intergenic
1076851161 10:133093795-133093817 CAGCCACAGATCAGACCAGCAGG + Intronic
1079183965 11:18220302-18220324 TGGCCACAGAGGTTTCCAGCAGG - Intronic
1079503800 11:21132305-21132327 CAGCCACAGAGGTTTCCAGCTGG - Intronic
1080293505 11:30698512-30698534 TAGGAACTGAGCTGCACAGCAGG - Intergenic
1080706838 11:34702655-34702677 TGGCCACAGAGGTTTCCAGCTGG + Intergenic
1080872813 11:36251899-36251921 AAGACACAGAACTGCCCAGCAGG + Intergenic
1081043979 11:38249718-38249740 TGGCCACAGAGGTTTCCAGCTGG - Intergenic
1083733621 11:64667397-64667419 CAGCCACAGCTCTGCTCAGCGGG - Exonic
1083766233 11:64842872-64842894 CACCCACAGACCCGCCCAGCTGG - Intronic
1084401297 11:68944989-68945011 TAATCCCAGAGCTGCCCAGAGGG - Intergenic
1084501961 11:69540294-69540316 TTCCCACGGAGCTGCCCAGGAGG - Intergenic
1084727617 11:70952190-70952212 CAGCCACAGATCTGGCCAGACGG - Intronic
1085212039 11:74790482-74790504 CAGCCACAGAGGTTTCCAGCTGG - Intronic
1085610707 11:77945984-77946006 TAGCCACAGAGCTGCCCAGCAGG + Intronic
1085738015 11:79056388-79056410 GAGTCACAGAGCTTGCCAGCAGG + Intronic
1086415747 11:86587371-86587393 AAGCCACAAGGCTCCCCAGCTGG - Intronic
1087131525 11:94672949-94672971 CAGCCACAGAGGTTTCCAGCTGG + Intergenic
1087185974 11:95196036-95196058 TATCACCAGAGCTTCCCAGCTGG - Intronic
1087534268 11:99424355-99424377 CAGCCACAGAGGTTTCCAGCTGG - Intronic
1088933824 11:114378808-114378830 CAGGCACAGGGCTGACCAGCTGG + Intergenic
1089731619 11:120522919-120522941 CAGCCACGGAGCAGCACAGCTGG + Intronic
1090231867 11:125112853-125112875 TAGCCACAGAGCTTCTCACTGGG - Intergenic
1090380265 11:126321596-126321618 CACCCACAGAGCTGCCCTTCAGG + Intronic
1091818682 12:3458361-3458383 TGGGCACAGAGCTGTGCAGCAGG + Intronic
1092171080 12:6374508-6374530 GAGCCACAGCACTGCCCAGAAGG + Exonic
1093298185 12:17417118-17417140 TGGCCACAGAGGTTTCCAGCTGG + Intergenic
1094320897 12:29182146-29182168 AAGCCACAGACCTTCACAGCAGG + Intronic
1095049569 12:37544050-37544072 TAGCCTCAGGCCTGCCCAGACGG + Intergenic
1095603362 12:44038648-44038670 TGGCCACAGAGGTTTCCAGCTGG + Intronic
1095923576 12:47556068-47556090 TAGCCACTGAGAGGCCCAGCTGG - Intergenic
1097078434 12:56412220-56412242 TGGCCACAGAGGTTTCCAGCTGG - Intergenic
1098663134 12:73124770-73124792 TAGCCACAGAGGATCTCAGCGGG - Intergenic
1098767950 12:74514181-74514203 GGGCCACAGAGATTCCCAGCTGG - Intergenic
1099049608 12:77767340-77767362 TGGCCACAGAGGTTTCCAGCTGG - Intergenic
1099438345 12:82669813-82669835 TAGGAACAGGGCTGCACAGCAGG - Intergenic
1099713913 12:86265310-86265332 CAGCCACAGAGGTTCCCAGCTGG + Intronic
1102044120 12:109819101-109819123 TTGCCACAGAGCAGCAGAGCCGG - Intronic
1106636238 13:31531183-31531205 TAGGAACGGAGCTGCACAGCAGG - Intergenic
1106671096 13:31906271-31906293 TAGCCACTGAGTTGCGTAGCTGG - Intergenic
1107011792 13:35677527-35677549 ATGCCACAGAGCTGGCCAGCAGG - Intergenic
1108427538 13:50318964-50318986 TAGCAACAGGGCCGCACAGCAGG + Intronic
1110343068 13:74414778-74414800 CAGCCACAGAGGTTTCCAGCTGG + Intergenic
1110745116 13:79043445-79043467 TAGGAACAGGGCTGCACAGCAGG - Intergenic
1110778142 13:79433342-79433364 CAGCCACAGAGGTTTCCAGCTGG + Intergenic
1110980512 13:81890634-81890656 CAGCCACAGAGGTTCCTAGCTGG + Intergenic
1111034496 13:82655248-82655270 TGGCCACAGAGATTCCCAGCTGG - Intergenic
1111505834 13:89186436-89186458 CAGCCACAGAGGTTTCCAGCTGG + Intergenic
1112372361 13:98804935-98804957 TCGCCAAAGAGCTGTCCAGAGGG - Intronic
1112736850 13:102430521-102430543 TGGACACAGGGCTGCTCAGCTGG + Intergenic
1113123198 13:106946961-106946983 AGGCCACATAGCTGTCCAGCAGG - Intergenic
1113362385 13:109643403-109643425 CAACCACAGAGCTGCACATCTGG + Intergenic
1113503243 13:110794499-110794521 TGGCCACAGAGGTTTCCAGCTGG + Intergenic
1113572758 13:111370446-111370468 CAGCCACAGGGCTGCTCAGAGGG - Intergenic
1114377133 14:22159194-22159216 TAGACACGGATATGCCCAGCAGG + Intergenic
1115141487 14:30176541-30176563 CAGCCACAGTGCACCCCAGCCGG - Intronic
1116221551 14:42095123-42095145 TAGCCATAGAGGTTTCCAGCTGG - Intergenic
1116574533 14:46556191-46556213 TAGGAACTGAGCTGCACAGCAGG - Intergenic
1117491355 14:56250993-56251015 TGGCCTCAGAGCTCCCCAGGGGG - Intronic
1117615493 14:57529814-57529836 CAGACACAGAGGTGCCCAGCAGG - Intergenic
1117931016 14:60840015-60840037 CAGCCACAGAGGTTTCCAGCTGG + Intronic
1118472962 14:66092772-66092794 TGGCCACAGAGGTTTCCAGCTGG - Intergenic
1119012131 14:71004338-71004360 TAGGAACAGGGCTGCACAGCAGG + Intronic
1121644291 14:95507247-95507269 GAGACACAGCGCTGCCCAGTGGG - Intergenic
1121667553 14:95684789-95684811 CAGCCACACACCTGCCCATCAGG + Intergenic
1121898686 14:97672700-97672722 CAGACACACAGCTGCCCACCTGG - Intergenic
1122623949 14:103074872-103074894 CATCCCCAGAGCTTCCCAGCTGG + Intergenic
1122937726 14:104967686-104967708 TGGCCACAGAGCTGCGCAGTGGG + Intronic
1123018126 14:105385121-105385143 GAGGCCCAGAGCTGCCCAGCTGG - Intronic
1124240026 15:28020907-28020929 TAGCCAGTGACCTACCCAGCAGG - Intronic
1124500407 15:30223217-30223239 TAGCCGCAGTGCAGCCCCGCGGG + Intergenic
1124743166 15:32315449-32315471 TAGCCGCAGTGCAGCCCCGCGGG - Intergenic
1125718318 15:41832330-41832352 TGGCCACAGAGGTTTCCAGCTGG + Intronic
1125749778 15:42020467-42020489 CAGCCACAAAGCTGCCCACCTGG - Intronic
1126453566 15:48836371-48836393 TACCCACAGAGGTCCCTAGCAGG + Intronic
1127545445 15:59990434-59990456 AAGCCCAAGAGCTACCCAGCTGG + Intergenic
1127559337 15:60120236-60120258 AAGACACTGAGCTGCACAGCAGG + Intergenic
1127731169 15:61803283-61803305 TAGCCAGAGACCTCTCCAGCTGG - Intergenic
1127842911 15:62846088-62846110 GGGCCACAGAGCTGCCCAGTGGG + Intergenic
1128683906 15:69669800-69669822 CACACACAGAGCTGTCCAGCAGG - Intergenic
1128816498 15:70613454-70613476 TAGATACACAGCTGCCCTGCTGG + Intergenic
1129377590 15:75143960-75143982 TGGCCACAGAGGTTTCCAGCTGG - Intergenic
1129824456 15:78625445-78625467 GAGGCTCAGAGCTGCCCAGCTGG - Intronic
1129850324 15:78790021-78790043 GGGCCAAAGAGATGCCCAGCCGG - Intronic
1129895887 15:79105490-79105512 TAGAAACAGTGCTGCCCAGAGGG + Intergenic
1130261061 15:82354929-82354951 TTGCCACAGAGCAGCCCCGGCGG + Intergenic
1130280174 15:82514089-82514111 TTGCCACAGAGCAGCCCCGGCGG - Intergenic
1130471549 15:84230275-84230297 TTGCCACAGAGCAGCCCCGGCGG - Intergenic
1130479043 15:84344846-84344868 TTGCCACAGAGCAGCCCCGGCGG - Intergenic
1130492727 15:84443285-84443307 TTGCCACAGAGCAGCCCCGGCGG + Intergenic
1130593843 15:85234902-85234924 TTGCCACAGAGCAGCCCCGGCGG - Intergenic
1132017013 15:98326962-98326984 CAGACACGGAGCTGACCAGCTGG + Intergenic
1132563549 16:610063-610085 TAGCCTCATACCAGCCCAGCTGG + Intronic
1133155388 16:3871272-3871294 AAGTCACAGCGCTGCCGAGCTGG + Intronic
1133660340 16:7910337-7910359 TAGGAACTGAGCTGCACAGCAGG - Intergenic
1137459712 16:48649505-48649527 TAGGCACACAGTTGCTCAGCTGG + Intergenic
1137494859 16:48961840-48961862 CAGCCACAGCCCTGACCAGCTGG - Intergenic
1137546772 16:49410280-49410302 TAGTCTCACAGCTGGCCAGCTGG + Intergenic
1137698370 16:50478082-50478104 TGGCCACAGAGGTTTCCAGCCGG - Intergenic
1138474176 16:57260908-57260930 CAGCCACAGGGCTGCCTACCTGG + Intronic
1138998668 16:62481743-62481765 CAGCCACAGAGGTTTCCAGCTGG + Intergenic
1139015620 16:62685178-62685200 TGGCCACAGAGGTTTCCAGCTGG + Intergenic
1139099617 16:63749743-63749765 TAGCCATAAAGCTTCCCAACAGG - Intergenic
1139151100 16:64382326-64382348 CAGCCACAGAGGTTTCCAGCTGG + Intergenic
1139558773 16:67728824-67728846 AGGCCACAGAGCTGCCCATGGGG - Intronic
1139582593 16:67882243-67882265 TAGCCACTGAGTTGCTCAGTTGG - Exonic
1139946411 16:70645302-70645324 TACCCTAAGAGGTGCCCAGCAGG - Intronic
1141919879 16:87128532-87128554 TATGCACAGAGCCCCCCAGCAGG - Intronic
1141961124 16:87410048-87410070 CAGCCACAGAGATGCCCACTAGG + Exonic
1142273758 16:89105019-89105041 TAGCCACAGAGCCTCCCTGAGGG + Intronic
1143057301 17:4171878-4171900 CAGCCACACAGCTGCGCAGAGGG + Intronic
1143172555 17:4938576-4938598 TAGCCACGGCGCTGGTCAGCTGG + Exonic
1143181956 17:4988910-4988932 CAGCCCCAGAGCTGCCCCACTGG + Exonic
1145734074 17:27214162-27214184 AAGCCACAGCCCTGACCAGCTGG + Intergenic
1145871509 17:28277238-28277260 TGGCCACACTGCTGACCAGCTGG + Intergenic
1148033359 17:44638584-44638606 TAGGAACTGGGCTGCCCAGCAGG - Intergenic
1148563340 17:48618811-48618833 CAGCCGCAGAGGTGGCCAGCAGG + Intronic
1149794789 17:59509155-59509177 TAGGAACAGGGCTGCACAGCAGG + Intergenic
1151679137 17:75614651-75614673 CAGCCCCAACGCTGCCCAGCAGG + Intergenic
1152821779 17:82441225-82441247 CATCCACAGAGCTGCGCAGATGG - Exonic
1152856553 17:82667976-82667998 CAGCCACAGAGGTTTCCAGCCGG - Intronic
1152864053 17:82711747-82711769 TGGCCACAGAGGTTTCCAGCTGG - Intergenic
1152877614 17:82796035-82796057 TCCCCACTGAGCTGGCCAGCCGG + Intronic
1155401323 18:25442483-25442505 TAGCCAAGGGGCTGCTCAGCAGG - Intergenic
1155666770 18:28318322-28318344 TTGCTCCAGAGCTTCCCAGCAGG + Intergenic
1156468258 18:37361777-37361799 TACCCTCGGAGATGCCCAGCCGG + Intronic
1157304770 18:46508950-46508972 AAGGCACAGAGCCGCACAGCTGG + Intronic
1158139292 18:54240769-54240791 TAACCACAGAGGTTTCCAGCTGG - Intergenic
1158592662 18:58790667-58790689 AAGCCACAGATCTGCCAAGGCGG + Intergenic
1158648304 18:59266260-59266282 CACCCTCAGAGCTGCCCTGCGGG + Intergenic
1159161192 18:64645798-64645820 TGGCCACAGAGCTTTCCAGCTGG - Intergenic
1160621009 18:80170620-80170642 CAGACACAGCGCTGCCCAGTGGG + Exonic
1160782409 19:883708-883730 TAGACACAGACGTGCCCAGCGGG + Intronic
1160952447 19:1674247-1674269 TAGCCAACCAGCTGCCCAGGAGG + Intergenic
1161989906 19:7678745-7678767 TACCCACAGAGCAACCCAGATGG - Intronic
1164302146 19:23972062-23972084 TAGCCACAGATTTTTCCAGCGGG + Intergenic
1164691423 19:30213541-30213563 TGGCTACAGAGCTGCACACCTGG - Intergenic
1164859921 19:31554888-31554910 TAGCCTCTGAGCTGGTCAGCTGG + Intergenic
1165014829 19:32873117-32873139 CAGCCTCTGGGCTGCCCAGCTGG + Intergenic
1165088163 19:33365812-33365834 TAGCAACCGGGCTGCCCAGCAGG + Intergenic
1165320719 19:35083727-35083749 CAGACACAGAGCCGCACAGCTGG + Intergenic
1167136734 19:47620882-47620904 CAGCAGCAGAGCTCCCCAGCAGG + Intronic
1167876645 19:52419559-52419581 TGGTCACAGTGTTGCCCAGCTGG + Intergenic
1168598191 19:57695941-57695963 GAGCCACCGCGCCGCCCAGCTGG + Intronic
927524111 2:23721502-23721524 TAGGCACACAGCTGTTCAGCTGG - Intergenic
927920456 2:26968466-26968488 TAGCCACAGAGTTGGACAACTGG - Intergenic
928182556 2:29079868-29079890 TAGCCACAGAGGTTTCCAGCTGG - Intergenic
928305035 2:30162525-30162547 TAGCCTCAGAGCTACCCACAAGG + Intergenic
928470122 2:31567780-31567802 TGGCCACAGAGGTTTCCAGCTGG - Intronic
929014719 2:37482599-37482621 TGGCCACAGAGGTTTCCAGCTGG + Intergenic
930313491 2:49770996-49771018 TGGCCACAGAGGTTTCCAGCTGG - Intergenic
932054559 2:68431673-68431695 TGGCCACAGAGGTTTCCAGCAGG - Intergenic
932398100 2:71462031-71462053 CAGCCACAGAGGTTTCCAGCTGG - Intronic
932480585 2:72036767-72036789 CAGCAACAAAGCTTCCCAGCTGG - Intergenic
932803535 2:74764094-74764116 TGGTCCCAGAGCTACCCAGCAGG + Intergenic
932803568 2:74764255-74764277 TGGCCCCAGAGCTACCCAGCAGG + Intergenic
933455061 2:82509033-82509055 TGGCCACAGAGGTTTCCAGCTGG + Intergenic
933846667 2:86332322-86332344 GAGCCACACACATGCCCAGCTGG - Intronic
934131708 2:88954990-88955012 TGGCCACAGGGCTGCCTGGCAGG + Intergenic
934135976 2:88996813-88996835 TGGCCACAGGGCTGCCTGGCAGG + Intergenic
934151676 2:89153368-89153390 TGCCCACAGAGCTGCCTGGCAGG + Intergenic
934215583 2:90028538-90028560 TGCCCACAGAGCTGCCTGGCAGG - Intergenic
934220342 2:90076484-90076506 TGGCCACAGGGCTGCCTGGCAGG - Intergenic
934503923 2:94877614-94877636 AGCTCACAGAGCTGCCCAGCTGG - Intergenic
934657412 2:96123423-96123445 CAGCCACAGGGCTGCCCTGAGGG + Intergenic
934873232 2:97887319-97887341 CAGGCACAGAGATGCTCAGCTGG + Intronic
934876093 2:97922280-97922302 TAGGAACAGGGCTGCACAGCAGG - Intronic
935687363 2:105695927-105695949 TAGCCAATGAGGAGCCCAGCAGG - Intergenic
935788316 2:106568923-106568945 TAGCCACAGAGAGACTCAGCGGG - Intergenic
935800596 2:106691429-106691451 TACTCCCAGAGCTCCCCAGCGGG - Intergenic
936370098 2:111896742-111896764 TAGACACACAGCTTCCCAGTTGG - Intergenic
937163882 2:119794258-119794280 TGGCCACAGAGGTTTCCAGCTGG - Intronic
937287151 2:120760919-120760941 CAGTCACTGGGCTGCCCAGCAGG - Intronic
937356636 2:121201989-121202011 CTGACACAGAGCTGACCAGCCGG + Intergenic
937883254 2:126883828-126883850 TAGCCACATAGCTGCCCTCAGGG - Intergenic
937903413 2:127039861-127039883 GGGCCACAGAGCTGCACAGGAGG + Intergenic
938839336 2:135143998-135144020 CAGCCACAGAGGGCCCCAGCGGG - Intronic
940246542 2:151624458-151624480 TGGCCACAGAGCTTCTCAGTTGG - Intronic
940398518 2:153221537-153221559 CAGCCACAGAGGTTTCCAGCTGG - Intergenic
940422632 2:153498290-153498312 CAGCCACAGAGGTTTCCAGCTGG - Intergenic
940582425 2:155599840-155599862 TGGCCACAGAGGTTTCCAGCTGG - Intergenic
940694123 2:156958443-156958465 TGGCCACAGAGATTTCCAGCTGG - Intergenic
943129482 2:183838604-183838626 CAGCCACAGAGGTTTCCAGCTGG + Intergenic
943191187 2:184681206-184681228 TGGCCACAGAGGTTCCCAGATGG + Intronic
943578778 2:189660478-189660500 TTTCCACAGAGATGCCCAACTGG - Intergenic
944716229 2:202377528-202377550 CAGCCGCAGTGCTGACCAGCAGG - Exonic
945044341 2:205768717-205768739 TAGCCTCAAAGCGGCCCACCAGG - Intronic
945933540 2:215880600-215880622 CAGCCACAGAGCTGCCCATGGGG - Intergenic
946150404 2:217762389-217762411 TAGGAACTGAGCTGCACAGCAGG - Intergenic
946443984 2:219722422-219722444 GTGCCTCAGAGCTGCCCAGCGGG - Intergenic
947836369 2:233178884-233178906 GAGCCACAAAGGTGGCCAGCGGG - Intronic
948059593 2:235033092-235033114 GAGCGGCAGAGCTGCCCTGCTGG - Intronic
948552063 2:238779204-238779226 GAGCCACACAGCTGCATAGCTGG - Intergenic
948782056 2:240327873-240327895 TGGCCACAGAGGTTTCCAGCTGG + Intergenic
1169309489 20:4522632-4522654 TGGCCACAGAGGTTTCCAGCTGG + Intergenic
1169575164 20:6951501-6951523 CAGCAACACAGCTGCACAGCAGG - Intergenic
1169880659 20:10342533-10342555 TGGCCACAGATGTTCCCAGCTGG + Intergenic
1171024237 20:21614280-21614302 TGGTCACAGAGCTGGCCAGAGGG - Intergenic
1171484962 20:25479783-25479805 AAGCCACTGAGCTACCCAGGGGG + Intronic
1171544103 20:25987560-25987582 TAGCCTCAGGCCTGCCCAGACGG + Intergenic
1172387920 20:34547059-34547081 TAGCCAGGGAGCGGCCCAGATGG + Intronic
1172442866 20:34978125-34978147 TAGCCACAGAGATGCCCTTATGG + Intronic
1173390868 20:42631587-42631609 CAGCCTTAGAGCTCCCCAGCAGG - Intronic
1175280934 20:57803670-57803692 TACTCACAGAACTGCCCAGGGGG - Intergenic
1175807111 20:61835782-61835804 CAGCCACAGAGAGGCCCACCTGG - Intronic
1176142930 20:63553235-63553257 TGGCCTCAGAGCTCCCCTGCGGG + Intronic
1176409162 21:6438379-6438401 GAGGCTCAGGGCTGCCCAGCGGG - Intergenic
1177125795 21:17191913-17191935 TAGCCACAGAGCTTTCCTGCTGG + Intergenic
1177404476 21:20646811-20646833 TGGCCACAGAGGTTTCCAGCTGG + Intergenic
1179960005 21:44762802-44762824 CAGCCCCAGAGCAGCCCTGCAGG - Intergenic
1180030678 21:45204815-45204837 TAGCCACAGAGCAGCTCAGGTGG - Intronic
1180056787 21:45363005-45363027 CAGGAACAGAGCTGTCCAGCAGG - Intergenic
1180830535 22:18903753-18903775 TGGCGACAGTGTTGCCCAGCTGG + Intergenic
1181051977 22:20242196-20242218 TGGCCACAGCGCAGCCCTGCAGG + Exonic
1181064103 22:20297637-20297659 CAGCCACATAGGTGCCCAGGTGG + Intergenic
1181069143 22:20321531-20321553 TGGCGACAGTGTTGCCCAGCTGG - Intergenic
1181542501 22:23580718-23580740 GGTCCAGAGAGCTGCCCAGCAGG + Intergenic
1182295533 22:29309608-29309630 GAGCCAGAGCGCTGCCAAGCTGG - Intronic
1183701607 22:39454298-39454320 TAGGCACGGAGGTGCTCAGCAGG - Intergenic
1184234352 22:43175073-43175095 GAGCCCCTGGGCTGCCCAGCTGG + Intronic
1184654480 22:45934256-45934278 TAGCCTCAGAGAGGCCAAGCTGG - Intronic
1185244615 22:49766275-49766297 TGGCCACAGGGCTGGTCAGCGGG - Intergenic
1203280625 22_KI270734v1_random:129024-129046 TGGCGACAGTGTTGCCCAGCTGG + Intergenic
949962297 3:9322482-9322504 TAGGAACAGGGCTGCACAGCAGG + Intronic
950118035 3:10463973-10463995 TGGCCCCAGAGCTGCCCCACTGG + Intronic
950207764 3:11093532-11093554 TGGCCACAGAGGTTTCCAGCCGG + Intergenic
950480996 3:13243653-13243675 TAGTAACAGATCTGACCAGCAGG + Intergenic
950515301 3:13461020-13461042 TGGCCACAGTGCTGCCCACACGG + Intergenic
950704011 3:14768975-14768997 GAGCCACACAGCTGTCCTGCTGG - Intronic
953045183 3:39288590-39288612 AAGCCAAAGGGCTGCCCACCAGG - Intergenic
953393070 3:42545157-42545179 TTCTCACAGAGCTGTCCAGCAGG - Intergenic
954296303 3:49676245-49676267 GAGCCCCAGGGCTGCCCTGCCGG - Intronic
954773854 3:52998912-52998934 CACCCGCAGAGCTGCCCTGCCGG + Intronic
955105101 3:55890495-55890517 TAGACACAGAGCTACTCAGCTGG + Intronic
955111731 3:55957499-55957521 TGGCCACAGAGGTTTCCAGCTGG - Intronic
955357879 3:58246551-58246573 TTCCCACAGTGCTGCCCAGGTGG + Intronic
956522486 3:70121247-70121269 TAGGAACAGGGCTGCACAGCAGG - Intergenic
956870600 3:73413618-73413640 TAACCACCGAGCAGCACAGCCGG + Intronic
957665023 3:83216923-83216945 CAGCCACAGAGGTTTCCAGCTGG - Intergenic
961020147 3:123498436-123498458 TTGGAACAGAGCTGCACAGCAGG + Intronic
961942825 3:130655763-130655785 TGGCCACAGAGGTTTCCAGCTGG - Intronic
962842596 3:139249428-139249450 TAGGCACTGGGCTGCACAGCAGG + Intronic
963375397 3:144457624-144457646 TAGCTACAGAGCTCCCCATGGGG - Intergenic
964215405 3:154274794-154274816 TGGACACAGAGCTGCACAGAAGG + Exonic
965056286 3:163721538-163721560 CAGCCACAGAGGTTTCCAGCTGG - Intergenic
965061186 3:163787631-163787653 CAGCCACAGAGGTTTCCAGCTGG - Intergenic
968649553 4:1755078-1755100 TGGACCCAGAGCTGCCCAGGAGG - Intergenic
968695719 4:2025313-2025335 TGGCCACAGAGGTTTCCAGCTGG + Intronic
969415371 4:7054247-7054269 CAGCCACAGAGATGTCCAGCGGG - Exonic
969570442 4:8005147-8005169 AAGCCAAAGAGGTGCCCGGCGGG + Intronic
970582289 4:17484484-17484506 TAGCTAGAGAGCTGCGCAGCTGG - Intronic
971834582 4:31747606-31747628 TCGCCACAGAGGTTTCCAGCTGG - Intergenic
972368509 4:38398261-38398283 TAGAAAGAGAGCAGCCCAGCTGG - Intergenic
972660485 4:41111228-41111250 TAGGAACAGGGCTGCACAGCAGG - Intronic
975254205 4:72215241-72215263 TGGCCACAGAGGTTGCCAGCTGG - Intergenic
975416667 4:74112688-74112710 CAGCCACAGAGATTTCCAGCTGG + Intergenic
975498465 4:75058852-75058874 CAGCCACAGAGGTTTCCAGCTGG + Intergenic
975663310 4:76708711-76708733 AAGTCACAGAGCTGCTCAGTGGG + Intronic
978061669 4:104346179-104346201 CAGCCACAGAGGTTTCCAGCTGG + Intergenic
978149204 4:105414327-105414349 TGGCCACAGAGGTTTCCAGCTGG - Intronic
979489512 4:121309035-121309057 TAGGAACCGAGCTGCACAGCAGG + Intergenic
979730741 4:124019960-124019982 TCCCCACAGAGCTCCCCGGCAGG + Intergenic
979946951 4:126843939-126843961 CAGCCACAGAGGTTTCCAGCTGG + Intergenic
980582852 4:134775138-134775160 TGGCCACAGAGGTTTCCAGCTGG + Intergenic
981452319 4:144912556-144912578 GGAACACAGAGCTGCCCAGCTGG - Intergenic
982390483 4:154858032-154858054 TAGGCCCAGAGCTTCCCAGCTGG - Intergenic
983352064 4:166602430-166602452 CAGCCACAGAGGTCTCCAGCTGG + Intergenic
988488044 5:31683099-31683121 GAGCCACAGAGCTGCCAAGGAGG - Intronic
989512396 5:42303408-42303430 TAGGTACAGAGCTGCACAGCAGG + Intergenic
989821842 5:45801579-45801601 TGGCCACAGAGGTTTCCAGCTGG + Intergenic
990853062 5:60228887-60228909 CAGCCACAAAACTACCCAGCTGG + Intronic
991286501 5:64982839-64982861 TAGGAACTGAGCCGCCCAGCAGG + Intronic
992800138 5:80288530-80288552 TGGCCACACTGCTGACCAGCTGG - Intergenic
993133429 5:83927449-83927471 TACCCAGTAAGCTGCCCAGCGGG - Intergenic
993703206 5:91142865-91142887 TGGCCACAGAGATTTCCAGCTGG - Intronic
994451948 5:99955022-99955044 TGGCCACAGAGGTTTCCAGCTGG - Intergenic
994873954 5:105392001-105392023 CAGCCACAGAGGTTTCCAGCTGG - Intergenic
995173800 5:109149866-109149888 TAGAAACTGAGCTGCCCAGCAGG + Intronic
995339712 5:111044388-111044410 TAGGAACTGAGCTGCACAGCAGG - Intergenic
995742574 5:115369773-115369795 TGGCCACAGAGGTTTCCAGCTGG + Intergenic
996407431 5:123119462-123119484 AAGCCACAGAGCCGCCCTGAAGG - Intronic
996644400 5:125796589-125796611 TTGCCACAGAGCTGAGCAGGTGG + Intergenic
997081190 5:130740256-130740278 CAGCCACAGCTCTGACCAGCTGG + Intergenic
997221949 5:132176547-132176569 TAGCAACCGGGCTGCACAGCAGG + Intergenic
997634039 5:135391382-135391404 CAGCCCCAGACATGCCCAGCAGG - Intronic
999871738 5:155758526-155758548 TAGCAACTGGGCTGCACAGCAGG + Intergenic
999887015 5:155935729-155935751 TGGCCACAGAGGTTTCCAGCTGG - Intronic
1000266426 5:159642005-159642027 TGGCCACAGAGGTTTCCAGCTGG + Intergenic
1000610221 5:163365485-163365507 CAGCCACAGAGGTCTCCAGCTGG + Intergenic
1001225429 5:169940807-169940829 TAGGAACCGAGCTGCACAGCAGG - Intronic
1001419694 5:171577298-171577320 GAGCCACAGAGCTGCCCAATGGG + Intergenic
1001586380 5:172835814-172835836 TAGCCTCAGGGCTGCCCGGCAGG - Intronic
1001910832 5:175516140-175516162 TAGGAATAGGGCTGCCCAGCAGG - Intronic
1002280011 5:178124410-178124432 TGGCCCCAGAGCCACCCAGCCGG - Exonic
1002554789 5:180027855-180027877 CAGCCACAGAGCCGGGCAGCCGG - Intronic
1002593419 5:180306499-180306521 GGGCCACAGGGCTGCCCAGAGGG - Intronic
1003077797 6:2998562-2998584 TTGCCCCTGAGCTCCCCAGCAGG - Intronic
1003085361 6:3056057-3056079 TTGCCCCTGAGCTCCCCAGCAGG + Intergenic
1005249180 6:23924864-23924886 TACCCACAGAACTGTCCTGCAGG + Intergenic
1005782232 6:29203964-29203986 TAGCCACAGAGGTTTTCAGCTGG - Intergenic
1005989436 6:30893777-30893799 TAGCCAGAGAGGAGCCCAGCAGG - Intronic
1006037943 6:31228778-31228800 GAACCACAGAGCTGTCCAGAGGG - Intergenic
1006408002 6:33856311-33856333 TGGCTTCAGGGCTGCCCAGCTGG + Intergenic
1006463672 6:34178356-34178378 CAGCCACAGAGGTTTCCAGCTGG - Intergenic
1006517337 6:34552281-34552303 TCCCCACAGCCCTGCCCAGCAGG + Intronic
1008523815 6:52387743-52387765 TAGGAACTGAGCTGCACAGCAGG + Intronic
1009241571 6:61192550-61192572 TAGCCACAGAGGTTTCCAGCTGG - Intergenic
1009588786 6:65638874-65638896 TGGCCACAGAGGTTTCCAGCTGG + Intronic
1011284016 6:85705266-85705288 CAGCCACAGAGGTTTCCAGCTGG - Intergenic
1011285120 6:85715023-85715045 CAGCCACAGAGATTTCCAGCTGG - Intergenic
1011659781 6:89584313-89584335 AAGCCACTGAGCTGCCCACTTGG + Intronic
1012903699 6:105038492-105038514 CAGACACAGACCTGCCCAGCAGG - Intronic
1013017157 6:106170193-106170215 GAGGCACGCAGCTGCCCAGCAGG - Intergenic
1013104355 6:107014060-107014082 TAGGAACAGAGCTGCACAGCAGG - Intergenic
1013307338 6:108861735-108861757 GAGCCACCGAGCTGCCGAACTGG - Intronic
1013438443 6:110137939-110137961 TGGCCACAGAGGTTTCCAGCTGG - Intronic
1013725407 6:113089263-113089285 TAGGAACTGGGCTGCCCAGCAGG - Intergenic
1014018750 6:116564903-116564925 TGGCCACAGAGGTTTCCAGCTGG - Intergenic
1014360896 6:120472021-120472043 CAGCCACAGAGATTTCCAGCTGG + Intergenic
1015066800 6:129039873-129039895 TAGGAACAGGGCTGCACAGCAGG - Intronic
1015096060 6:129416649-129416671 TGGCCACAGAGGTTTCCAGCTGG - Intronic
1016163146 6:140907229-140907251 CAGCCACAGAGGTTTCCAGCTGG - Intergenic
1017100851 6:150848572-150848594 TAGTCTCAGAGCAGCCCAGGGGG + Intergenic
1018431553 6:163726477-163726499 TAGCCCCAGAGCTGCCAGGAGGG + Intergenic
1018645468 6:165943910-165943932 AAGGCACAGAGCTGTGCAGCCGG - Intronic
1019108023 6:169684769-169684791 TAGGCACAAGGCTGCTCAGCTGG - Intronic
1019222831 6:170487929-170487951 TAGCCACAGATGTGGCCAGTTGG - Intergenic
1019658947 7:2213098-2213120 CAGCCACAGAGATGCCTGGCTGG + Intronic
1020763791 7:12296605-12296627 TGGCCACAGAGATTTCCAGCTGG + Intergenic
1021097404 7:16548795-16548817 TGGCCACAGAGGTTTCCAGCTGG + Intronic
1021116853 7:16754074-16754096 AAGCCAAAGAGCTCCCAAGCAGG - Intronic
1022258049 7:28678919-28678941 TAGACACAGAGCTCTACAGCTGG + Intronic
1022518104 7:30988443-30988465 AAGCAACAGAGCAGCCCATCAGG + Intronic
1022838102 7:34136104-34136126 TAGCCACAGGGATGCCAAACTGG + Intronic
1025115749 7:56256458-56256480 CAGCCACAGAGGTTTCCAGCTGG + Intergenic
1025295482 7:57772643-57772665 TAGCCTCAGGCCTGCCCAGAAGG + Intergenic
1025842399 7:65163070-65163092 TAGCCACAGAGCTGCCCAGCAGG - Intergenic
1025880646 7:65532899-65532921 TAGCCACAGAGCTGCCCAGCAGG + Intergenic
1025892791 7:65669705-65669727 TAGCCACAGAGCTGCCCAGCAGG - Intergenic
1027350846 7:77309429-77309451 TGGGCACAGAGCTGCTCAGCTGG + Intronic
1027687236 7:81293869-81293891 CAGCCACAGAGGTTTCCAGCTGG - Intergenic
1028136920 7:87231542-87231564 TGGCCACAGAGGTTTCCAGCTGG + Intergenic
1028750188 7:94374346-94374368 GTGCCACATAGCTGACCAGCTGG + Intergenic
1028999515 7:97138816-97138838 TGCCCACAGAGGTCCCCAGCTGG - Intronic
1029220880 7:98989330-98989352 CAGCCACAGAGCTGGCGTGCTGG + Intronic
1030131697 7:106207087-106207109 TTGCCACCCAGCTCCCCAGCAGG - Intergenic
1030137478 7:106269429-106269451 TAGACACAGAACTGCGCAGCAGG + Intronic
1030710085 7:112739659-112739681 TAGGCACACAGCTGGTCAGCTGG + Intergenic
1031347296 7:120684664-120684686 TAGGAACAAAGCTGCACAGCAGG + Intronic
1032456685 7:132078478-132078500 TAGCCACAGTTCTCCTCAGCAGG - Intergenic
1032591048 7:133192934-133192956 CAGCCACAGAGGTTTCCAGCTGG - Intergenic
1033239568 7:139665968-139665990 TAAACACTGAGCTGCCCAGATGG + Intronic
1033440728 7:141375944-141375966 TAGCCCCAGAGCTGGCAACCTGG + Intronic
1035277912 7:157758860-157758882 TAGCCACAGAGCAGCCACGCAGG - Intronic
1035284518 7:157797639-157797661 TGGCCAGAGAGCTGCCCTGCAGG + Intronic
1036660806 8:10707241-10707263 CAGCCACATGGCTGCCAAGCAGG - Intronic
1036915299 8:12798919-12798941 TGGCCACAGAGGTTTCCAGCTGG - Intergenic
1037190334 8:16117097-16117119 TAGAAACAAAGCTGCACAGCAGG + Intronic
1037333234 8:17765264-17765286 TAGGAACAGGGCTGCACAGCAGG - Intronic
1040409894 8:47143533-47143555 TAGCCACGTAGCTGGCCTGCAGG + Intergenic
1041205349 8:55493952-55493974 TAGCCACAGAGATTTCCAGCTGG - Intronic
1041351189 8:56949505-56949527 TAGGCACTGGGCTGCACAGCAGG + Intergenic
1041405730 8:57497333-57497355 GAGCCACAGAGCTTTCCTGCAGG + Intergenic
1042336892 8:67639242-67639264 TGGCCACAGAGGTTTCCAGCTGG - Intronic
1042439530 8:68810059-68810081 TGGCCACAGAGGTTTCCAGCTGG - Intronic
1043024952 8:75054995-75055017 TAGAAACAGGGCTGCACAGCAGG + Intergenic
1043180431 8:77081968-77081990 CAGCCACACAGCTTTCCAGCTGG - Intergenic
1044614037 8:94120862-94120884 CAGCCACAGAGGTTTCCAGCTGG + Intergenic
1046503601 8:115110608-115110630 CAGCCACAGAGGTTTCCAGCCGG - Intergenic
1046690908 8:117283076-117283098 CAGCCACGGAGGTCCCCAGCTGG + Intergenic
1048291318 8:133183733-133183755 CAGCCACATAGATCCCCAGCTGG - Intergenic
1048335397 8:133498697-133498719 CAGCCACAGAGGAGCCCGGCAGG - Intronic
1048469917 8:134696623-134696645 CAGCCACAGCCCTGCCCAGGTGG + Intronic
1048481058 8:134793678-134793700 TAGGCACTGGGCTGCACAGCAGG - Intergenic
1049344955 8:142133941-142133963 CAGCCAGGGAGCTGCCCAGAGGG + Intergenic
1049349012 8:142154150-142154172 TTGCCACTGCGCTGCCCAGAGGG - Intergenic
1049436123 8:142587042-142587064 TAGCCACACAGGTGCCCCACAGG - Intergenic
1049473380 8:142786071-142786093 TAGGCTCAGAGCAGCCAAGCTGG - Intronic
1049502709 8:142975969-142975991 TAGGCACAGAGCGAGCCAGCAGG + Intergenic
1050589502 9:7147855-7147877 CAGCCACAGAGGTTTCCAGCTGG - Intergenic
1050942139 9:11472628-11472650 CAGCCACAGAGGTTTCCAGCTGG + Intergenic
1052158495 9:25226036-25226058 TAGCCACAGAGGTTTCCAGCTGG - Intergenic
1052466647 9:28838702-28838724 TGGCCACAGAGATTTCCAGCTGG - Intergenic
1052798508 9:32946256-32946278 TGGCCAGAGAGGTGCCCAGGAGG - Intergenic
1053028956 9:34758142-34758164 TAGGCACAAGGCTGCTCAGCTGG + Intergenic
1053602449 9:39624321-39624343 CAGCCACAGAGATTTCCAGCTGG + Intergenic
1053860096 9:42378047-42378069 CAGCCACAGAGATTTCCAGCTGG + Intergenic
1054251087 9:62718114-62718136 CAGCCACAGAGATTTCCAGCTGG - Intergenic
1054565198 9:66752627-66752649 CAGCCACAGAGATTTCCAGCTGG - Intergenic
1055645598 9:78358618-78358640 TGGCCACAGAGGTTACCAGCTGG + Intergenic
1055846410 9:80568917-80568939 TAGGAACAGGGCTGCCCAGCAGG - Intergenic
1056306770 9:85298458-85298480 TAGGAACCGAGCTGCACAGCAGG - Intergenic
1056763399 9:89430024-89430046 CACCCACAGAGCTGCCCGTCAGG - Intronic
1056787502 9:89603788-89603810 CGGCCACGGAGCTGCCCGGCCGG - Intergenic
1057310911 9:93942698-93942720 AACCCGCTGAGCTGCCCAGCGGG + Intergenic
1057510677 9:95677581-95677603 TGGCCACAGAGATTTCCAGCTGG - Intergenic
1058545612 9:106058455-106058477 TGGCCACAGACGTGTCCAGCTGG - Intergenic
1059466050 9:114469527-114469549 TAGCCACAGAGCTGCCTCCAGGG - Intronic
1059996240 9:119913147-119913169 TAGGAACTGAGCTGCACAGCAGG - Intergenic
1060104162 9:120863135-120863157 CAGCCTCAGAGGAGCCCAGCCGG - Intronic
1060472720 9:123961916-123961938 TAGCCAGAGAGCGGCTCAGCTGG + Intergenic
1061650263 9:132042128-132042150 TGGCCACTCAGCAGCCCAGCTGG - Intronic
1061897300 9:133655123-133655145 AAGCCACAGAACTGCCCACGGGG - Intronic
1062071112 9:134555498-134555520 GAGCCACAGAGCTGGGCAGAGGG + Intergenic
1062117275 9:134816290-134816312 TACCCACAGCTCTGCCTAGCAGG + Intronic
1062476733 9:136731711-136731733 TAGCAGCAGAGCAGCCTAGCAGG + Intergenic
1062724848 9:138066161-138066183 TACCCTCAGAGCTCCCCTGCAGG - Intronic
1203745296 Un_GL000218v1:37969-37991 AGCTCACAGAGCTGCCCAGCTGG + Intergenic
1203564813 Un_KI270744v1:81515-81537 AGCTCACAGAGCTGCCCAGCTGG - Intergenic
1185838471 X:3367409-3367431 TAGCCAGAGAGGTGCCCAGGAGG - Intergenic
1189344229 X:40228376-40228398 TAGGAACTGGGCTGCCCAGCAGG - Intergenic
1189602070 X:42637708-42637730 AAGCCATGGAGCTGCCAAGCAGG - Intergenic
1189843325 X:45105794-45105816 TAGGAACCGAGCTGCACAGCAGG + Intronic
1193753711 X:85379817-85379839 TAGCTACAAGGCTGCCCAGCAGG + Intergenic
1194212351 X:91083550-91083572 TAGCCACAGAGGTTTCCAGCTGG + Intergenic
1195880155 X:109585501-109585523 TGGCCACAGAGGTTTCCAGCTGG - Intergenic
1197342368 X:125288680-125288702 TGGCCACAGAGGTTTCCAGCTGG + Intergenic
1197798033 X:130318780-130318802 TACCAACAGAGTTGTCCAGCAGG - Intergenic
1198313020 X:135438461-135438483 GAGCCACAGCCCAGCCCAGCTGG + Intergenic
1198978235 X:142361834-142361856 TATCCAAAGAGCCGGCCAGCAGG + Intergenic
1199676211 X:150191272-150191294 TAGCCCCTGAGCTGCCCACAGGG + Intergenic
1201158617 Y:11152988-11153010 AGCTCACAGAGCTGCCCAGCTGG + Intergenic
1201237289 Y:11923487-11923509 TAGCCAGAGAGGTGCCCAGGAGG + Intergenic
1201720442 Y:17090415-17090437 TGGCCACAGAGGTTTCCAGCTGG + Intergenic