ID: 1085610709

View in Genome Browser
Species Human (GRCh38)
Location 11:77945993-77946015
Sequence AGCTGCCCAGCAGGCCACCG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 335
Summary {0: 1, 1: 0, 2: 0, 3: 31, 4: 303}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085610704_1085610709 -1 Left 1085610704 11:77945971-77945993 CCATTTCCCTACATAGCCACAGA 0: 1
1: 1
2: 6
3: 16
4: 266
Right 1085610709 11:77945993-77946015 AGCTGCCCAGCAGGCCACCGCGG 0: 1
1: 0
2: 0
3: 31
4: 303
1085610699_1085610709 28 Left 1085610699 11:77945942-77945964 CCAAAGCAACAGCCAACCAGGCA 0: 4
1: 0
2: 1
3: 16
4: 202
Right 1085610709 11:77945993-77946015 AGCTGCCCAGCAGGCCACCGCGG 0: 1
1: 0
2: 0
3: 31
4: 303
1085610701_1085610709 12 Left 1085610701 11:77945958-77945980 CCAGGCAGTAGCCCCATTTCCCT 0: 1
1: 3
2: 1
3: 15
4: 201
Right 1085610709 11:77945993-77946015 AGCTGCCCAGCAGGCCACCGCGG 0: 1
1: 0
2: 0
3: 31
4: 303
1085610700_1085610709 16 Left 1085610700 11:77945954-77945976 CCAACCAGGCAGTAGCCCCATTT 0: 1
1: 3
2: 0
3: 8
4: 120
Right 1085610709 11:77945993-77946015 AGCTGCCCAGCAGGCCACCGCGG 0: 1
1: 0
2: 0
3: 31
4: 303
1085610706_1085610709 -8 Left 1085610706 11:77945978-77946000 CCTACATAGCCACAGAGCTGCCC 0: 1
1: 3
2: 0
3: 25
4: 228
Right 1085610709 11:77945993-77946015 AGCTGCCCAGCAGGCCACCGCGG 0: 1
1: 0
2: 0
3: 31
4: 303
1085610705_1085610709 -7 Left 1085610705 11:77945977-77945999 CCCTACATAGCCACAGAGCTGCC 0: 1
1: 3
2: 0
3: 17
4: 186
Right 1085610709 11:77945993-77946015 AGCTGCCCAGCAGGCCACCGCGG 0: 1
1: 0
2: 0
3: 31
4: 303
1085610702_1085610709 1 Left 1085610702 11:77945969-77945991 CCCCATTTCCCTACATAGCCACA 0: 1
1: 0
2: 3
3: 27
4: 325
Right 1085610709 11:77945993-77946015 AGCTGCCCAGCAGGCCACCGCGG 0: 1
1: 0
2: 0
3: 31
4: 303
1085610703_1085610709 0 Left 1085610703 11:77945970-77945992 CCCATTTCCCTACATAGCCACAG 0: 1
1: 0
2: 5
3: 22
4: 246
Right 1085610709 11:77945993-77946015 AGCTGCCCAGCAGGCCACCGCGG 0: 1
1: 0
2: 0
3: 31
4: 303
1085610698_1085610709 29 Left 1085610698 11:77945941-77945963 CCCAAAGCAACAGCCAACCAGGC 0: 4
1: 0
2: 0
3: 13
4: 157
Right 1085610709 11:77945993-77946015 AGCTGCCCAGCAGGCCACCGCGG 0: 1
1: 0
2: 0
3: 31
4: 303

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085610709 Original CRISPR AGCTGCCCAGCAGGCCACCG CGG Intronic
900188830 1:1344895-1344917 AGCTGCCGGCCAGGCCACCTGGG - Intronic
900301212 1:1978383-1978405 CGCTGCCCTGCTGCCCACCGAGG - Intronic
900384687 1:2404975-2404997 GCCTGCCCAGCAGGCCCCCCAGG + Exonic
900881037 1:5381459-5381481 AGCTGCCCAGGAGGCTCCTGGGG - Intergenic
900981873 1:6050316-6050338 AGCTGCAGTGCAGGCCACCTGGG + Intronic
902880818 1:19370724-19370746 AGCTGGCAAGCATGCCTCCGAGG + Intronic
902993049 1:20203095-20203117 ACCTACCCATCAGGCCACCTTGG + Intergenic
904008197 1:27374715-27374737 AGCTGCCCAGGTGGGCACCTAGG - Exonic
905679130 1:39854405-39854427 AGCTGCTCAGGAGGCCATCAAGG + Intronic
905785916 1:40757462-40757484 AGCTGTCCATCAGGCCCCCTGGG + Intronic
905888204 1:41502995-41503017 CGCTGGCCAGCAGGCCTCCCAGG - Intergenic
906129908 1:43449914-43449936 GGCTGACCAGCAAGCCAGCGAGG + Intronic
907320574 1:53599689-53599711 AGCTACCCAGCAGGGCTCTGTGG + Intronic
907373054 1:54015432-54015454 AGCTGCACAGCAGGGCACCCAGG - Intronic
907467920 1:54651710-54651732 GGCTGCCCAGAAGGCCAGTGGGG + Intronic
909375720 1:74939520-74939542 AGCTACCCAGAAGGCCAAGGTGG + Intergenic
915227161 1:154419665-154419687 AGCTGCCTGGCCTGCCACCGAGG - Intronic
915724565 1:158008285-158008307 GGCTGCCCAGCAGGCCCCAGGGG + Intronic
920584470 1:207144328-207144350 AGCTGTCCAGAAGGCCCCCATGG - Intronic
921592856 1:217024069-217024091 AGCTGTACAGCAGGGCACTGTGG + Intronic
923049699 1:230382150-230382172 AGGAGCCCAGCAGGCAACCATGG + Intronic
923110141 1:230883772-230883794 AGGTGCCCAGCAGAACACAGAGG - Intergenic
924152168 1:241140514-241140536 AGCTACTCAGCAGGCCAAGGCGG - Intronic
924709169 1:246519674-246519696 AGCTGTCCAGCAGGTCTCTGAGG - Intergenic
1063300500 10:4845534-4845556 AGCTGCCCTGCAGGGCACAGAGG - Intronic
1063665655 10:8058768-8058790 AGCCGCCCAGCAGGCTGCTGGGG - Exonic
1064770710 10:18719547-18719569 AGCTACTCAGGAGGCCACAGTGG - Intergenic
1066367460 10:34791363-34791385 AGCTCCCCAGCATCCCACTGTGG + Intronic
1067398056 10:45942623-45942645 AGGTGCCCAGAAGCCCACCCTGG - Intergenic
1067866374 10:49911712-49911734 AGGTGCCCAGAAGCCCACCCTGG - Intronic
1069744067 10:70703745-70703767 AGCTTCCCAGCTGCCCACCATGG - Intronic
1070392208 10:75981325-75981347 AGGTGCCATGCAGGGCACCGTGG + Intronic
1070827011 10:79397218-79397240 AGCTGCCAGGAAGGCCACTGAGG - Intronic
1071497574 10:86179385-86179407 AGCTGCCTGGCACGCCATCGGGG - Intronic
1072985938 10:100140212-100140234 AGCAGCCCAGCTGGCTACCCTGG + Intergenic
1073479469 10:103777417-103777439 AGCTGCCCAGCTGGCGTGCGTGG + Intronic
1075521514 10:123146422-123146444 AGCGGCCCGGGAGGCCAGCGAGG - Intergenic
1076433688 10:130425170-130425192 ACCTGCCCTGCAGACCACCCAGG - Intergenic
1077374193 11:2197971-2197993 AGCTGTGCAGGAGGCCGCCGAGG - Intergenic
1077672101 11:4166494-4166516 AGCGGTCCAGCAGGCAACCAGGG + Intergenic
1078987492 11:16609968-16609990 AGCTGCCCAGCAAGGTACCAGGG - Intronic
1080645276 11:34183524-34183546 AGCCCGGCAGCAGGCCACCGTGG - Intronic
1083160712 11:60852594-60852616 AGCTGCCCAGCAGCCAGCCGAGG + Exonic
1083180697 11:60982859-60982881 CGCTGCCCAGCAGGGCATGGCGG + Intronic
1083421216 11:62554352-62554374 AGCTGCTGAGCAGGCCAGGGAGG - Intronic
1083674390 11:64317356-64317378 CTCCGCCCTGCAGGCCACCGAGG - Exonic
1083861389 11:65422206-65422228 GGCGGCCCAGAAGGCCAGCGGGG - Intergenic
1083897157 11:65625581-65625603 AGCTGCCCAGCAGCCCAAGCTGG - Intronic
1084041244 11:66543875-66543897 AGCGGCCCAGCAGGCGGCAGTGG + Exonic
1084163732 11:67365375-67365397 TGCTGCCCAGCAGGCCCTGGAGG + Exonic
1084419428 11:69052965-69052987 TGCTCCCCAGCAGGCCAACAGGG - Intronic
1084536846 11:69762419-69762441 AGGTGCCCAGCAGCACACTGGGG + Intergenic
1085056592 11:73407982-73408004 AGCTGCCCAGGAGGCTGACGCGG - Intronic
1085507719 11:77069654-77069676 AGCTGCCCAGGAGGCTGCTGGGG - Intronic
1085610709 11:77945993-77946015 AGCTGCCCAGCAGGCCACCGCGG + Intronic
1085634514 11:78148027-78148049 AGCTACCCAGCAGGCCAGCCAGG - Intergenic
1088638006 11:111843030-111843052 AGCTGCCCGGGAGGCTACGGTGG - Intronic
1088749288 11:112830416-112830438 AGCTGCCCAACACTCCACCCAGG - Intergenic
1089376653 11:117999563-117999585 AGCTGCCCAGGAGACCACCTGGG - Exonic
1089753151 11:120666194-120666216 ACCTGCCTTGCAGGTCACCGGGG - Intronic
1092103103 12:5902475-5902497 AGCTACCCAGGAGGCCAAGGCGG + Intronic
1093034539 12:14320379-14320401 GGCTGCCCAGGAGCCCACGGAGG - Intergenic
1096964865 12:55617901-55617923 AACTCCCCAGCTGGCCACTGAGG + Intergenic
1099876990 12:88419838-88419860 AGCTGGGCAGCAGGACACCTAGG + Intergenic
1102958548 12:117075775-117075797 AGCTACCCAGGAGGCCAAGGTGG - Intronic
1102986840 12:117285215-117285237 AGCTGACCAGCTGGGCACTGGGG - Intronic
1104666396 12:130650162-130650184 AGCTGCCCACCAAGCCCCCTTGG - Intronic
1105269453 13:18857652-18857674 AGCTGCTCAGGAGGCCACGGTGG - Intergenic
1105303396 13:19153929-19153951 AGGAACCCAGGAGGCCACCGGGG + Intergenic
1105898420 13:24737347-24737369 AGGTGCCCAGCAGCCCCACGTGG - Intergenic
1106449808 13:29870154-29870176 GGCTCCCCAGCAGGCCTCTGGGG - Intergenic
1107372532 13:39768282-39768304 AGCTGCCCAGCTGGTCCCCAGGG - Intronic
1109104884 13:58238824-58238846 AGCTGCGCAGCAGCCCATCTGGG + Intergenic
1110611511 13:77493043-77493065 AGCTGCTCAGCAGGTCTCCATGG + Intergenic
1113666548 13:112145670-112145692 AGCTGCTGAGCAGGCCGCCCCGG + Intergenic
1113960235 13:114122123-114122145 GGCTGCGCAGCCGGCCACGGCGG + Intronic
1115261294 14:31457119-31457141 CGCAGCCAGGCAGGCCACCGCGG + Intronic
1116030668 14:39567721-39567743 AGCTGCCCAGGAGGCTAAGGTGG - Intergenic
1117727301 14:58687346-58687368 GGCTGCACAGGAGCCCACCGCGG + Intergenic
1117862812 14:60110441-60110463 CTCTGCCCACCAGGCCACTGGGG - Intronic
1119335941 14:73833731-73833753 AGCTGCCCAGGAAGCCAGGGAGG + Intergenic
1121104574 14:91272016-91272038 AGCTGCCCTGCAGGCTGCCCTGG + Exonic
1121168730 14:91835968-91835990 AGCCGCCCACCTGGCCAGCGGGG + Intronic
1121543784 14:94748668-94748690 AGCTACTCAGGAGGCCAACGTGG + Intergenic
1122255600 14:100473478-100473500 TGCTGCCCAGCAGGCTCCCCAGG - Intronic
1122399934 14:101460952-101460974 TGCTGCCGAGTAGGCCACTGGGG - Intergenic
1123990319 15:25678554-25678576 TGCTGCACAGCTGGCCACCATGG - Exonic
1124061547 15:26298139-26298161 GGCTGCGCAGCAGCCCACTGTGG + Intergenic
1126667349 15:51087295-51087317 ATCTGCCCAGCAGGCCTCTGTGG - Intronic
1127271829 15:57408617-57408639 AGCTGCTCAGGAGGCCAAGGTGG - Intronic
1127365350 15:58284316-58284338 TACAGCCCAGCAGGCCACAGGGG + Intronic
1127960711 15:63888333-63888355 ATCTGCCCAGCAGGCCTATGTGG + Intergenic
1128322654 15:66703849-66703871 AGCCGCCCGGCACGCCGCCGCGG - Exonic
1129069001 15:72935749-72935771 AGGTGCCCAGCAGGGCAGCCTGG - Intergenic
1129815207 15:78546329-78546351 AGCTACCCAGGAGGCCAAGGTGG + Intronic
1130321658 15:82847520-82847542 AACTGCACAGCAGCCCACTGTGG + Intronic
1130641257 15:85677757-85677779 AGCTACCCAGGAGGCTACCCGGG - Intronic
1133099729 16:3471799-3471821 GGCTGCCCACCTGGCCACCCTGG - Intronic
1133722520 16:8508357-8508379 AGCTGCCATGCTGGCCACCCAGG + Intergenic
1135246250 16:20859828-20859850 AGCTGCCCTGCAGCCAACTGAGG - Exonic
1135319072 16:21479176-21479198 AGCTACTCAGGAGGCCACAGCGG + Intergenic
1135371970 16:21910969-21910991 AGCTACTCAGGAGGCCACAGCGG + Intergenic
1135405264 16:22193160-22193182 ATCTTCCCAGCAGGGCACAGTGG + Intergenic
1135439818 16:22459735-22459757 AGCTACTCAGGAGGCCACAGCGG - Intergenic
1136329377 16:29561251-29561273 AGCTACTCAGGAGGCCACAGCGG + Intergenic
1136444006 16:30300958-30300980 AGCTACTCAGGAGGCCACAGCGG + Intergenic
1137017757 16:35393840-35393862 AGCTGCCCTCCAGGCCTCCAGGG + Intergenic
1137403844 16:48175129-48175151 AGTGGCCCAGCAGGCCAAGGAGG + Intronic
1137611830 16:49823194-49823216 AGCCGACCAGCAGGCCAGCCAGG - Intronic
1138187127 16:54985352-54985374 AGAAGCCCAGCAGGCCAGGGTGG - Intergenic
1138623076 16:58227129-58227151 AGCTACTCAGGAGGCCACAGTGG + Intergenic
1138950558 16:61907565-61907587 AGCTACCCAGGAGGCCAAGGTGG + Intronic
1139923007 16:70471325-70471347 AGCTGTCCAGACGGCCAACGAGG - Exonic
1141162264 16:81637358-81637380 AGGTGACCAGCTGGGCACCGTGG - Intronic
1141172804 16:81701829-81701851 CCCTGCCCAGCAGGCCAGGGGGG + Intronic
1142339014 16:89508545-89508567 ACATGGCCAGCAGGCCTCCGGGG + Exonic
1142351346 16:89582152-89582174 AGCTGACCTGCAGGGCACCACGG + Intronic
1142489756 17:270506-270528 AGGTGACCAGCAGCCCACTGGGG - Intronic
1142686717 17:1581383-1581405 AGCAGCCCAGGAGGCCAGGGAGG + Intronic
1142819938 17:2457990-2458012 AGCTACCCAGTAGGCCAAGGTGG - Intronic
1142879005 17:2869960-2869982 AGCAGGCCAGCAGGTCACAGAGG - Intronic
1143027199 17:3947881-3947903 AGCTGCTCAGCAGCCAACCAGGG + Intronic
1143029504 17:3959992-3960014 AGCTGCCCAGCAGGGGCCAGTGG + Intronic
1143103973 17:4519362-4519384 GGCTGCCCACCAGGACACCGAGG + Intronic
1144731200 17:17527417-17527439 AGCTGCCCTGCTGGGCACTGGGG - Intronic
1144767326 17:17739847-17739869 AGCTGGCCAGTGGGCCACGGGGG + Intronic
1145057838 17:19714878-19714900 TGCTGCCCAGCAGGCAGCGGTGG + Intronic
1145264606 17:21373803-21373825 CGCTGCCCAGCAGGAGACCTGGG - Intergenic
1145810196 17:27759760-27759782 AGGTCCCCAGCAGGCCCCCTGGG - Intronic
1146809442 17:35891471-35891493 AGCTACACAGCAGGCCAAGGCGG - Intergenic
1147617104 17:41836097-41836119 AGCCCCCCAGCTGGTCACCGAGG - Intronic
1148212400 17:45816507-45816529 AGCTGCCCCGCAGGGCTGCGGGG - Exonic
1148341637 17:46876775-46876797 AGCTGCCCAGCCGGCCCTCTGGG + Exonic
1148575154 17:48705412-48705434 ACCTCCCCAGCAGACCTCCGAGG + Intergenic
1150810571 17:68353607-68353629 GTATGCCCAGCAGGCCACGGTGG - Intronic
1151746552 17:76014684-76014706 ATCTGCACAGCAGGCCACTCGGG - Intronic
1152481429 17:80556252-80556274 AGCTGCCCAGGAGCCCAGCTAGG - Intronic
1152537515 17:80959335-80959357 ACCTGCCCCGCAGGCCACCTGGG - Intronic
1152611064 17:81315223-81315245 GGCTGCCCAGCTGGCCCCAGGGG + Intronic
1152657137 17:81525005-81525027 AGCTGCTCAGGAGGCCAAGGTGG + Intergenic
1152815864 17:82407447-82407469 AGCCGCCCAGGAGGCCAAGGTGG - Intronic
1154279938 18:12993593-12993615 AGCTACTCAGGAGGCCACGGTGG - Intronic
1154418587 18:14202339-14202361 AGCTGCTCAGGAGGCCACGGTGG + Intergenic
1155208007 18:23577704-23577726 GGCTGCACAGGAGGCCACGGAGG + Intronic
1155931462 18:31713237-31713259 AGCTACTCAGGAGGCCAACGTGG + Intergenic
1155953371 18:31936349-31936371 AGCTACCCAGGAGGCCAATGTGG + Intronic
1156927642 18:42601899-42601921 TGATGCCCACCAGACCACCGTGG - Intergenic
1158248180 18:55455072-55455094 AGCTGCTCAGCAGGCTAAGGTGG + Intronic
1158951400 18:62498783-62498805 ATCTGACCAGGAGGCCACAGTGG - Intergenic
1160220644 18:76975021-76975043 AGCTGCTCAGGAGGCCAAGGCGG - Intergenic
1160629264 18:80233997-80234019 AGCTGCCAACCAGGCAACCCAGG + Intronic
1161047736 19:2145302-2145324 GGATGCCCAGCAGGCCACCCGGG + Intronic
1161272566 19:3398019-3398041 ATCTGCCCAGCAACCCACAGGGG - Intronic
1161273952 19:3405000-3405022 ACCTGACCCGCAGGACACCGAGG + Intronic
1161359412 19:3838869-3838891 AGCTGCCCAGCTGTCTCCCGGGG + Intronic
1161361034 19:3849905-3849927 AGTTGCCCTGCAGGCCAGCAGGG - Intronic
1161741234 19:6022274-6022296 TGCTGTCCTGCAGGCCACAGTGG - Intronic
1161814421 19:6490879-6490901 AGCTACTCAGCAGGCCAAGGAGG - Intergenic
1163651674 19:18521606-18521628 AGGTGCCCAGCAGGCCAGAAAGG + Intronic
1167557877 19:50206730-50206752 AGCTGCCCTGGAGGCCCCCCTGG - Intronic
1167690620 19:50982396-50982418 AGCGGCTCAGCAGGGCACCATGG - Exonic
1168126480 19:54286196-54286218 CGCTGTCCAGCCGGCCACCTAGG + Intergenic
1168131364 19:54321821-54321843 AGCTGCCCAGGACTCCACTGTGG - Intergenic
1168175414 19:54624668-54624690 CGCTGTCCAGCCGGCCACCTAGG - Intronic
1168307053 19:55441466-55441488 CCCTGCCCTGCAGGCCACCGAGG + Intronic
925703153 2:6659159-6659181 ATCTGCACAGCTGGCCACCCAGG + Intergenic
929217945 2:39436441-39436463 TGCTGCCCACCAGGCCTCGGTGG - Intronic
930000641 2:46859456-46859478 AGCTGCCCAGTAGGACATCCAGG + Intergenic
931765038 2:65447551-65447573 AGGTGCTCAGCTGGGCACCGTGG - Intergenic
932023715 2:68113437-68113459 AGCTGCCCAGCATGGCACCATGG + Intergenic
932276095 2:70453396-70453418 AGCTGCCCAGCAGGCCCCTAGGG - Intronic
933852914 2:86385400-86385422 AGCTGCCCAGGAGGCCTCAGGGG - Intergenic
933865610 2:86514118-86514140 AGCTGACCAGCAGCACACCAAGG - Intronic
934498667 2:94834876-94834898 AGCTGCTCAGGAGGCCAAGGTGG - Intergenic
934676830 2:96255137-96255159 AGCTACCCTGCAGACCACCCAGG - Intronic
934975398 2:98798802-98798824 AGCTGCTCAGGAGGCCAAGGTGG - Intronic
935122875 2:100197772-100197794 TGCTGCCCAGAAGGCCAGCAGGG + Intergenic
936947208 2:117941589-117941611 AGCTACCCACCAGGCCCCCAAGG + Intronic
937243597 2:120478013-120478035 TGGAGCCCAGCAGGCCACAGGGG - Intergenic
937905444 2:127050749-127050771 ATCTGCCCACCAGGGCACCGAGG + Intronic
938621155 2:133054791-133054813 AGATGTCCAGGGGGCCACCGTGG + Intronic
940639022 2:156329165-156329187 AGCTGCCCTGCAGGAGACCATGG - Intronic
942109856 2:172670163-172670185 AGCTGCCCGGAAGGCTAACGTGG - Intergenic
942454126 2:176125796-176125818 AGGTACCCAGCTGGCCACAGTGG - Intergenic
942454785 2:176130265-176130287 AGCCGCCCCACAGGCCCCCGCGG + Exonic
943724677 2:191241132-191241154 AGCTGCACAGCAGCCCAACGAGG - Intergenic
944256059 2:197624834-197624856 AGCTACCCAAGAGGCCAACGTGG + Intronic
946394115 2:219434824-219434846 TGCTACCCAGAAGGTCACCGGGG - Exonic
946411159 2:219515771-219515793 AGCTCCCCAGGAGGCCACCCGGG - Intronic
948673508 2:239583797-239583819 AGCAGTCCAGCAGCCCAGCGAGG - Exonic
948889138 2:240898312-240898334 AGCTGCCCAGCCGTCCAGGGCGG - Intergenic
1171447332 20:25214157-25214179 AGCTGCCCAGCATTCCGCAGTGG + Intronic
1172092282 20:32441863-32441885 GGCTGGCCAGCAGGCCAGCGGGG + Intergenic
1172093973 20:32451768-32451790 AGCCGCCCTGCAGGCCAGCGGGG + Intronic
1173894663 20:46541756-46541778 AGCTGCCCCGCTGGCCGCGGGGG - Exonic
1173945316 20:46945689-46945711 AAGGGCCCAGCAGGCCACAGAGG - Intronic
1174385736 20:50187687-50187709 AGCTTCCCTGCAGGACACCTGGG + Intergenic
1176084773 20:63290916-63290938 GGCTGCACAGGAGGCCACTGGGG + Intergenic
1176220929 20:63969184-63969206 ACCTGCACCCCAGGCCACCGGGG - Intronic
1176854712 21:13956951-13956973 AGCTGCTCAGGAGGCCACGGTGG - Intergenic
1177175733 21:17699148-17699170 AGCTACCCAGGAGGCCAAGGTGG - Intergenic
1178086962 21:29121941-29121963 AGTTGCAAAGCAGGCCACAGAGG + Intronic
1179992518 21:44955630-44955652 AGCTGCTCAGGAGGCCAAAGTGG - Intronic
1180020647 21:45123711-45123733 AGCTGCTCAGCAGGCTAAGGCGG - Intronic
1181388738 22:22563891-22563913 AGATGCGCAACAGGCCACAGTGG + Exonic
1182275937 22:29188654-29188676 AGCTGCCCAGGAGGCCAGTGGGG + Intergenic
1182280849 22:29217044-29217066 AGCTGCCAAGGAGACCACAGAGG + Intronic
1182442114 22:30370714-30370736 TGCTGCCCAGCGGCCCACGGTGG - Exonic
1182551363 22:31102583-31102605 TGCTGCCCAGCAAGCCAGCTTGG + Intronic
1183798723 22:40143318-40143340 AGCTGCCCAGGAGGCTAAGGTGG + Intronic
1184451503 22:44585540-44585562 ACCTGCCCTGCAGGCCATGGAGG + Intergenic
1184682195 22:46078467-46078489 ACCAGGCCTGCAGGCCACCGTGG - Intronic
1184801463 22:46762901-46762923 CGCAGCCCAGGAGGCCAACGCGG - Intronic
1184859826 22:47166961-47166983 AGCTGCCCAGCCGGACAAGGAGG + Intronic
1185069452 22:48648078-48648100 AGCTGCCCTGAAGTCCACCAAGG - Intronic
1185125269 22:49007052-49007074 AGCAGCCCAGGAGGCCACACTGG + Intergenic
950262862 3:11554871-11554893 AGCTCCTCAGCAGGCGGCCGGGG - Exonic
950911211 3:16594555-16594577 TGCTCCCCAACAGGCCACTGTGG + Exonic
954105059 3:48405490-48405512 AGCTCCCCAGCAGGACGGCGAGG - Intronic
956420201 3:69079935-69079957 AGCGGCCCGCCAGGCCCCCGGGG + Intronic
956424772 3:69122535-69122557 AGCTGCTCAGCAAACCACTGAGG - Exonic
960537202 3:118827222-118827244 GGCTGCCCACCAGGACAACGAGG + Intergenic
961052350 3:123757579-123757601 GACTGCCCAGCAGGACACTGGGG + Intronic
961384804 3:126517477-126517499 AGCTGCTCAGCCGCCCACCCTGG - Intronic
961809520 3:129513902-129513924 AACTGCCCACCAGGCCCTCGGGG + Intronic
962561199 3:136608416-136608438 AGCTGCTCAGCAGGCTAAAGTGG + Intronic
962754651 3:138458425-138458447 AGCTGCCCAGGCAGCCCCCGGGG + Intronic
962960037 3:140302713-140302735 AGCTGGACAGTAGGCCACTGTGG - Intronic
964117130 3:153147999-153148021 AGCTGCCCAGGAGGCTAAGGCGG + Intergenic
968793603 4:2687130-2687152 AGCTGTCCAGCAGCCCAGAGGGG + Intronic
969254598 4:5993445-5993467 AGATGCCCAGTTGGCCGCCGTGG + Intergenic
969568672 4:7995355-7995377 AGCTGCCCACGAGGCCTCCGAGG + Intronic
969661680 4:8533674-8533696 AGCTGCTCAGGAGGCCAATGCGG - Intergenic
970576155 4:17430247-17430269 TGCTGCCCGGCTGGCCACAGAGG - Intergenic
974262328 4:59541990-59542012 AGCTCCCCATGAGGCCACCTGGG + Intergenic
979693660 4:123587440-123587462 AGCTACCCAGGAGGCCAAGGTGG + Intergenic
981286618 4:143025865-143025887 AGCTGGCCAGCAGCCCATCTGGG + Intergenic
982090103 4:151872898-151872920 ACCTGCCCACCTGGCCACCCCGG + Intergenic
983424765 4:167569343-167569365 AGCTGTTCAGGAGGCCACGGTGG - Intergenic
984790319 4:183609245-183609267 AGAAGCCCAGCAGGGCACTGTGG - Intergenic
985192380 4:187389871-187389893 AGCCGCTCAGCAGGGCATCGAGG + Intergenic
985776612 5:1847603-1847625 AGATGCCCACCTGGCCACTGTGG + Intergenic
985840449 5:2301462-2301484 AGCTGCCCAGAGAGCCACGGTGG - Intergenic
986974870 5:13382506-13382528 TGCTGTCCAGCAGGCCATCTAGG + Intergenic
987336377 5:16901262-16901284 GGGCGCCCAGCAGGCCAGCGAGG - Intronic
989336259 5:40320301-40320323 AGCTGCTCAGGAGGCCAAGGTGG + Intergenic
990698935 5:58454440-58454462 ACCAGTCCAGCAGGCCACAGGGG + Exonic
998186281 5:139982268-139982290 AGCTGCCCAGCATGATCCCGGGG + Intronic
998708572 5:144793987-144794009 AGCTAACCAGCAGGGCACAGTGG - Intergenic
999593733 5:153178724-153178746 ATCTGCCAAGCAGGCCACTGGGG + Intergenic
999709328 5:154302460-154302482 AGCAGCCCAGCAGGGCTCCCAGG - Intronic
1001423941 5:171611163-171611185 ATTTGCCCAGGAGGCCAACGTGG + Intergenic
1001745807 5:174091373-174091395 AGCTGGGCAGGCGGCCACCGAGG + Intronic
1002443156 5:179274705-179274727 AGCCGCCCAGCAGGCCCTGGGGG - Intronic
1003711081 6:8590768-8590790 AGCTGCCTATCTGGCCACCAAGG - Intergenic
1006134385 6:31887018-31887040 AGCCGCCCAGAAGGGCTCCGTGG - Exonic
1006637432 6:35470491-35470513 ACCTGCTCACCAGGCCACTGGGG + Intronic
1007809488 6:44476052-44476074 CGCAGCCCAGCAGGCCTCCATGG - Intergenic
1008462625 6:51793426-51793448 ATCTGTGCAGCAGGCCACCGTGG - Intronic
1009402123 6:63269488-63269510 AGCTGCCAAGCGGGCCTCCTAGG + Intergenic
1011178153 6:84587674-84587696 AGCTGCACAGGAGCCCACGGAGG - Intergenic
1012512895 6:100024879-100024901 AGCTGCACAGCAGAGCACCCTGG + Intergenic
1013017154 6:106170184-106170206 AGCTGCCCAGCAGGGCTAGGAGG - Intergenic
1016125417 6:140396346-140396368 TGCTGCCCATCTGGCCCCCGAGG - Intergenic
1018384664 6:163291459-163291481 AGATGCCCCGCAGGCCAGCTCGG - Intronic
1019079567 6:169421055-169421077 AGACGCTCCGCAGGCCACCGGGG - Intergenic
1019299304 7:295528-295550 AGGTGCCCAGAAAGCCGCCGTGG - Intergenic
1019328576 7:451856-451878 AGGGGCCCAGCAGCCCAGCGGGG - Intergenic
1019493109 7:1324206-1324228 GGCTGCCCGGCAGGCCACACCGG - Intergenic
1019668199 7:2263320-2263342 AGCGGCCCAGGAGGGCAGCGGGG + Exonic
1020279911 7:6644898-6644920 AGGAGCCCAGCACGCCATCGCGG + Intronic
1022098804 7:27157053-27157075 TCCTGCCCACAAGGCCACCGCGG - Intronic
1023396169 7:39754023-39754045 GGCTGCCCAGGAGCCCACGGCGG + Intergenic
1024853017 7:53743827-53743849 AGCTGGGCAGCAGCCCACCTAGG + Intergenic
1026098297 7:67364603-67364625 GGCTGCCGAGGAGCCCACCGCGG + Intergenic
1027164949 7:75827743-75827765 ACCTCCCCAGCAGGTCACCCTGG - Intergenic
1027422984 7:78035190-78035212 AGCAGCCCTGCCGGCCACCGTGG - Intronic
1028041291 7:86058203-86058225 TGCTGTCCAGCAGTCCACCTAGG - Intergenic
1028100910 7:86819576-86819598 TGCTGCCCAGCAGGCCTAGGGGG + Intronic
1029236428 7:99123418-99123440 AGCTACTCAGGAGGCCAACGTGG + Intronic
1031273684 7:119689219-119689241 AGCTGACCAGGAGGCCACATTGG - Intergenic
1032353369 7:131186393-131186415 AGCTGCTCAGGAGGCCAACGTGG + Intronic
1034671178 7:152859793-152859815 AGCTGCCATGCAGGCAACCCAGG - Intergenic
1035207170 7:157301222-157301244 AGCTGCTCAGGAGGCTACGGTGG + Intergenic
1036191007 8:6670768-6670790 GGCTGCCCTGCAGGCCAGTGGGG - Intergenic
1037239469 8:16760614-16760636 AGCTGCACAGGAGCCCACCATGG + Intergenic
1039234230 8:35484316-35484338 AGCTGCCCAGCTGGCCCCAGTGG - Intronic
1040413876 8:47180877-47180899 TGCAGCTCAGCAGGCCCCCGGGG - Intergenic
1040701823 8:50075150-50075172 GGCTGCCCAGGAGCCCACAGGGG - Intronic
1041078067 8:54187225-54187247 AGCTGGCCAGGAGGCCACTAAGG + Intergenic
1042500995 8:69508816-69508838 TGATGCCCAGCAGGACACAGTGG + Intronic
1042839835 8:73112391-73112413 ACCTGCCCGGCAAGCCACAGAGG + Intronic
1043866796 8:85383777-85383799 AGGTGAGCAGCAGGCCAGCGAGG + Intronic
1045062849 8:98423948-98423970 ATCTTCCCAGCAGGCCAGCCAGG + Intronic
1051459304 9:17294749-17294771 GGCTGCGCAGGAGCCCACCGCGG + Intronic
1053658491 9:40245657-40245679 AGCTGCTCAGGAGGCCAAGGTGG + Intronic
1053908863 9:42874925-42874947 AGCTGCTCAGGAGGCCAAGGTGG + Intergenic
1054370610 9:64391931-64391953 AGCTGCTCAGGAGGCCAAGGTGG + Intronic
1054526107 9:66130565-66130587 AGCTGCTCAGGAGGCCAAGGTGG - Intronic
1054678241 9:67881680-67881702 AGCTGCTCAGGAGGCCAAGGTGG + Intronic
1054759141 9:68989278-68989300 AGCTGAACAGGAGGCCACTGAGG - Intronic
1056713529 9:89010392-89010414 AGAGGCCCAGCCGGCCTCCGTGG + Intergenic
1056753313 9:89367270-89367292 AGCTCCCCAGCAGTCCTCCGTGG - Intronic
1057277079 9:93681704-93681726 TTCTGCCCAGGAGTCCACCGAGG + Intergenic
1059135118 9:111798309-111798331 AGCTGCCAGGCTGGGCACCGTGG + Intergenic
1060925276 9:127451536-127451558 GGCTGGCAAGCAGGGCACCGCGG + Exonic
1061225036 9:129276558-129276580 AGCTGCCCAGGGGGACACCCAGG - Intergenic
1061573789 9:131493764-131493786 CCCTCCCCAGCAGGCCACCCTGG - Intronic
1061821947 9:133233832-133233854 AGAGGCCCTGCAGGCCACCAAGG - Intergenic
1062016541 9:134294032-134294054 AGCTTCCCAGCAAGCCTCCGCGG + Intergenic
1062237351 9:135516682-135516704 AGAGGCCCTGCAGGCCACCAAGG + Intergenic
1062284970 9:135768768-135768790 TGCCGCCCAGCAGCCCACAGAGG + Intronic
1062597547 9:137306012-137306034 GGCTGCCCAGCAGGTCAAGGGGG + Intergenic
1186700055 X:12081118-12081140 TGCTGCCCAGCAGGAAACCCTGG + Intergenic
1189417132 X:40825266-40825288 ACCTGCCCAGAAGGCCACATTGG - Intergenic
1191853213 X:65601562-65601584 ACCCGCCCAGCCAGCCACCGTGG - Intronic
1196507416 X:116463632-116463654 ATCTGTGCAGCAGGCCACCATGG - Intergenic
1196756040 X:119158247-119158269 TTCTGCCCAGCAGGGCACTGAGG + Intergenic
1197171216 X:123436544-123436566 AGATGGCCGGCAGGCCACCTTGG - Intronic
1199867938 X:151871096-151871118 AACTGCCCAGAAGCCCACCCAGG + Intergenic
1200141429 X:153904750-153904772 AGCTGCCCAGGAGCCCAGCCAGG + Exonic
1200180854 X:154149943-154149965 AGCTACTCAGGAGGCCAACGTGG - Intronic
1200186497 X:154187057-154187079 AGCTACTCAGGAGGCCAACGTGG - Intergenic
1200192149 X:154224195-154224217 AGCTACTCAGGAGGCCAACGTGG - Intronic
1200197904 X:154261999-154262021 AGCTACTCAGGAGGCCAACGTGG - Intronic
1202232281 Y:22669658-22669680 AGCTGGCAAGCAGGGCACTGCGG - Intergenic
1202277393 Y:23137485-23137507 TGCTCCCCAACAGGCCACTGCGG + Intronic
1202280242 Y:23177244-23177266 TGCTCCCCAACAGGCCACTGCGG + Intronic
1202280971 Y:23188091-23188113 TGCTCCCCAACAGGCCACTGCGG + Intronic
1202288635 Y:23283203-23283225 TGCTCCCCAACAGGCCACTGCGG - Intronic
1202310875 Y:23526500-23526522 AGCTGGCAAGCAGGGCACTGCGG + Intergenic
1202430385 Y:24771208-24771230 TGCTCCCCAACAGGCCACTGCGG + Intronic
1202436593 Y:24844815-24844837 TGCTCCCCAACAGGCCACTGCGG - Intronic
1202440407 Y:24898879-24898901 TGCTCCCCAACAGGCCACTGCGG - Intronic
1202559927 Y:26144094-26144116 AGCTGGCAAGCAGGGCACTGCGG - Intergenic