ID: 1085612512

View in Genome Browser
Species Human (GRCh38)
Location 11:77964714-77964736
Sequence AAGGGCAAGTGGAGGGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1562
Summary {0: 1, 1: 1, 2: 9, 3: 152, 4: 1399}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085612512 Original CRISPR AAGGGCAAGTGGAGGGAGGA AGG Intronic
900093323 1:929970-929992 AGAGGCAGGTAGAGGGAGGATGG + Intronic
900159379 1:1216305-1216327 CAGCGCAGGTGGTGGGAGGATGG - Intergenic
900391629 1:2436328-2436350 GAGGAAAGGTGGAGGGAGGAAGG - Intronic
900391649 1:2436381-2436403 GAGGAAAGGTGGAGGGAGGAAGG - Intronic
900391656 1:2436403-2436425 GAGGAAAGGTGGAGGGAGGAAGG - Intronic
900391671 1:2436448-2436470 GAGGAAAGGTGGAGGGAGGAAGG - Intronic
900391706 1:2436547-2436569 GAGGAAAGGTGGAGGGAGGAAGG - Intronic
900419139 1:2548032-2548054 CAGGGGGAGGGGAGGGAGGAGGG + Intergenic
900471371 1:2856665-2856687 AAGGGGAGGCGGAGGGAGGGAGG - Intergenic
900622548 1:3593934-3593956 AAGGGGAAGAGAAGGGATGATGG - Intronic
900686153 1:3948966-3948988 GAGGGCAGGTGGGGGGAGGCTGG - Intergenic
900932906 1:5747861-5747883 AAGGGAAAGGGGAGGGAGGCAGG + Intergenic
900977601 1:6026968-6026990 AAGGGGGAGGGGAGAGAGGAGGG - Intronic
901004067 1:6163271-6163293 CAGTGCAGGTGGATGGAGGAGGG - Intronic
901224190 1:7602158-7602180 GAGGGGAAGGGAAGGGAGGAGGG - Intronic
901447911 1:9319411-9319433 AGGAGGAAGAGGAGGGAGGAAGG - Intronic
901921057 1:12538068-12538090 GAGGGCAAGAGGAGAGGGGAGGG - Intergenic
902517633 1:16997875-16997897 AAGGGGAGGGGGAAGGAGGAGGG + Intronic
902774252 1:18664445-18664467 CTGGGGAAGGGGAGGGAGGAGGG + Intronic
902821295 1:18944921-18944943 AAGAGCATGAGGAGGGAGGAGGG + Intronic
903331712 1:22600058-22600080 AAGGGGGGATGGAGGGAGGAAGG + Intronic
903396176 1:23003417-23003439 AAGGAGGAATGGAGGGAGGAAGG + Intergenic
903407997 1:23114958-23114980 AAGGGCAAATGGAGATAGCATGG - Intronic
903578401 1:24353371-24353393 GTGGGCAGGTGGATGGAGGATGG + Intronic
903601125 1:24541583-24541605 AGGAGGAAGTGGAGGGAGGCAGG - Intergenic
904044635 1:27602350-27602372 AGGGGCCAGCTGAGGGAGGAAGG - Intronic
904301362 1:29556781-29556803 GGGGACAAGTGGAGGGAGGCAGG + Intergenic
904339984 1:29828316-29828338 GGGGACAAGTGGAGGGAGGTGGG + Intergenic
904372443 1:30058412-30058434 CAGGGGAAGGGGAGGGAGGGTGG - Intergenic
904389335 1:30171521-30171543 GAGGGAAACTGGAGGGGGGAGGG - Intergenic
904404193 1:30275390-30275412 GAGGACAAGTGGAGGGAGGTGGG - Intergenic
904473290 1:30748798-30748820 AGAGCCCAGTGGAGGGAGGAGGG - Intronic
904652351 1:32014657-32014679 AGCCGCAAGAGGAGGGAGGAGGG - Intronic
904807272 1:33140861-33140883 AAGGAGAAGGGGAGAGAGGAGGG - Intergenic
905175664 1:36134034-36134056 AAGGGGGAGTGGGGGGAGGGAGG - Intergenic
905306099 1:37019322-37019344 AGGGGCAAGGGCAGGAAGGAGGG + Intronic
905375007 1:37514389-37514411 GAGGGGGCGTGGAGGGAGGACGG - Intronic
905415221 1:37799386-37799408 AATGACAACTGGAGAGAGGAAGG + Intronic
905485495 1:38292923-38292945 AAGGGCATGAGGCTGGAGGATGG - Intergenic
905943891 1:41885721-41885743 AAGGGGAAGAGGAGGGGGAAGGG - Intronic
906135974 1:43501244-43501266 AAGGGAGAGGGGAGGGGGGAGGG - Intergenic
906232250 1:44173753-44173775 AAGAGAAAATAGAGGGAGGAAGG + Intergenic
906316025 1:44786847-44786869 GAGGCCAGGAGGAGGGAGGAGGG + Intronic
906427777 1:45727433-45727455 AAGGGCAAGGGGAAGGGGAAGGG - Intronic
906490231 1:46262496-46262518 AGGGGCAAGAGCAGGCAGGAGGG + Intronic
906764803 1:48418856-48418878 GAGGGGAAGGAGAGGGAGGAAGG + Intronic
906956611 1:50380843-50380865 GAGGGGAAGGGAAGGGAGGAGGG + Intergenic
907614927 1:55913726-55913748 AAGGGCAAGTGGAGCAGTGAGGG - Intergenic
907663450 1:56414496-56414518 ATGGGGCAGTGGAGGGGGGATGG - Intergenic
907727973 1:57037806-57037828 AAGGGCAAGTGGCTTGAGGTGGG + Intronic
907965084 1:59321227-59321249 AAGGGCAAGTACAGGGTGGTAGG - Intronic
908000145 1:59671522-59671544 CAGAGTAGGTGGAGGGAGGAAGG + Intronic
908066870 1:60415556-60415578 AAGGCCAAGTGGTGTGGGGAGGG - Intergenic
908378518 1:63572013-63572035 CTGGGCAAGTGAAGGGAGAAAGG + Intronic
908558183 1:65278964-65278986 ATGGGGAAGGGGATGGAGGAGGG - Intronic
908833640 1:68206931-68206953 AAGGACAAGGAGGGGGAGGAGGG - Intronic
908852261 1:68387528-68387550 AAGGAGAAATGGAGGGTGGAAGG - Intergenic
909498272 1:76304331-76304353 GAGGGAGAGTGGAGGGAGAAAGG - Intronic
910241762 1:85094117-85094139 AAGGGCCAGTGTAGGGTGAAAGG - Intronic
910504787 1:87937624-87937646 AGGGGGAAGTGCAGTGAGGAAGG + Intergenic
910532217 1:88250469-88250491 AAGGAGAAAGGGAGGGAGGAAGG + Intergenic
910736295 1:90461592-90461614 GAGGGCAGAGGGAGGGAGGAGGG - Intergenic
911093573 1:94037423-94037445 AAGGGGAAGTGGAGAGAAGTAGG - Intronic
911094381 1:94043999-94044021 AAAGGGAAGGGGAAGGAGGAAGG - Intronic
911262127 1:95699242-95699264 CAGGGCCTGTTGAGGGAGGAGGG + Intergenic
911542293 1:99172385-99172407 GAGGGTAAGGGGTGGGAGGAGGG - Intergenic
911741634 1:101392559-101392581 GAGGGCAAGAGGAAGGAGGGAGG - Intergenic
911759935 1:101602520-101602542 AAGGAGAAATGGAGGGTGGAAGG + Intergenic
911809794 1:102261273-102261295 AATGGAAATTGGAGGGAGGGAGG + Intergenic
912713402 1:111965402-111965424 AAGGGGTCGGGGAGGGAGGAGGG - Intronic
912813416 1:112810667-112810689 AAGGGGGAATGGAGGGCGGAAGG - Intergenic
912925183 1:113906823-113906845 GATGGGAAGTGGAAGGAGGAAGG + Intronic
913058551 1:115183917-115183939 AAGTGGAAGTGAAGAGAGGAAGG - Intergenic
913124694 1:115774429-115774451 AAGGACTAGTGGGAGGAGGAGGG - Intergenic
913183880 1:116348943-116348965 AAGGGGAAGGGAAGGAAGGAAGG + Intergenic
913369682 1:118084097-118084119 AAGGAGAAGTGGAGGGTGGCAGG + Intronic
914000365 1:143689559-143689581 ATGGGGAACTGGAGAGAGGAAGG + Intergenic
914324872 1:146602789-146602811 GAGGCCTAGTGGAGGGTGGAGGG - Intergenic
914677734 1:149917252-149917274 AAGGGCAGGTGAAGGATGGAGGG - Intronic
914918392 1:151831822-151831844 AGGGCCCAGGGGAGGGAGGAGGG + Exonic
914926395 1:151892251-151892273 AGGAGCAAGTAGAAGGAGGAGGG + Intronic
914940714 1:152020651-152020673 AAGGGTAAGTGGGGTGATGATGG - Intergenic
915218152 1:154353429-154353451 AAGGTGCAGTGGTGGGAGGAGGG - Intergenic
915244208 1:154544697-154544719 ATGTGAAAGTGGAGGTAGGAGGG - Intronic
915724927 1:158010719-158010741 CAGGCAAAGGGGAGGGAGGAGGG - Intronic
915878805 1:159643431-159643453 AAGGGGGAGGGGAGGGGGGAGGG + Intergenic
916376767 1:164163424-164163446 AGGGGCTGGTGGAGGGAGGCAGG - Intergenic
916601198 1:166295203-166295225 GATGGCAAGTGGGGGGAGAAAGG - Intergenic
916651610 1:166839462-166839484 GAGGACACGTGGTGGGAGGAGGG - Intronic
916881604 1:169024426-169024448 AAGGAGAAGAGGAGGAAGGAAGG + Intergenic
917223565 1:172757943-172757965 AAAGTCAATAGGAGGGAGGAAGG - Intergenic
917816282 1:178713191-178713213 AAGAGAAAGAGGGGGGAGGAAGG + Intergenic
917999563 1:180479490-180479512 AGGGGCAAGTAGGGGGAAGAGGG + Intronic
918026215 1:180749911-180749933 AAGGGCAAATGAAGGGTTGAGGG + Intronic
918222855 1:182451784-182451806 AAGGGCAAGAGGTGGGAGCTAGG + Intronic
918289309 1:183091473-183091495 AAGGGCAGAGGGAGGGAGGTAGG - Intronic
918462866 1:184794385-184794407 AAGCGGAAATGGAGGGTGGAAGG - Exonic
918469910 1:184861515-184861537 GGGGGGAAGAGGAGGGAGGAAGG + Intronic
918469966 1:184861726-184861748 AAGGAGAAGGGGAGGGAGGAAGG + Intronic
918532483 1:185538725-185538747 CAGGGCAAGTGGAGGCAGGGCGG - Intergenic
918590760 1:186238296-186238318 ATGGAGAAGTGGAGGGGGGAAGG + Intergenic
918612068 1:186504225-186504247 CAAGGGCAGTGGAGGGAGGAGGG + Intergenic
918833982 1:189435533-189435555 AAGGGGAAGGGGAAGGAGGAAGG + Intergenic
919061616 1:192641360-192641382 AGGGGAAAAGGGAGGGAGGAAGG + Intronic
919710312 1:200720994-200721016 GAGGGGAAGGGAAGGGAGGAAGG - Intergenic
919819333 1:201463092-201463114 GAGGGCAGGTGGAGGGTGGAGGG - Intergenic
919830408 1:201536894-201536916 ATGGACAGGTTGAGGGAGGAAGG - Intergenic
919885395 1:201930245-201930267 AAGGTCAACTGTGGGGAGGATGG + Intronic
920398187 1:205661286-205661308 AAGGGGAAGGGGAAGGAGAAAGG + Intronic
920578208 1:207078843-207078865 ATGGGGAGGTTGAGGGAGGAGGG + Intronic
920672598 1:208015799-208015821 AAGGGAAGGTGGAGTGAGTAGGG + Intergenic
921214374 1:212924685-212924707 GAGGCCAGGTGGAGGAAGGAAGG - Intergenic
921584746 1:216933891-216933913 AGGGGTCAGTGGAGGGAAGATGG - Intronic
921771918 1:219050528-219050550 AGGGGGAGATGGAGGGAGGAAGG + Intergenic
922574889 1:226654944-226654966 AGGAGGAAGAGGAGGGAGGAGGG + Intronic
922598824 1:226834497-226834519 AAGGGGGAATGGAGGGTGGAAGG - Intergenic
922845609 1:228681784-228681806 AAGGAGAAATGGAGGGTGGAAGG + Intergenic
922856372 1:228778526-228778548 CAGGGCAGGGGGAGGGGGGAGGG - Intergenic
922883904 1:229003491-229003513 CAGGGGGAGGGGAGGGAGGAAGG + Intergenic
922974202 1:229770090-229770112 AAGGGGAGATGGAGGGAGGGAGG - Intergenic
923072427 1:230577865-230577887 AAGGGGAAGGGGAAGAAGGAGGG - Intergenic
923208739 1:231783895-231783917 AAGGGATAATGGAGGGAGAAAGG - Intronic
923401841 1:233623281-233623303 AAGGGTACGGGGAGGGGGGATGG + Intronic
923482423 1:234397407-234397429 AGGGGGAAGAGGGGGGAGGAGGG + Intronic
923482433 1:234397426-234397448 AGGGGGAAGAGGGGGGAGGAGGG + Intronic
923529594 1:234803128-234803150 AAGGGGAGGAGGAGGGGGGAAGG - Intergenic
923736985 1:236619505-236619527 AAGGGCAAGCGGAGAGAGGAAGG + Intergenic
923850824 1:237792515-237792537 TGGGGCAAATGGAGGAAGGATGG + Intronic
924307035 1:242700341-242700363 AAGAACAAATGGAGGGAGGGAGG + Intergenic
924365380 1:243287827-243287849 AAGGGGAAGTGAAGTGAGAAAGG + Intronic
924457254 1:244228627-244228649 AAGGGCAGGGGGAGAGAGAATGG + Intergenic
924529467 1:244881143-244881165 ATTGACAAGTTGAGGGAGGAAGG + Intergenic
924608658 1:245556254-245556276 AAGAGGAGGAGGAGGGAGGAAGG - Intronic
1062787787 10:279643-279665 AAGGGGCAGTGCAGGGAGGCTGG + Intronic
1062826349 10:571554-571576 ATGGGGAAGTGCAGTGAGGAAGG - Intronic
1062842712 10:683488-683510 AAGGGAAGGTGGAAGCAGGAAGG + Intronic
1063207569 10:3849110-3849132 AAGGGGGAGGGGAGGGGGGAAGG - Intergenic
1063207576 10:3849122-3849144 AAGGGGAAGGGGAAGGGGGAGGG - Intergenic
1063286249 10:4692074-4692096 AAGGGGAAGGGGAAGGAGAAGGG + Intergenic
1063376710 10:5558445-5558467 AAGGGCAAGCGGTGGGGGCAAGG + Intergenic
1063526555 10:6792120-6792142 AAAGGCAGGTGGAGGTGGGAAGG + Intergenic
1063938942 10:11107803-11107825 AGGGGGAAGAAGAGGGAGGAGGG - Intronic
1063938949 10:11107822-11107844 AGGGGGCAGAGGAGGGAGGAGGG - Intronic
1064037559 10:11926833-11926855 AGGAGGAATTGGAGGGAGGAAGG + Intronic
1064225262 10:13478067-13478089 AGGGGAGAGGGGAGGGAGGATGG + Intronic
1064360031 10:14655980-14656002 AAGGGCAAGGGGAGAGGGGCTGG + Intronic
1064563180 10:16612883-16612905 AGGGGGAAGAGGAGGGGGGAAGG - Intronic
1064569781 10:16680612-16680634 AAAGGGAAGGGGAGGGAGGGAGG + Intronic
1064715667 10:18174213-18174235 AAGGGGAAGGGGAAGGAGAAAGG - Intronic
1065203067 10:23331673-23331695 AAGGGAAAGGGAAGGGAAGAAGG + Intronic
1065377463 10:25058155-25058177 GAGGACAAGTAGAGGGAGGAAGG - Intronic
1065608531 10:27446671-27446693 AAGGGGAAGGGAAGGAAGGAAGG - Intergenic
1066103514 10:32137900-32137922 AAGGGGAAATGGAGGGCGGAAGG + Intergenic
1066371526 10:34821991-34822013 AAAGAAAAGGGGAGGGAGGAAGG + Intergenic
1066437508 10:35407714-35407736 AAGGAGGAGTGGAGGGTGGAAGG + Intronic
1066598498 10:37078147-37078169 AGGGGCAGGGAGAGGGAGGAAGG - Intergenic
1067048809 10:43000471-43000493 AGGGGCAAGTGGAAGAAGGACGG + Intergenic
1067225758 10:44374738-44374760 AAGAGAAAGTGGTTGGAGGATGG - Intronic
1067239740 10:44480455-44480477 AAGGGCAAGCCGAAGCAGGAGGG + Intergenic
1067276075 10:44835292-44835314 AAGAGCAAGAGCAGGCAGGAGGG - Intergenic
1067286310 10:44909995-44910017 AAGGGGAAGGGGAAGGAGAAGGG + Intergenic
1067361008 10:45578461-45578483 AATGGGATGTGGAGGGAGGAGGG + Intronic
1067438370 10:46294411-46294433 CTGGGAAAGTGGAGGGAGGCAGG + Intronic
1067759073 10:49029771-49029793 AAGGGGAAGTTGGGGGAGAAGGG + Intronic
1067913782 10:50374711-50374733 ATGGGCAAGTGGGGAGAGGCTGG - Intronic
1068174002 10:53433469-53433491 AAGGGAAAGAAGAAGGAGGAAGG + Intergenic
1068830661 10:61491198-61491220 AAGGAGAAGGGAAGGGAGGAAGG + Intergenic
1069266045 10:66459026-66459048 AAGTGGAAGGGGAGGCAGGAGGG - Intronic
1069335146 10:67340174-67340196 AAGGGCAGGAGGAAGGAGGAGGG + Intronic
1069341177 10:67410352-67410374 AAGGGCAAGGGGTGAGAGGAGGG + Intronic
1069567593 10:69474154-69474176 GAGAGCAGGTGGGGGGAGGAGGG - Intronic
1069782779 10:70967320-70967342 CATGGCAAGTGGAGGGTGGAGGG + Intergenic
1069887938 10:71635627-71635649 CAGGGCAAGAGGGGGAAGGAGGG + Intronic
1070109334 10:73467804-73467826 CAGGGCTGGTAGAGGGAGGAAGG + Intronic
1070493920 10:77003798-77003820 AAGGATAAGGGGAGGGATGATGG + Intronic
1070711947 10:78689298-78689320 GAGGGCGGGAGGAGGGAGGAAGG + Intergenic
1071187087 10:83058393-83058415 AAGGGGGAATGGAGGGTGGAAGG - Intergenic
1071203814 10:83251734-83251756 AAGAGGAGGAGGAGGGAGGAGGG + Intergenic
1071306389 10:84302767-84302789 AAGGGAAATTGGAGTGGGGAAGG + Intergenic
1071316865 10:84409906-84409928 GAGGGCAGGGGGTGGGAGGAGGG - Intronic
1071820223 10:89272239-89272261 GAGGGCAGGGGGTGGGAGGAGGG - Intronic
1071827142 10:89336384-89336406 AAGGGCAATGGGAGTGAGGAGGG - Intronic
1071829955 10:89361856-89361878 AAAGGCAGGTGGAGGGTGGGGGG - Intronic
1072043238 10:91629606-91629628 AAGGAAAAGTTGAGGAAGGATGG - Exonic
1072898204 10:99385351-99385373 AAGGGAAAGTAGGGGAAGGAAGG - Intronic
1073001005 10:100286282-100286304 GAAGGCAAGTGGAGGGATGTCGG - Intronic
1073247029 10:102098376-102098398 AAGGGCAAATGGTAGCAGGAGGG - Intergenic
1073353381 10:102835428-102835450 AAGGGCAAGAGTGGGGTGGATGG - Intronic
1073502107 10:103949561-103949583 AAGGGCAAGTGGAGTGAAAATGG + Intergenic
1073565793 10:104534683-104534705 AAGAGGAAGGGAAGGGAGGAGGG - Intergenic
1073771159 10:106737302-106737324 AAGGGAAAGTGGGGAAAGGAAGG - Intronic
1073911221 10:108347054-108347076 GAGGGAAAGAGGAGGGAGGAAGG + Intergenic
1073920045 10:108448389-108448411 AAGAGGAAGAGGAGGGATGATGG + Intergenic
1074001539 10:109378698-109378720 CAGGGCCAGTGCAGGGAGGAGGG + Intergenic
1074749136 10:116567019-116567041 AAGGACAGAGGGAGGGAGGAAGG - Intronic
1074829452 10:117238674-117238696 AAGGGGAAAGGGAGGGAGGGGGG - Intergenic
1075048761 10:119166316-119166338 AAGGGCAGGTGGGAGGAGGAAGG - Intergenic
1075284487 10:121171797-121171819 AAGGGGAAGGGAAGGGAGAAGGG + Intergenic
1075284494 10:121171815-121171837 AAGGGGAAGGGAAGGGAGAAGGG + Intergenic
1075284501 10:121171833-121171855 AAGGGGAAGGGAAGGGAGAAGGG + Intergenic
1075403385 10:122177298-122177320 AAGGAGCAGTGGAGGGAGGCTGG + Intronic
1075471373 10:122692676-122692698 GATGGCATGTGGAAGGAGGAAGG + Intergenic
1075923761 10:126234769-126234791 AACTCCAAATGGAGGGAGGATGG + Intronic
1076072744 10:127504651-127504673 AAGGGGAAGTCAAGGGAGCAGGG + Intergenic
1076100717 10:127775514-127775536 AAAGGCACTTCGAGGGAGGAAGG - Intergenic
1076130119 10:128008272-128008294 AAAGGCACCTGGAGGGAGGGAGG - Intronic
1076135138 10:128040484-128040506 CAGGGCGAGTGGAGGGTGGATGG + Intronic
1076157683 10:128216087-128216109 CAGGGCAGGTGGAGGGCAGAGGG + Intergenic
1076239963 10:128897336-128897358 AAGAGGAAGAGGAGGGAGGGAGG + Intergenic
1076304864 10:129458837-129458859 GAGGGAGAGAGGAGGGAGGAGGG - Intergenic
1076318891 10:129564242-129564264 AAGGGGAAGAGGAGGGGGAAGGG - Intronic
1076336598 10:129710581-129710603 AAGGGGAGGTGGATGGTGGATGG + Intronic
1076404620 10:130203731-130203753 AGGGGCAGGTGGAGGCGGGAGGG - Intergenic
1076404628 10:130203750-130203772 AGGGGCAGGTGGAGGCGGGAGGG - Intergenic
1076404636 10:130203769-130203791 AGGGGCAGGTGGAGGCGGGAGGG - Intergenic
1076404644 10:130203788-130203810 AGGGGCAGGTGGAGGCGGGAGGG - Intergenic
1076428813 10:130387473-130387495 AGAGGGAAGAGGAGGGAGGACGG + Intergenic
1077003842 11:341121-341143 AAAGGAAAGAGGAGGAAGGAGGG + Intergenic
1077159988 11:1108307-1108329 AAGGGCAGGCTGAAGGAGGAGGG - Intergenic
1077229022 11:1450460-1450482 AAAGGCCAGTGGCGGGAGGCCGG - Intronic
1077248009 11:1548480-1548502 AAGGGCCAGAGGCGGGTGGAGGG - Intergenic
1077268550 11:1664552-1664574 AAGGGAGGGGGGAGGGAGGAGGG + Intergenic
1077268567 11:1664602-1664624 AAGGGAAGGGGGAGGGAGGAGGG + Intergenic
1077272329 11:1687066-1687088 AAGGGAGGGGGGAGGGAGGAGGG - Intergenic
1077307179 11:1873636-1873658 AATGGAAGGAGGAGGGAGGAGGG + Intronic
1077412172 11:2408700-2408722 CGGGGCAGGAGGAGGGAGGAGGG + Intronic
1077522352 11:3043778-3043800 CAGGCCAAGGGGAGGAAGGAGGG + Intronic
1077876100 11:6307673-6307695 AAGGGAAATTGGATGGAAGATGG + Intergenic
1077911773 11:6578440-6578462 AAGAGAAAGTGAAGGAAGGAAGG + Intronic
1078470148 11:11580002-11580024 AAGGCCAGGTGGAGGGAGTCTGG + Intronic
1078642375 11:13108638-13108660 CAGGGCTTGTGGAGGGAAGAGGG + Intergenic
1078714709 11:13828933-13828955 TAGGGCAAGAGGAGGGAGAGTGG - Intergenic
1078984669 11:16581438-16581460 CAGGGCCTGTGGAGGGTGGAAGG + Intronic
1079105780 11:17571490-17571512 AAGGGGCAGTGAAGGGAGGAAGG - Intronic
1079152504 11:17913229-17913251 TGGGGCTAGTGGAGGCAGGATGG - Intronic
1079403015 11:20121409-20121431 AGGAGGAAGGGGAGGGAGGATGG - Intronic
1079427152 11:20354490-20354512 AAGGAAAAGTGGAAGGAGAATGG - Intergenic
1079496034 11:21045088-21045110 CAGGGCAAGTAAAGGCAGGAGGG + Intronic
1079660910 11:23035552-23035574 AAGGGGAGGTGGAAAGAGGATGG - Intergenic
1079834071 11:25309041-25309063 AGGAGCAAGAGGAGGAAGGAAGG - Intergenic
1080061803 11:27964365-27964387 CAGGGCATGTGGAGAGGGGAAGG - Intergenic
1080114569 11:28607226-28607248 GAGGGGGAGAGGAGGGAGGATGG - Intergenic
1080220217 11:29894384-29894406 AAGTGCAAGAGGTGGGAGTATGG + Intergenic
1080572263 11:33567108-33567130 CATGGCCAGTGCAGGGAGGAGGG - Intronic
1080639335 11:34149687-34149709 GAGAGAAAGTGGAGGTAGGAAGG - Intergenic
1080960805 11:37157640-37157662 AAGGACAAGATGAGGGAAGAAGG - Intergenic
1081283964 11:41245774-41245796 GCGGACAAGTGGAGGGTGGAGGG + Intronic
1082892401 11:58154095-58154117 AAGGGGAGGAGGAAGGAGGAGGG + Intronic
1083022550 11:59521698-59521720 AAGGGGAAGGGGAAGGAGAAGGG + Intergenic
1083212364 11:61196012-61196034 GGGGGCAGATGGAGGGAGGATGG - Intergenic
1083328812 11:61887365-61887387 AAGGGTAAGAGAAGGGAGGATGG - Intronic
1083887276 11:65579048-65579070 AGGGGGAAGGGGAGGGAGAAAGG - Intronic
1083951932 11:65961420-65961442 AAGTGCAAGCGCAGGGAGGCCGG + Intergenic
1084208855 11:67611691-67611713 AGGTGGAAGAGGAGGGAGGAAGG + Intronic
1084215032 11:67642489-67642511 CTGGGGAAGTGGATGGAGGAAGG - Intergenic
1084441814 11:69178957-69178979 GAGGGGAAGGGAAGGGAGGAGGG + Intergenic
1084882041 11:72178267-72178289 AAGCGCAGGTGGAAGGAAGATGG + Intergenic
1085410781 11:76289146-76289168 AAGGGGAAGAGGAGGCAGGAAGG + Intergenic
1085612512 11:77964714-77964736 AAGGGCAAGTGGAGGGAGGAAGG + Intronic
1086215206 11:84370896-84370918 GTGGGCAGGTGGTGGGAGGAGGG + Intronic
1086472084 11:87124792-87124814 AGGGGAAAAAGGAGGGAGGAAGG - Intronic
1086477834 11:87198542-87198564 AGGGGAGAGGGGAGGGAGGAGGG - Intronic
1086855926 11:91865774-91865796 CAGGGAAAGTGAAGGGAGGAGGG + Intergenic
1087006665 11:93478384-93478406 AAAGGGAAGGGGAGGGAAGAGGG + Intergenic
1087181118 11:95143625-95143647 CAGGGCCAGTGGCAGGAGGATGG + Intergenic
1087328363 11:96751015-96751037 GAGGGCAAGAGGTGGGAGGAGGG - Intergenic
1087365802 11:97217400-97217422 AGGGGAAAGTGGAAGCAGGATGG - Intergenic
1087797557 11:102470453-102470475 AAGGGCAGGGGTTGGGAGGAGGG + Intronic
1088197678 11:107293867-107293889 GAGGGCAAGAGGAAGGAGGGCGG + Intergenic
1088371142 11:109089807-109089829 ATAGGCAGCTGGAGGGAGGAAGG - Intergenic
1088461585 11:110088971-110088993 AAGAGCAGCTAGAGGGAGGATGG - Intergenic
1088651271 11:111959525-111959547 AAGGGCAAGTGGAGTGGCAAGGG - Intronic
1088686967 11:112292259-112292281 AAGGGGAAGAGAAGGGAGGGAGG - Intergenic
1088715397 11:112544379-112544401 AATGGCAATGAGAGGGAGGAAGG + Intergenic
1088735329 11:112723738-112723760 AAGGGTAAGGGGAGGGAGGATGG + Intergenic
1088751882 11:112849191-112849213 AAGGACAAGAGGAAGGAAGAAGG - Intergenic
1088796527 11:113270358-113270380 AAGGGCAAGGACATGGAGGAGGG + Exonic
1088822078 11:113464976-113464998 GAGGGGCAGTGGAGGTAGGAAGG - Intronic
1089025120 11:115260968-115260990 AAGAGCACCTGGAGGTAGGATGG - Intronic
1089085628 11:115814822-115814844 GAGACCATGTGGAGGGAGGAGGG - Intergenic
1089303376 11:117512164-117512186 AAGGGCAAGTTGCGGGGGCAGGG - Intronic
1089306861 11:117531915-117531937 AAAGGGAAGGGAAGGGAGGAGGG + Intronic
1089378597 11:118012100-118012122 TAGAGCAAGTGGGAGGAGGAGGG - Intergenic
1089396666 11:118140641-118140663 AAGGGGAAGGGGAGGGAAGATGG - Intronic
1089612535 11:119677485-119677507 AAGGAGAGGAGGAGGGAGGAGGG + Intronic
1089629142 11:119773035-119773057 CAGGGGAAGTGGAAAGAGGAGGG - Intergenic
1089678487 11:120106378-120106400 AAGGGCCAGTGAGTGGAGGAGGG - Intergenic
1090052400 11:123391157-123391179 TAGGGCAAGTGGCGGGATTATGG - Intergenic
1090569299 11:128029665-128029687 AAGGGCATCTGGGGGAAGGATGG + Intergenic
1090623552 11:128584856-128584878 AAGGGAAGGAGGAGGGAAGAGGG + Intronic
1090761468 11:129840408-129840430 ATGAGGAAGTGCAGGGAGGAGGG + Intronic
1090887579 11:130892885-130892907 AAGGGCAAGGGCAGAGAGGTGGG + Intronic
1091021514 11:132104334-132104356 GGGGGAAAATGGAGGGAGGAAGG - Intronic
1091057213 11:132430286-132430308 AGGGGGAAGAGGAGGGAGGTGGG + Intronic
1091300995 11:134508147-134508169 AAGGACAAGTGGAAGAATGAAGG + Intergenic
1091392652 12:135235-135257 AAGGGGAAATGTAGAGAGGAAGG - Intronic
1091406837 12:214433-214455 AAGGGCAAGGAGGAGGAGGAGGG - Intronic
1091658220 12:2361482-2361504 AAGGAGAAATGAAGGGAGGAAGG - Intronic
1091685853 12:2561670-2561692 AAGGCCCAGTGTAGGGAGAAGGG + Intronic
1091700186 12:2653978-2654000 AAGGGAGAAGGGAGGGAGGAAGG - Intronic
1091916587 12:4274705-4274727 CCGGGGAGGTGGAGGGAGGAGGG + Intronic
1092203756 12:6603354-6603376 GAGGGAGAGAGGAGGGAGGAGGG - Intronic
1092231586 12:6778558-6778580 AAGGGGAAGGTGAGGGAGGCTGG - Intergenic
1092436300 12:8449264-8449286 AAGAGCCAGTGGGGGGAAGAGGG + Intergenic
1092483296 12:8879986-8880008 ACAGACTAGTGGAGGGAGGAAGG + Intronic
1093141634 12:15516567-15516589 GAGGGCAGGGGGAGGGAGGAAGG + Intronic
1093322131 12:17724737-17724759 AAGGGGGAATGGAGGGTGGAAGG + Intergenic
1093459228 12:19393277-19393299 AAGGGGAAGGGGAAGGGGGAAGG + Intergenic
1093925221 12:24902826-24902848 GAGGGCAAGGCGAAGGAGGATGG + Intronic
1093943634 12:25083094-25083116 AATAGAAAGTGGAGGGCGGAAGG - Intronic
1094171261 12:27494813-27494835 AAGGCCAAAGGGAAGGAGGAAGG - Intronic
1094183455 12:27616114-27616136 AGGGAAAAGAGGAGGGAGGAAGG - Intronic
1094555704 12:31497827-31497849 AGGGGCAAGGGGAGGGGGCAGGG + Intronic
1095204183 12:39420578-39420600 AAGAGCAAGTTGAGGCAGTAAGG + Intronic
1095587018 12:43860712-43860734 GAGGAGAAGTGGAGGGAGGTGGG + Intronic
1095957403 12:47814446-47814468 AAGGGAAGGAGGTGGGAGGAAGG + Intronic
1096086106 12:48866008-48866030 AAGAGAAAGAGAAGGGAGGAAGG - Intergenic
1096412404 12:51386892-51386914 AAGGGTCAGGGGTGGGAGGAGGG - Intronic
1096469889 12:51869327-51869349 TGGGGGAAGAGGAGGGAGGAGGG + Intergenic
1096573321 12:52537294-52537316 AAGGGCAAGAGCAGGCAGGCAGG - Intergenic
1096675702 12:53224713-53224735 AGTGGCAGGAGGAGGGAGGAGGG - Intronic
1096694204 12:53338519-53338541 AAGGGGAAAAGGAGGAAGGATGG + Intronic
1096700702 12:53380704-53380726 TACGGAAAGTGGGGGGAGGAGGG - Intronic
1096855432 12:54478587-54478609 AAGGGAAAGGGGAGGAAGGAAGG - Intergenic
1097021154 12:56021597-56021619 GGCGGCTAGTGGAGGGAGGAAGG + Intronic
1097133292 12:56830163-56830185 GAAGGCAAGTGAAGGAAGGAAGG - Intergenic
1097361147 12:58659548-58659570 AAGGGCAAGTGTAGGAAGAAAGG - Intronic
1097542345 12:60956446-60956468 AAGGGGGAATGGAGGGTGGAAGG + Intergenic
1097818214 12:64098838-64098860 ATAGGCAAGTGGATGGAGGTGGG - Intronic
1097825645 12:64172448-64172470 AAGGAAAAGAGGAGGGAGGAGGG + Intergenic
1098081508 12:66790887-66790909 AAGGGGAAGGAGCGGGAGGAAGG + Intronic
1098802872 12:74984765-74984787 AAGGGCAAGTGGAGCTGGAAGGG + Intergenic
1099248045 12:80217299-80217321 GATGGGAAGGGGAGGGAGGATGG + Intronic
1099648673 12:85395531-85395553 AAGGTCTACTTGAGGGAGGATGG - Intergenic
1099849507 12:88074642-88074664 TAGGGCAGGTGAAAGGAGGATGG - Intronic
1099869624 12:88330476-88330498 AAGAGAAAGGGGATGGAGGAGGG + Intergenic
1100631943 12:96399285-96399307 AGGGGAAAATGGGGGGAGGAGGG - Intronic
1101540200 12:105658212-105658234 AAAGGTAAGTGTAGTGAGGATGG + Intergenic
1101750792 12:107581135-107581157 AAGGGCCTGCGGTGGGAGGAGGG - Exonic
1101864469 12:108510234-108510256 AAGGGCATGTGAAGGGGAGAAGG + Intergenic
1102010239 12:109613728-109613750 AAGGGCAGGTGAGGGGCGGAGGG - Intergenic
1102185507 12:110944934-110944956 AAGGGCTGGGGGAGGGAGAATGG - Intergenic
1102270945 12:111534712-111534734 AAGGGAAAGTGGAGTAAGTAGGG + Intronic
1102509442 12:113404092-113404114 AAGGGGAAGTGGAAAGAGGGAGG - Intronic
1102520871 12:113476903-113476925 AAGGGAAGGGGGAGGGAGGGAGG - Intergenic
1102786115 12:115606343-115606365 AGGGGGAAGGGGAGAGAGGAGGG + Intergenic
1103195785 12:119042674-119042696 AAGGGCAGGAAGAGGGAGGAAGG + Intronic
1103451319 12:121031397-121031419 AGGGGCAAGGAGAGGGAAGAGGG - Intronic
1103597807 12:122034835-122034857 AAGCGCAAGAGGAGTTAGGAAGG - Intronic
1103628997 12:122244064-122244086 ACGGGCAAGAGGAGGCAGGAAGG + Intronic
1103782401 12:123407719-123407741 AAGGGAAAGTGGGGCGGGGAGGG - Exonic
1103821597 12:123702995-123703017 AAGGTCAATTGGAGGAAGTAGGG - Intronic
1103956796 12:124581960-124581982 AAGGGAAAGTAGAAGGAGGTAGG + Intergenic
1104148889 12:126062601-126062623 TAGGAAAAGTGGAGGGAGGGGGG - Intergenic
1104316227 12:127704394-127704416 AAGAGGAGGAGGAGGGAGGAGGG + Intergenic
1104337902 12:127918035-127918057 AAGGACAAGGGCAGGCAGGAGGG - Intergenic
1104451660 12:128873995-128874017 AAGGGGAAGGGAAGGGAAGAAGG - Intronic
1104463379 12:128971867-128971889 AAGGGAGAGAGGAGGGAGGGAGG - Intronic
1104603458 12:130169461-130169483 CAGGGACAGAGGAGGGAGGAGGG + Intergenic
1104683862 12:130771597-130771619 GAGGCCAACTGAAGGGAGGACGG - Intergenic
1104716076 12:131017070-131017092 GGGGGCAAGTGGAGAGGGGAGGG + Intronic
1104984177 12:132587341-132587363 CAGTGCAGCTGGAGGGAGGACGG + Intergenic
1104984188 12:132587387-132587409 CAGTGCAGCTGGAGGGAGGACGG + Intergenic
1105050903 12:133049852-133049874 AAGCGGAAGTTGAGGGAGGAAGG - Intronic
1105217687 13:18298749-18298771 AAGGGAAAGTGGGGCGGGGAGGG - Intergenic
1105529722 13:21208418-21208440 AAGGTCACTTGGAGGTAGGAAGG + Intergenic
1105577415 13:21667134-21667156 AAAGGAAAGTGAAGGAAGGAAGG - Intergenic
1105764590 13:23546918-23546940 AGGGGAGAGAGGAGGGAGGAAGG - Intergenic
1105849088 13:24318660-24318682 AAGCGCAGGTGGAGAGAGGCAGG - Intronic
1106070997 13:26410784-26410806 AATGGCATGTGTAGGGAGGCAGG - Intergenic
1106251063 13:27981802-27981824 AAGGGTAAGTGGTGTGGGGATGG - Intronic
1106269280 13:28138476-28138498 AGGGGAGAGGGGAGGGAGGAGGG - Intergenic
1106573997 13:30957397-30957419 AAGGGCAAAGGGAGGGTTGAGGG + Intronic
1107282390 13:38751525-38751547 AAGGGTCTGTGGATGGAGGATGG - Intronic
1107342575 13:39423999-39424021 AAAGGCAAGGGGAAGGAAGAAGG + Intronic
1107584911 13:41835081-41835103 GAGGGTGAGAGGAGGGAGGAGGG + Intronic
1107795456 13:44046909-44046931 AAGGGGAAGGGGAAGGAGAAGGG - Intergenic
1107814533 13:44232481-44232503 AAGGCCAAGGGGAGGGACAAAGG + Intergenic
1107884564 13:44864610-44864632 AAGAGAAAGTTGAGGGGGGAGGG - Intergenic
1108281171 13:48863726-48863748 AAGGACAAGTACAGGGAAGAAGG - Intergenic
1108410778 13:50144312-50144334 AAGGCCAAATGGAGGGAAGGAGG - Intronic
1109374818 13:61478603-61478625 GAGGGTAAAGGGAGGGAGGAAGG - Intergenic
1110329331 13:74252761-74252783 ATGGGGAAGAGAAGGGAGGATGG - Intergenic
1110765655 13:79277419-79277441 AAGTGAAAGTGAAGGGAGGCTGG - Intergenic
1111006427 13:82255711-82255733 AAGGAGAGGTGGAGGGAGGGAGG - Intergenic
1111048512 13:82847072-82847094 AAGGGAGGGAGGAGGGAGGAAGG + Intergenic
1111293891 13:86255599-86255621 ATGGGAAAGTAGAGAGAGGAAGG - Intergenic
1111353784 13:87070300-87070322 AAGGGGAAGTGGAAGGGGAAGGG - Intergenic
1111462669 13:88566979-88567001 AAGGGGAAGGGAAGGGAGAAGGG + Intergenic
1111785533 13:92782071-92782093 AACGGGAAGGGGAGGGAGAAAGG + Intronic
1112135969 13:96578103-96578125 AAGGGAATGTGCGGGGAGGAAGG - Intronic
1112356463 13:98678029-98678051 ACAGGCAAGTGGAAGGAGAATGG + Intergenic
1112621510 13:101058375-101058397 AAGGGGAACTGCAGGAAGGAAGG + Intronic
1112662216 13:101523141-101523163 AAGGACAAATGGAGCTAGGATGG - Intronic
1112719338 13:102225207-102225229 AAAGGCCAGTGAAGAGAGGAGGG - Intronic
1112742638 13:102492585-102492607 TTGGGCAGGGGGAGGGAGGAAGG + Intergenic
1112845885 13:103643189-103643211 AAGGGTGAGTGGAGGGAGGTTGG - Intergenic
1112862624 13:103851290-103851312 AAGTGCAAGTGTTGGGAGGTGGG - Intergenic
1112945086 13:104918626-104918648 AAGAGAGAGTGGAGGGCGGAAGG - Intergenic
1113129821 13:107023483-107023505 AAGGGCAAGAGGAGGATGAAGGG - Intergenic
1113166272 13:107447149-107447171 AAGGAGAAGAGGAAGGAGGAAGG - Intronic
1113179788 13:107612091-107612113 GAGGGGAGGGGGAGGGAGGAAGG + Intronic
1113375196 13:109758943-109758965 AAGGGAAGGAGAAGGGAGGAAGG + Intronic
1113391878 13:109905711-109905733 AAGGGTGTGTGGAGGGAGGGAGG - Intergenic
1113395612 13:109944809-109944831 GAGGGCTATTGGAGGGTGGAGGG + Intergenic
1113433117 13:110267254-110267276 ATGACCCAGTGGAGGGAGGAGGG + Intronic
1113895052 13:113759128-113759150 AAGGGAGAGTAGAGCGAGGAAGG + Intergenic
1113975641 13:114225552-114225574 AAGGGGGAGGGGAGGGAGGGGGG + Intergenic
1114170029 14:20262884-20262906 AAGGGCAAAGGGAAGGAGGGAGG + Intronic
1114201238 14:20522618-20522640 AAGGGGAAGTGGAAGGGGAAGGG + Intergenic
1114647868 14:24265588-24265610 AAGGGCAAGGGTAGGGGGCAGGG + Exonic
1114654512 14:24308026-24308048 AAGTCCAAGGGGAGGGATGAGGG + Exonic
1114660022 14:24338132-24338154 GGGGGCACGAGGAGGGAGGAGGG + Intronic
1115288201 14:31741235-31741257 ATGGGCAAGTGCAGGGGGCAGGG + Intronic
1115294702 14:31812607-31812629 GAGGGCAAGTGGAAGCAGGGCGG - Intronic
1115657990 14:35462538-35462560 GAGGGGAAGGGGAGGGAGGAAGG - Intergenic
1115797639 14:36957178-36957200 AATGGGAAGTGGAGGAAAGAAGG - Intronic
1116029163 14:39549985-39550007 AAGGGATAGGGGAGGAAGGAGGG + Intergenic
1116133236 14:40887729-40887751 AAGACTCAGTGGAGGGAGGAAGG + Intergenic
1116217902 14:42044075-42044097 AAGGGGAAGGGAAGGAAGGAAGG + Intergenic
1116217909 14:42044094-42044116 AAGGGGAAGGGAAGGAAGGAAGG + Intergenic
1116427334 14:44807018-44807040 GAGGGGAAGGGGAGGGAAGAAGG + Intergenic
1116523800 14:45880446-45880468 AAGGGGAACTGGAAGGGGGATGG - Intergenic
1117369674 14:55065547-55065569 AAGGGCAAGTGGGGTGGGGGTGG - Exonic
1117749722 14:58908625-58908647 AAGGGTGAGGGGATGGAGGAGGG + Intergenic
1117947722 14:61047320-61047342 AAAGGGATGTGGAGGAAGGATGG + Intronic
1118233493 14:63976993-63977015 AAGGTCAAGGGGTGGGAGGGTGG + Intronic
1118663633 14:68042603-68042625 ATGGGAAAGGGGAGGGAGAAAGG - Intronic
1118982231 14:70726193-70726215 AAGGGAAGGAGGAGGGAGGGAGG + Intronic
1119184856 14:72632864-72632886 AAGGGGAGGGGAAGGGAGGAAGG + Intronic
1119505261 14:75167372-75167394 AAGAGGCAGGGGAGGGAGGAAGG - Intronic
1119771465 14:77222661-77222683 AAGGGCTGGTGGAGGGAAGCAGG - Intronic
1119913314 14:78371372-78371394 AAGGGGAGGTGGAAGGGGGATGG - Intronic
1120045064 14:79796453-79796475 AAGAGAGAGGGGAGGGAGGAAGG - Intronic
1120251541 14:82065542-82065564 AAGGGGGAATGGAGGGTGGAAGG + Intergenic
1120539708 14:85737435-85737457 AAGGGAGAATGGAGGGAGAATGG + Intergenic
1120678325 14:87449237-87449259 GAAGGGAAGTGGTGGGAGGAGGG + Intergenic
1120953975 14:90065479-90065501 AAGGGAAAGTGAATCGAGGAAGG + Intronic
1121186163 14:91971617-91971639 AAGGGGAAGGGAAGAGAGGAAGG + Intronic
1121409351 14:93738434-93738456 AAGGGGATGATGAGGGAGGAAGG + Intronic
1121468206 14:94129400-94129422 GAAGGGAAGGGGAGGGAGGAAGG + Intronic
1121617471 14:95322261-95322283 AAGGTGAAGTGCAGGGAGCAGGG - Intergenic
1121637722 14:95465169-95465191 AAGGGCAGGAGGAGGAAGGGAGG + Intronic
1121798918 14:96757215-96757237 AGGGGGAAGAGGATGGAGGAGGG + Intergenic
1121800323 14:96769123-96769145 AAGGGAGAGGGGAGGGAAGAAGG - Intergenic
1121814350 14:96917619-96917641 AAGGCCAAGTGAAGGGAGATTGG + Intronic
1121886680 14:97549517-97549539 AAGGGCAGTTGGATGAAGGAGGG - Intergenic
1121949916 14:98162812-98162834 AATAGCAAGAGGAGGGAGAAAGG - Intergenic
1122021077 14:98838491-98838513 AGGGTCTGGTGGAGGGAGGATGG + Intergenic
1122089299 14:99327653-99327675 AGCGGCCAGTGCAGGGAGGAGGG + Intergenic
1122138379 14:99647443-99647465 GTGGGCAGGTGGATGGAGGAAGG + Intronic
1122439264 14:101718918-101718940 AAGGGGAAGGGAGGGGAGGAGGG + Intergenic
1122507479 14:102240870-102240892 AAGGGGGAATGGAGGGTGGAAGG - Intronic
1122738876 14:103859458-103859480 AAGGGAAGGGGGAGGAAGGAAGG + Intergenic
1122775794 14:104116585-104116607 AAGTGAAACTGGAGGGAGGGAGG - Intergenic
1123083188 14:105705697-105705719 AAGGACGGGTGGATGGAGGATGG - Intergenic
1123687589 15:22810137-22810159 AGAGGCAGGGGGAGGGAGGAAGG + Intronic
1123799893 15:23808728-23808750 GGAGGCAAGTGGAGGGAGGTGGG + Intergenic
1123996349 15:25720558-25720580 GAGGGGAAGGGGAGGAAGGAGGG + Intronic
1124647664 15:31450409-31450431 AGGGGGAAGGGGAGGGAGAAGGG + Intergenic
1124651879 15:31480076-31480098 AAGGGTAACTGGAGGTGGGAAGG - Exonic
1124914090 15:33951412-33951434 AAGGGGTGGGGGAGGGAGGAGGG + Intronic
1125294261 15:38185198-38185220 TAGAGGAAATGGAGGGAGGAGGG + Intergenic
1125423480 15:39527421-39527443 AAGTGGAAGGGGAGGCAGGAGGG - Intergenic
1125670062 15:41465141-41465163 AAGGGAAGGGGGAAGGAGGAAGG - Intronic
1125684663 15:41556814-41556836 AAGGGGAAGTGGAAGGGGAAGGG + Intergenic
1126142501 15:45449771-45449793 GAGGGGAAGGGGAGGGAGGAGGG + Intergenic
1126430886 15:48583060-48583082 AAGGGCATGTGTAGGAAGGCTGG - Intronic
1126640321 15:50818153-50818175 AAAGGCTGGAGGAGGGAGGATGG + Intergenic
1127117029 15:55738904-55738926 AAGGGAAGGGGGAGGGAGAAAGG + Intronic
1127517808 15:59713373-59713395 AAGGGGAAGGGAAGGGAGGAAGG - Intergenic
1127867161 15:63042405-63042427 AAGGGCACGCGGAGGGCGGAGGG + Intergenic
1127872349 15:63083831-63083853 GAGGGAGAGAGGAGGGAGGAAGG + Intergenic
1128300830 15:66565456-66565478 AAGGCCAAGTGGGGAGAGGAAGG + Exonic
1128358297 15:66943546-66943568 AAGGGAAAGAAGAGGGAGGGAGG - Intergenic
1128363454 15:66979561-66979583 ATGAGAAAGGGGAGGGAGGAAGG - Intergenic
1128484258 15:68069340-68069362 ACGGGCAAAAGGAAGGAGGAGGG - Intronic
1128690259 15:69719312-69719334 ATGAGCAAGTGGAGGCTGGATGG + Intergenic
1128769054 15:70268320-70268342 ACGGGCAAGTGGAGGGTCCAAGG + Intergenic
1128777176 15:70329412-70329434 ATGTCCAAGGGGAGGGAGGAGGG - Intergenic
1128818183 15:70629551-70629573 CAGGGCTAGGGCAGGGAGGAGGG - Intergenic
1129044877 15:72725761-72725783 AAGGGGAAGAGGAAGGGGGAAGG - Intronic
1129155228 15:73713529-73713551 TAGAGCAAGAGGAGGAAGGAGGG - Exonic
1129272222 15:74424981-74425003 AACCCCAAGTGGAGGGAGGGAGG + Intronic
1129332131 15:74833148-74833170 AAGGGGAAAAGGAGGGAGGGAGG - Intergenic
1129351514 15:74958359-74958381 TAGGGCGGGTGGAAGGAGGACGG - Intronic
1129442132 15:75588976-75588998 GAGGAAAAGGGGAGGGAGGAGGG + Intergenic
1129447137 15:75626197-75626219 AAGGGCAAGTGGGGGAGCGAAGG - Intronic
1129451503 15:75653627-75653649 AGGCGAAAGAGGAGGGAGGAAGG + Intronic
1129465223 15:75721072-75721094 AAGGTCAGGTTGAGGAAGGAAGG + Intergenic
1129662112 15:77558802-77558824 AATGACAAGAGGAGGGAGGCAGG - Intergenic
1130561739 15:84964262-84964284 AAGGGCATGGGAAGGAAGGATGG + Intergenic
1130684771 15:86027340-86027362 AGGGACAGATGGAGGGAGGAAGG - Intergenic
1131014154 15:89043513-89043535 AGGAGGAAGAGGAGGGAGGAGGG + Intergenic
1131147749 15:90025118-90025140 TAGGGGACGTGGAGGGATGAGGG + Intronic
1131171158 15:90179217-90179239 AAGGGAATGGGGAGGGAGAAAGG + Intronic
1131369074 15:91864876-91864898 AGGGGCCAGTGGAGGGAGGTAGG - Intronic
1131434517 15:92412347-92412369 GAGGGGAAGAGGAGGGATGAAGG + Intronic
1131447586 15:92512766-92512788 AAGGGGGAATGGAGGGTGGAAGG - Intergenic
1131553158 15:93375131-93375153 AATGGCAAGTGGGGTCAGGAAGG + Intergenic
1131785409 15:95906591-95906613 AAGGGGAGGGTGAGGGAGGAGGG + Intergenic
1132262864 15:100441534-100441556 AAGGGGGAATGGAGGGTGGAAGG - Intronic
1132273237 15:100544599-100544621 GACGGCAGGTGGAGGGAAGAGGG - Intronic
1132327554 15:100984491-100984513 AGGGGCCAGGGGAGGGAGGGAGG - Intronic
1132543147 16:520828-520850 GAGGTCAAGTAGAGGCAGGAAGG + Exonic
1132833478 16:1941171-1941193 TGGGGCAAGCAGAGGGAGGAAGG + Intronic
1133305220 16:4804195-4804217 AAGAGGGAGAGGAGGGAGGATGG + Exonic
1133472427 16:6088500-6088522 AAGGGAAGGGGGAGGAAGGAAGG - Intronic
1133869752 16:9675938-9675960 AAGGAGAAATGGAGGGTGGAAGG + Intronic
1134059482 16:11190558-11190580 AGGGACAAGTGGAGGGAGGGGGG - Intergenic
1134225113 16:12383858-12383880 GAAGGGTAGTGGAGGGAGGAGGG - Intronic
1134307888 16:13049764-13049786 AAGTGGAGGTGGAGGCAGGAGGG - Intronic
1134351827 16:13444796-13444818 AAGGGAAGATGGAGGGAAGAGGG - Intergenic
1134523155 16:14927718-14927740 AGGGGCTAGGGGAGGGGGGAGGG - Intronic
1134549475 16:15132340-15132362 AGGGGCTAGGGGAGGGGGGAGGG + Intronic
1134648774 16:15891715-15891737 AAGGGAAAGGGCGGGGAGGAAGG - Intergenic
1134710822 16:16326369-16326391 AGGGGCTAGGGGAGGGGGGAGGG - Intergenic
1134770608 16:16806056-16806078 AAGGGGAAGGGGAAGGAGAAGGG - Intergenic
1134948779 16:18342276-18342298 AGGGGCTAGGGGAGGGGGGAGGG + Intergenic
1135025560 16:18996634-18996656 AAGGGGGAATGGAGGGCGGAAGG + Intronic
1135063502 16:19290330-19290352 GAGGGGAAGTGGAGGGAGAGAGG - Intronic
1135124854 16:19800134-19800156 ATGGGAAAGTAGAGAGAGGAAGG + Intronic
1135547812 16:23377575-23377597 AAGGGAGAAGGGAGGGAGGAAGG - Intronic
1135567511 16:23523240-23523262 AATAGCAAGTGAAAGGAGGATGG - Exonic
1135632625 16:24047962-24047984 AAGGGTGAGGGAAGGGAGGAGGG + Intronic
1135633949 16:24058088-24058110 AAGAGCAAGTGCAAGAAGGAAGG - Intronic
1135667399 16:24347368-24347390 AAGAGAAAGAGAAGGGAGGAAGG + Intronic
1135708701 16:24696773-24696795 AAGGGGAGGGGGAGGGAGGGAGG + Intergenic
1135903560 16:26489538-26489560 GAGGGCAAGGGAAGGGAAGATGG - Intergenic
1136283872 16:29230190-29230212 CAGGCCAGGTGCAGGGAGGACGG + Intergenic
1136449117 16:30342785-30342807 GAGGGCAGGTGGGCGGAGGAGGG - Intergenic
1136619714 16:31420260-31420282 AAAGGCAAGTGTAGGGCTGAAGG + Intronic
1136698206 16:32105613-32105635 AAGAGGAAAGGGAGGGAGGAAGG + Intergenic
1136932962 16:34435524-34435546 AATGGTGAGTGGTGGGAGGAGGG - Intergenic
1136971610 16:34976290-34976312 AATGGTGAGTGGTGGGAGGAGGG + Intergenic
1137802158 16:51271305-51271327 AAAGGCAAGAGGAGGGAGAATGG - Intergenic
1138203078 16:55104527-55104549 AAGGGCTTGTGGAGGGTGCAAGG + Intergenic
1138242221 16:55436276-55436298 ATGGGCCAGAGGAGAGAGGAGGG + Intronic
1138600538 16:58051522-58051544 AAGGAGAAAGGGAGGGAGGAAGG + Intergenic
1138637406 16:58352143-58352165 AAGGGCAGGGGGAGGGAAGAGGG - Intronic
1139060948 16:63250702-63250724 GAGGGGAAGGGGAAGGAGGAGGG + Intergenic
1139225740 16:65232253-65232275 AAGTGAAAGTGGAGAGAGGCTGG + Intergenic
1139648191 16:68347107-68347129 CTGGGCAAGTGGAGTGAGAAGGG + Intronic
1139893601 16:70270474-70270496 AGAGGGAAGTGGAGGGAGAAAGG + Intronic
1140107379 16:71973176-71973198 CTGGGCAAAAGGAGGGAGGAGGG - Intronic
1140186612 16:72778707-72778729 CAGGGGAAGTGAAGGGAGAAGGG + Intergenic
1140200006 16:72887483-72887505 AATGGAAGGTGGAGGGAGGAAGG + Intronic
1140230201 16:73111729-73111751 AAGGACAGAGGGAGGGAGGAAGG + Intergenic
1140230456 16:73113240-73113262 CAGAGGAAGTGAAGGGAGGAAGG + Intergenic
1140251971 16:73302235-73302257 AAGAGAAAGAGAAGGGAGGAAGG - Intergenic
1140435499 16:74943644-74943666 AAGGGCAGGAGGAGACAGGAAGG - Intronic
1140603504 16:76506442-76506464 AAGCGGAAGGGGAGGGAAGAAGG - Intronic
1140765767 16:78155268-78155290 AAGGGAAAGGGAAGGAAGGAAGG + Intronic
1140962590 16:79930901-79930923 AAGGCCAAGTGGATGGATGATGG - Intergenic
1141002316 16:80319431-80319453 AAGGGCAACTGGATGGTGGCAGG + Intergenic
1141190897 16:81823939-81823961 AAGGGAAAGGGAAAGGAGGAAGG - Intronic
1141372442 16:83500480-83500502 AGGGGGAGGAGGAGGGAGGAAGG - Intronic
1141447638 16:84072301-84072323 AAGGGCTGGTGGAAGGAAGAAGG + Intronic
1141503898 16:84462410-84462432 CAGAGCACGTGCAGGGAGGAAGG + Intronic
1141521605 16:84583830-84583852 AAGGAGAAGTGGAGGTGGGAAGG - Intronic
1141585023 16:85027981-85028003 AGGGGCGCGGGGAGGGAGGAGGG + Intronic
1141621313 16:85238042-85238064 TAGGGGCAGTGGAGAGAGGAGGG + Intergenic
1141696852 16:85624265-85624287 CAGGGCCTCTGGAGGGAGGAAGG + Intronic
1141812312 16:86383698-86383720 GAGGGAAAGGGAAGGGAGGATGG + Intergenic
1141934776 16:87229953-87229975 AAGGGCAAGGACAGGGAGGCAGG - Intronic
1142046309 16:87927275-87927297 GAGGGCAGGTGGGTGGAGGAGGG + Intronic
1142547380 17:714489-714511 AAGGGAAAGTGGAGGTGGGGAGG - Intronic
1142567730 17:851461-851483 AAGGGCAGGTGGAAAGAGCAGGG + Intronic
1142621636 17:1169100-1169122 AGGGGAAAGAGGAGGGAGGGAGG + Intronic
1142836881 17:2593914-2593936 GAGGGAGAGGGGAGGGAGGAAGG - Exonic
1142864044 17:2779687-2779709 AAGGAGGAGTGGAGGGAGGGTGG + Intronic
1142871698 17:2825312-2825334 TTGGGCAAGAGGAGGGAGAAGGG + Intronic
1142902870 17:3024134-3024156 AAGGGCAGGTGGAGAAGGGAAGG + Intronic
1143021231 17:3918070-3918092 AAAGGGAAGGGAAGGGAGGAAGG + Intergenic
1143085496 17:4413079-4413101 CAGGGCAGGAGGAAGGAGGACGG - Intergenic
1143498312 17:7324822-7324844 GAGGGCAACTGGAGGTAGGCAGG + Exonic
1143687978 17:8534531-8534553 AAGGGCAAATGGAAGCAGGCAGG - Intronic
1143701118 17:8660913-8660935 AAGAGAAAGAAGAGGGAGGAAGG - Intergenic
1143816771 17:9522772-9522794 AAGGGCAAGAGGTTGGGGGAAGG + Intronic
1144459470 17:15446445-15446467 AAGGGCAATGGGAGTGGGGAGGG + Intronic
1144631876 17:16877720-16877742 AAATGCAAGTGGAGACAGGATGG - Intergenic
1144754235 17:17669714-17669736 AAGGGAGGATGGAGGGAGGAGGG - Intergenic
1145226589 17:21133786-21133808 AAGAGAAAATGGGGGGAGGAAGG + Intronic
1145736959 17:27239899-27239921 AAGGGCAGGGGGCGGGAGGGAGG - Intergenic
1145984720 17:29037749-29037771 GGGGGCAAAGGGAGGGAGGATGG + Intronic
1146006282 17:29162740-29162762 ATGGGCAGGTGGAAGGATGATGG + Intronic
1146904276 17:36608208-36608230 AAGGACAAGGGAAGAGAGGACGG - Intronic
1147050143 17:37788239-37788261 AAGGGGAGAGGGAGGGAGGAGGG - Intergenic
1147122573 17:38344175-38344197 AAGGGCAGGCAGAGGGAGGGAGG - Intergenic
1147200443 17:38798318-38798340 AAGAGCAAGTGGTTGGAAGAGGG + Intronic
1147315592 17:39618628-39618650 AAGGGCCAGTGGCGGCGGGAAGG + Intergenic
1147367491 17:39968702-39968724 AAGGGCAAGAGGAGTGAAGAGGG + Intronic
1147890048 17:43710781-43710803 AAGGGCAAAGAGAGGGAGAAAGG + Intergenic
1147969628 17:44212492-44212514 AGGGGCAGGGGGAGGGGGGAAGG + Intronic
1147985745 17:44307043-44307065 AAGAGCAAGATGATGGAGGAGGG + Intergenic
1148109567 17:45136953-45136975 CAGGGCAGGAGCAGGGAGGAAGG + Intronic
1148467564 17:47874023-47874045 AAGAGGAAGAGGAAGGAGGAGGG - Intergenic
1148467570 17:47874057-47874079 GAGGGAAGGAGGAGGGAGGAAGG - Intergenic
1148476433 17:47931785-47931807 AAACACAGGTGGAGGGAGGAAGG - Intergenic
1148482811 17:47971128-47971150 AAGCGGAAGTGGAGGAAAGATGG + Intronic
1148551235 17:48551832-48551854 GAGGGCAGCTAGAGGGAGGAGGG + Intronic
1148777256 17:50102566-50102588 AGGGGCAGGTGGGGAGAGGAGGG - Intronic
1148852122 17:50560504-50560526 AGGGGCAAGGGGAGGGGAGAGGG + Intergenic
1148887822 17:50786463-50786485 CAGGGTAGGAGGAGGGAGGATGG + Intergenic
1148911182 17:50944065-50944087 AAGGGCAAGTGGAGAGCAGGTGG + Intergenic
1149361960 17:55904515-55904537 AAGGGAGAGTGATGGGAGGAAGG - Intergenic
1149369076 17:55975217-55975239 AAGGAAAAGTGTAGTGAGGAAGG + Intergenic
1149477725 17:56977173-56977195 AAGGGCGAGGGGAGGGAGAAAGG + Intergenic
1149937159 17:60819707-60819729 AAGGGGAGGGGAAGGGAGGAAGG - Intronic
1149950986 17:60985659-60985681 AAAGGGTAGTGGAGGGAGGAGGG - Intronic
1150217293 17:63477681-63477703 CCGGGCGAGTGGAGGGTGGATGG - Intergenic
1150407674 17:64916679-64916701 GAGGCCAAGAGGTGGGAGGATGG + Intronic
1150465196 17:65386681-65386703 AAGAGAAAGAGGAAGGAGGATGG - Intergenic
1150557126 17:66264337-66264359 AATGGGAAGTGGAAGGAGCAAGG + Intergenic
1150645725 17:66976445-66976467 GAGGGAAGTTGGAGGGAGGAGGG - Intronic
1150786259 17:68165371-68165393 GAAGGGAAGGGGAGGGAGGAGGG + Intergenic
1150977812 17:70108788-70108810 AAGGAGAAAGGGAGGGAGGAAGG - Intronic
1151172640 17:72260040-72260062 AGGGGCAGGTGGAGGGCGGTGGG + Intergenic
1151228877 17:72667519-72667541 GAGGGCAAGTGCAGGGTGCATGG + Intronic
1151235576 17:72717537-72717559 AGGGACACGTGGAGGGAAGACGG - Intronic
1151360579 17:73586269-73586291 AAGAGCAACAGGAGGGAGGGAGG - Intronic
1151519580 17:74618614-74618636 AAAGGCAGATGGTGGGAGGAGGG - Intronic
1151706560 17:75772061-75772083 AAGGCCAAGTTGAGCAAGGAGGG - Intergenic
1151784441 17:76268500-76268522 AGGGAGTAGTGGAGGGAGGAGGG + Intronic
1151824983 17:76519185-76519207 AAGGTCAGTGGGAGGGAGGATGG - Intergenic
1151837688 17:76594245-76594267 TGGGGCAGGTGGAGGGTGGAGGG - Intergenic
1151924558 17:77185244-77185266 AAGAGAATGTGGAGGGAGTAAGG + Intronic
1152126412 17:78450017-78450039 CAGGGGAAGAGCAGGGAGGAGGG + Intronic
1152244654 17:79178957-79178979 ACTGGCCAGCGGAGGGAGGAGGG - Intronic
1152261586 17:79270119-79270141 AATGGCAAAGGGAAGGAGGACGG - Intronic
1152301010 17:79495397-79495419 AAGGGCACAAGGAGGTAGGAAGG + Intronic
1152368320 17:79870220-79870242 GAGGGGAAGTGGGAGGAGGAAGG - Intergenic
1152423268 17:80205283-80205305 GAGGGAAGGAGGAGGGAGGAAGG - Intronic
1152425611 17:80217006-80217028 AGGTGCAAGGGGCGGGAGGAGGG - Intronic
1152436447 17:80279155-80279177 AAAGGCAAGTGGAAGGATGTGGG - Intronic
1152466905 17:80471654-80471676 AAGGGGAAGAGGAGCAAGGAGGG - Intronic
1152609221 17:81307449-81307471 AAGGGGAAGGGGAAGGGGGAGGG - Intergenic
1152609255 17:81307532-81307554 AAGGGGAAGGGGAAGGGGGACGG - Intergenic
1152740423 17:82016174-82016196 AGAGGCCAGAGGAGGGAGGACGG + Intronic
1152811912 17:82386322-82386344 AGGGGAAGGCGGAGGGAGGACGG - Intergenic
1152811966 17:82386513-82386535 AGGGGAAGGCGGAGGGAGGATGG - Intergenic
1152859083 17:82685215-82685237 ATGGGGAGGGGGAGGGAGGACGG + Intronic
1153647216 18:7205963-7205985 AAAGGAAAGGGGAGGGAGGGAGG - Intergenic
1154095775 18:11413744-11413766 AAGGGGAAGGGAAGGGAGGAAGG - Intergenic
1154350987 18:13583325-13583347 AAGGTGAGGTGGAGAGAGGATGG + Intronic
1154415166 18:14172297-14172319 AAGGGCAAGGGTAGGGGGCAGGG + Intergenic
1155058225 18:22204248-22204270 AAGGGGAAGGGAAGGGAAGAAGG - Intergenic
1155243942 18:23889641-23889663 AAGAGGAAGGGAAGGGAGGAGGG + Intronic
1155453019 18:25982726-25982748 AACGGCCCATGGAGGGAGGAGGG - Intergenic
1155545152 18:26907053-26907075 AAGGGCAGCTGTATGGAGGATGG + Exonic
1155630571 18:27887621-27887643 GAGGGAAAGAGGAGGGAGGGAGG - Intergenic
1156187365 18:34678510-34678532 AAGGAAAAGTGTGGGGAGGAGGG - Intronic
1156346295 18:36259996-36260018 AAGAGTAAGTAGGGGGAGGATGG - Intronic
1156461903 18:37326020-37326042 AAGGACCAGGGGAGGGAGGAAGG - Intronic
1156546099 18:37965191-37965213 AGGGGAAAGGGGAGGGAGGGAGG - Intergenic
1157084544 18:44565802-44565824 GAGGGAAAGAGGAGGGAGAAAGG + Intergenic
1157210273 18:45736104-45736126 AAGAGCAAGTGGAGGGACAAAGG + Intronic
1157333316 18:46719339-46719361 AAGGGCAAGAGGAGTGAGAAAGG + Intronic
1157428088 18:47601356-47601378 AAGAGAAAGGGAAGGGAGGAGGG - Intergenic
1157484351 18:48076412-48076434 GAGGGTAAGGGGAGGGAGGTGGG + Intronic
1157614695 18:48979508-48979530 CTGGGCACCTGGAGGGAGGAAGG + Intergenic
1157810776 18:50694271-50694293 ACGTGCATGAGGAGGGAGGATGG - Intronic
1158155726 18:54423378-54423400 AAGGGAAAAAGGAGGGAGGGAGG + Intergenic
1158406596 18:57165464-57165486 AGGGGCAGCTGGATGGAGGAGGG - Intergenic
1158425769 18:57338571-57338593 AAGGGAAGGTGGAGGGAATAGGG - Intergenic
1158500406 18:57995748-57995770 AAGGACAGGAGGAGGGAGGGAGG + Intergenic
1158576848 18:58645435-58645457 AAGGGAGAATGGAGGGTGGAAGG + Intergenic
1158875266 18:61728141-61728163 CAGGGCGGGAGGAGGGAGGAGGG - Intergenic
1158931134 18:62325607-62325629 AAGGGCAAGCGGAGGGAAACTGG + Intronic
1160356086 18:78229524-78229546 AAGGGAGGGAGGAGGGAGGAAGG - Intergenic
1160544970 18:79647215-79647237 AAGGAAAGGGGGAGGGAGGAAGG + Intergenic
1160851361 19:1194514-1194536 CAGGGCAAGAGGCAGGAGGAGGG - Intronic
1160975533 19:1790549-1790571 GAGGGGCAGTGGAGGGAGAAGGG - Intronic
1161198879 19:3003222-3003244 GAGGGAGAGAGGAGGGAGGAGGG + Intronic
1161242446 19:3229844-3229866 AAGCTCAGGTGCAGGGAGGATGG + Intronic
1161285267 19:3465128-3465150 AAGAGGAAGTGGGGGGTGGAGGG - Intronic
1161711828 19:5853036-5853058 AAGGGGGAATGGAGGGCGGAAGG - Intergenic
1161717776 19:5886498-5886520 CACAGCAAGTGGAGGGAGGCTGG + Intronic
1161733214 19:5974933-5974955 GATGGCAAATGGATGGAGGAGGG + Intronic
1161845254 19:6708500-6708522 AAGGAGGAATGGAGGGAGGAAGG - Intronic
1161918740 19:7250353-7250375 AAGGGAAAGAGGAAGGAGGAGGG + Intronic
1162032751 19:7924593-7924615 AGGGGCAAGTGGCAGGAGGGCGG + Exonic
1162064546 19:8117160-8117182 AAGGGCATGTGCAGGTAGGTGGG - Exonic
1162194372 19:8972951-8972973 AGGGGGAAGTGGAAGAAGGATGG + Exonic
1162344733 19:10112544-10112566 AAGGGAGAGTGGAGGCACGAGGG + Intronic
1162413712 19:10521272-10521294 AAGGGCAGGGGGAGTGAGGAGGG - Intergenic
1162450803 19:10753385-10753407 AAGGGAAGGGGGAGGGGGGAAGG - Intronic
1162450814 19:10753404-10753426 AAAGGGAAGTGGGGGGGGGAAGG - Intronic
1162500786 19:11052469-11052491 ATGGCCAGGTGGAGGAAGGAGGG - Intronic
1162583575 19:11545482-11545504 CAGGGAAGGTGGAGGGAGGGGGG + Intronic
1162690508 19:12426029-12426051 AAGGGAAAGGGGAAGGAGAAGGG + Intronic
1162733096 19:12730677-12730699 ATGGCTAAGGGGAGGGAGGAGGG + Exonic
1162861009 19:13505870-13505892 GAGGGGAGGCGGAGGGAGGAGGG + Intronic
1162984093 19:14258280-14258302 AAAGGGAAGGGGAGGGAGGCGGG - Intergenic
1163083799 19:14964223-14964245 AAGGGCAAGAGGCGGGAGGAAGG - Intronic
1163290404 19:16376047-16376069 AGGGGCACGTGTAGGCAGGAGGG + Intronic
1163350987 19:16777035-16777057 AAAGGGAACTGGAGGGAAGAGGG + Intronic
1163453990 19:17395234-17395256 AACAGGAAGAGGAGGGAGGAGGG - Intergenic
1163760805 19:19135436-19135458 AAAGGGAAGAAGAGGGAGGAGGG - Intronic
1164202644 19:23031268-23031290 AAGGGGGAATGGAGGGTGGAAGG + Intergenic
1164258613 19:23550495-23550517 AAGGGGGAATGGAGGGTGGAAGG - Intronic
1164544855 19:29151867-29151889 AAGGGAAAGGGAAAGGAGGAAGG + Intergenic
1164731026 19:30504507-30504529 GGGGGCAGGAGGAGGGAGGAAGG - Intronic
1164734250 19:30529029-30529051 AAGGGCGAGGGGAGGGGTGAAGG + Intronic
1164866846 19:31611510-31611532 AAGGGAAAGGAGAGAGAGGAGGG + Intergenic
1164957815 19:32402238-32402260 AAGAGAAAGAGAAGGGAGGAGGG + Intergenic
1164980809 19:32612676-32612698 AAAGGCAAGTCACGGGAGGAAGG + Intronic
1165176516 19:33934388-33934410 AAGGGAAGGTGGAGGGGTGATGG + Intergenic
1165180445 19:33963011-33963033 AAAGCCAAGTTTAGGGAGGATGG + Intergenic
1165332817 19:35150798-35150820 GAGGGCAATGGGCGGGAGGAGGG + Intronic
1165699911 19:37929662-37929684 AAGGGTAGGAGGAGGGGGGAGGG - Intronic
1165910286 19:39221805-39221827 AAGGGGAAGGGAAGGGAGGAAGG - Intergenic
1166052754 19:40270169-40270191 AAGGGTAAGGGGAGGTAGGGTGG - Intronic
1166147248 19:40846121-40846143 GAGGGCAAGAGGAGTGAGGTTGG - Intronic
1166151400 19:40878017-40878039 GAGGGCAAGAGGAGTGAGGTTGG - Intronic
1166155893 19:40910711-40910733 GAGGGCAAGAGGAGTGAGGTTGG - Intergenic
1166318764 19:42003590-42003612 AAGCGCAAGTGGTGGGAGGGGGG - Exonic
1166813364 19:45527194-45527216 AGGGGCATGGGGAGGGAGGCTGG - Intergenic
1166981883 19:46635841-46635863 AAGGGGAAATGGAGGAAGGGGGG + Intergenic
1167095896 19:47375036-47375058 ACGACCAAGTGGAGAGAGGAGGG - Intronic
1167175310 19:47860610-47860632 AGGGGAAAGTAGGGGGAGGAGGG - Intergenic
1167272242 19:48511926-48511948 AAGGGTGGGAGGAGGGAGGATGG + Intronic
1167698387 19:51027890-51027912 AAGGGAAACTGGAGGAGGGAGGG - Intronic
1167786613 19:51643135-51643157 AAGGGCAGGTGGAGAGGGGATGG + Exonic
1168063286 19:53906149-53906171 ACAGGCAAATGGAGGGAGGAAGG - Intronic
1168348311 19:55661366-55661388 GAGGGGAAGAGGAGGGAGGGAGG - Intronic
1168464866 19:56594530-56594552 ATGGGTAAGGAGAGGGAGGAGGG - Intergenic
1168592896 19:57651775-57651797 AAGGGAAAGTGGTAGGAAGACGG - Intergenic
1168697117 19:58409779-58409801 AAGGGTATGTGTAGGGAGTAAGG + Intronic
924965580 2:73526-73548 AAAGGCAAGTGAAGGGAGGAGGG + Intergenic
924969321 2:109680-109702 AAGGGGAAAGGGAGGAAGGAAGG + Intergenic
925056863 2:863063-863085 AAGAGAAGGTGGAGGGAGGAAGG - Intergenic
925068649 2:950179-950201 AAGGGAGGGTGGAAGGAGGAGGG + Intergenic
925068952 2:951141-951163 GAGGGGGCGTGGAGGGAGGAGGG - Intronic
925130154 2:1488785-1488807 AAGGGCCAGGGGACAGAGGAAGG - Intronic
925192756 2:1898799-1898821 TCGGGCAGGTGGAGGGAAGAAGG + Intronic
925363340 2:3294835-3294857 GAGGGTATGTGGAGAGAGGATGG - Intronic
925372940 2:3360932-3360954 AAGGGGAGGAGAAGGGAGGAGGG + Intronic
925683996 2:6453082-6453104 AAGGGGAAGGGAAGGGAAGAAGG + Intergenic
925862223 2:8190415-8190437 AAAGGAAAAGGGAGGGAGGATGG - Intergenic
925871111 2:8271555-8271577 AATGGCAAGTGTTGGGAGGCTGG + Intergenic
925901579 2:8512974-8512996 CAGGGCAAGGGCAGGGAGGGTGG - Intergenic
925921057 2:8638270-8638292 AGGGGCACGGGGAGGGAAGAGGG - Intergenic
925927587 2:8681672-8681694 AAGGGGGAGGGGAAGGAGGAGGG - Intronic
926429152 2:12768089-12768111 GAGAGCAAAAGGAGGGAGGAAGG + Intergenic
926527378 2:13997959-13997981 AAGGGAAAATGGAGGGAGAAAGG + Intergenic
926702000 2:15810065-15810087 GAGGGCAAGAGGAAAGAGGAGGG - Intergenic
926725482 2:15994233-15994255 AAGGGGAAGGGAAGGGAGGAAGG - Intergenic
926728646 2:16018049-16018071 AAGGGGAAGGGAAGGAAGGAAGG - Intergenic
926794595 2:16608473-16608495 ATGGCCAAGTGGAATGAGGACGG + Intronic
926800057 2:16652425-16652447 TACGGCAAGGGGAGAGAGGATGG - Intronic
926974050 2:18495497-18495519 AAGGGGAAGGGGAGGAAGGAAGG - Intergenic
927000627 2:18791027-18791049 AAAGGGAAGGGGAGGAAGGAAGG - Intergenic
927287483 2:21371619-21371641 AAGGGGAAGGGAAGGGAAGAAGG + Intergenic
927412065 2:22837933-22837955 AAGGGCATGGGGAGGGAGCCTGG + Intergenic
927468242 2:23352527-23352549 AAGGGGAAAGAGAGGGAGGATGG + Intergenic
927521435 2:23701108-23701130 ATGGGAAGGTTGAGGGAGGAGGG - Intronic
928127981 2:28629214-28629236 AAGGGCACCTGGGGTGAGGAGGG + Intronic
928274088 2:29883083-29883105 AAGGGAGAGAGGAAGGAGGAAGG + Intronic
928465927 2:31522318-31522340 CAGAGAAAGTGGAGGAAGGAGGG - Intergenic
928789030 2:34928825-34928847 AAGGACGAGAGAAGGGAGGAAGG - Intergenic
929249552 2:39737906-39737928 GGTGGGAAGTGGAGGGAGGAGGG + Intronic
929481232 2:42310329-42310351 AAGGGGAAGGGGAAGGAGAAGGG - Intronic
929602542 2:43213350-43213372 AAGTGCCAGTGGAGAGGGGAAGG - Intergenic
929778885 2:44944773-44944795 GAGGGGAAGGAGAGGGAGGAGGG - Exonic
930217223 2:48709142-48709164 AAGGGTAAGTGGAGGGAAAGTGG + Intronic
930556787 2:52906260-52906282 AAGGGGAAGTAGAAGGAGGCTGG - Intergenic
930752757 2:54948618-54948640 AAGGTTAAGCAGAGGGAGGAGGG + Intronic
931169832 2:59790974-59790996 AAGGGAAAGGCGAGGGAGGCTGG + Intergenic
931340722 2:61398440-61398462 AGGGGAAAGTGGGGGAAGGACGG + Intronic
931390104 2:61834351-61834373 GAGGGAGAGTGGAGGGAGGAGGG + Intronic
931543873 2:63359078-63359100 GAGGGAAAGTGGAAAGAGGAAGG - Intronic
931784530 2:65607498-65607520 AAGGGGATGAGGAGGGTGGAGGG + Intergenic
931826297 2:66004184-66004206 AAGGGGAAGGGGAAGGAGAAGGG - Intergenic
931884377 2:66599769-66599791 AAGAGCAAGGAGAGGGTGGAAGG - Intergenic
931926052 2:67073734-67073756 TTGGGCAGGTGGAAGGAGGAAGG - Intergenic
932180511 2:69642750-69642772 CAGGGCAAGTGAAGGGGGAAGGG + Intronic
932304965 2:70695498-70695520 AAGTGCAGTGGGAGGGAGGAGGG - Intronic
932337982 2:70941930-70941952 AAGGCCAAGGAGAGGGTGGAAGG + Exonic
932539370 2:72636274-72636296 AAGGAAAAATGGAGGGAAGAAGG + Intronic
932626713 2:73302236-73302258 AAGGGCAAGTGGGGTCAGGCTGG + Intergenic
932742904 2:74305692-74305714 AAAGGGAGTTGGAGGGAGGAAGG - Intronic
933734750 2:85486876-85486898 GAGGGGAAGGGAAGGGAGGAGGG + Intergenic
934051492 2:88215074-88215096 AACAGCAAGAGGTGGGAGGAGGG - Intergenic
934087749 2:88524674-88524696 AAGGGCACCTGGAGGTGGGAGGG + Exonic
934161643 2:89255162-89255184 AAGCTATAGTGGAGGGAGGAGGG + Intergenic
934205641 2:89927253-89927275 AAGCTATAGTGGAGGGAGGAGGG - Intergenic
934296621 2:91747902-91747924 AAGGGAAAGTGGGGCGGGGAGGG + Intergenic
935063286 2:99626527-99626549 AAGGGAGAAGGGAGGGAGGAAGG - Intronic
935253090 2:101282822-101282844 ACAGCCCAGTGGAGGGAGGAGGG - Intronic
935480558 2:103582984-103583006 AAGGAGAAAGGGAGGGAGGAAGG - Intergenic
935546457 2:104404873-104404895 CAGGGCAAGTGAAGGGAGATTGG + Intergenic
936233643 2:110725220-110725242 AAGGAGGAATGGAGGGAGGAAGG + Intergenic
936350623 2:111710030-111710052 AAGGGCAAGTGGAAGAAGCCAGG - Intergenic
936476999 2:112848122-112848144 AAAGGAAGGAGGAGGGAGGAGGG - Intergenic
936528361 2:113257698-113257720 AAGAGGAAGTGGGGGAAGGAGGG + Intronic
937062786 2:118992732-118992754 AAGGGAAAGGGGAGGAAGGGAGG - Intronic
937348504 2:121143444-121143466 GAGGGCAAGGGGAGGGAGAGTGG + Intergenic
937905030 2:127049017-127049039 AAGGGCAAGTCGAAGTTGGAGGG - Intronic
938043416 2:128095389-128095411 AAGGGGAAGGGGAAGGAGAAGGG - Intronic
938670384 2:133580976-133580998 AAGGGAAAGAGGAAGGAGGTTGG - Intergenic
938849660 2:135247850-135247872 AAGGGAGTGTGGAGGGTGGAAGG + Intronic
940216145 2:151305426-151305448 AAGGGGAAGGGGAAGGAGAAGGG + Intergenic
940216666 2:151310066-151310088 AAGGAGGAGTGGAGGGTGGAAGG - Intergenic
940492603 2:154382931-154382953 AATGGCAAGTGCAGAGAGGTGGG + Intronic
941038188 2:160590504-160590526 AAGGGGGAGGGGAGGGGGGAGGG - Intergenic
941234003 2:162946579-162946601 AAGGGGAAGGGGAGGGGGAAAGG + Intergenic
941336041 2:164245073-164245095 AAGGGAAACAGGAGGAAGGAAGG - Intergenic
941809214 2:169738953-169738975 AAGGGGGAGGAGAGGGAGGAGGG - Intronic
941868832 2:170362334-170362356 AAGCTCAAGTGAAGGTAGGACGG - Intronic
942322359 2:174746760-174746782 AAGGGCTGGTGGTGGGTGGAAGG + Intergenic
942570907 2:177313364-177313386 AAGGGAAAGAAGAGGAAGGAAGG - Intronic
942809683 2:179983250-179983272 AAGGGAGAGTGGAGGGTGGGAGG - Intronic
942891273 2:180991815-180991837 AAGCCCAAGTGGATGGAGCAGGG + Intronic
943063584 2:183063817-183063839 AAGGGGAAGGGAAGGAAGGAAGG - Intergenic
943395720 2:187330076-187330098 AGAGGAAAGTGGAGGGAAGAGGG + Intergenic
943669461 2:190646560-190646582 TGGGGGAAGTGGTGGGAGGAAGG - Intergenic
943921522 2:193713239-193713261 AAGGGGAAGGGGAGGGGGAAGGG - Intergenic
944154857 2:196598203-196598225 AAGGGAAGGGGAAGGGAGGAGGG + Intergenic
944154897 2:196598284-196598306 AAGGGAAGGGGAAGGGAGGAGGG + Intergenic
944455923 2:199893971-199893993 AAAGGCATGTGGGGGTAGGAAGG - Intergenic
944523820 2:200598127-200598149 GAGGGAGAGAGGAGGGAGGAAGG + Intronic
944617400 2:201475854-201475876 AAGTGAAAATTGAGGGAGGAAGG + Intronic
944687180 2:202127960-202127982 AGGGGCTAGGGGAGGGAGGAGGG - Intronic
944701499 2:202250160-202250182 AAGGGCAAGAGGACAGAGGTGGG + Intergenic
945884484 2:215360520-215360542 AAGGAAAGGTGGAGGGAAGAAGG + Exonic
946147583 2:217742647-217742669 AAAGGCAGGTGGAGACAGGATGG - Intronic
946187843 2:217991175-217991197 AGGGTCCAGAGGAGGGAGGAGGG + Intronic
946254016 2:218430249-218430271 AAGGAGAAATGGAGGGAGGCTGG + Intronic
946426644 2:219601959-219601981 CAAGGAAAGAGGAGGGAGGAAGG - Intronic
946553085 2:220823842-220823864 AAGAGGAAGGGGAGGGAGGAAGG - Intergenic
946604356 2:221386681-221386703 AAGGGCTAGTTAAGGTAGGAAGG - Intergenic
947139520 2:227008364-227008386 AAGGCCAGATGGAGGAAGGAAGG - Intronic
947143307 2:227040239-227040261 AAAGGCAGGTGGAAGGAGAAAGG + Intronic
947559690 2:231137694-231137716 ACTGGGAACTGGAGGGAGGAGGG - Intronic
947736776 2:232459300-232459322 AAGGGGATGCGGAGGGAAGAAGG - Exonic
947873621 2:233453693-233453715 GAGGGCAAGTGGATGAAGGGAGG - Intronic
947909212 2:233790572-233790594 AAAGGGGAGGGGAGGGAGGAAGG - Intronic
948009786 2:234642300-234642322 AAGGTCCAAGGGAGGGAGGAGGG + Intergenic
948041575 2:234905652-234905674 AAGGGAAAGGGAAGGAAGGAAGG + Intergenic
948336402 2:237210817-237210839 AAGGGCAAGGACATGGAGGAAGG + Intergenic
948540793 2:238690310-238690332 AACGGCCAGTGGGGGGAGGGGGG - Intergenic
948705310 2:239788441-239788463 AAGGGAAAGTGAAGGGAGAAAGG - Intronic
948756493 2:240162577-240162599 CAGGGCGGGTGGAGGGAGGCGGG + Intergenic
948859084 2:240744227-240744249 TGGGGCACGTGGTGGGAGGAGGG - Intronic
948890399 2:240904624-240904646 CAGGGCGGGTGGAGTGAGGAAGG - Intergenic
1168955980 20:1834691-1834713 AAGGGTGAGAGGAGGGAGAAGGG + Intergenic
1169178619 20:3542548-3542570 AAGGGGAGGTGGAAGGGGGAAGG - Intronic
1169208456 20:3752892-3752914 AAGAGCAGCTGGAGGGTGGATGG + Exonic
1169227107 20:3863818-3863840 CAGGGCAAGGGGTGGCAGGATGG - Intronic
1169289847 20:4339978-4340000 AAGGGTAAGTGGTGGGATGTTGG + Intergenic
1169655248 20:7915371-7915393 AAGGGAAAGGGGAAGGAGAAGGG + Intronic
1169664599 20:8019817-8019839 AACGGCAAGTGGAGGCGGGAGGG - Exonic
1170607287 20:17883654-17883676 AGGGGCAAGGGGAGGGAGAAGGG + Intergenic
1170934330 20:20796719-20796741 CAGGGTATGTGGAGGCAGGATGG + Intergenic
1171304269 20:24091899-24091921 CAGGGAAAGGAGAGGGAGGAGGG - Intergenic
1171474518 20:25397830-25397852 AAGGGAAAGGGGAAGGGGGAAGG + Intergenic
1171937288 20:31286832-31286854 AAGTGGAAGTGGAGGAAAGATGG - Intergenic
1172062019 20:32193199-32193221 GAGGGCAGGTGGAGAGAGGACGG + Exonic
1172224436 20:33295914-33295936 AAGGGAAAGGGAAGGAAGGAAGG + Intronic
1172254848 20:33508572-33508594 ATGGGAAAGTGGAGGGTGGGAGG - Intronic
1172292132 20:33784120-33784142 ATGGGGAAGAGGAGGGAGAAGGG - Intronic
1172759734 20:37313743-37313765 AGGGGCCCGAGGAGGGAGGAGGG + Intronic
1172872786 20:38146396-38146418 CAGAGCAAGTGGTGGGAGGGAGG + Intronic
1173337513 20:42124844-42124866 AAGGGGAAATGGAGGGACAAAGG - Intronic
1173564827 20:44031160-44031182 AAGGGCAGGTGGGGGAAGGTGGG + Intronic
1173698403 20:45043844-45043866 AGGGGAAAGTGGAAGGAGGGAGG - Intronic
1173827044 20:46054816-46054838 AAGGCCAAGGGAAGGAAGGAAGG - Intronic
1174066660 20:47870736-47870758 AAGGCAAAGAGGAGGGAGGAAGG + Intergenic
1174179530 20:48666128-48666150 AACGGGAAGGGGAGGGAGGTGGG + Intronic
1174668434 20:52282809-52282831 TAGGGCAAGTCGAGGAAGGTGGG - Intergenic
1174673180 20:52327520-52327542 AAGGGAAAGAGGTGGGAGAAAGG - Intergenic
1174709524 20:52690263-52690285 AAGGGGAAGGGGAAGGAGAAGGG - Intergenic
1174723565 20:52838844-52838866 AAGGGAAGGGGGAGGAAGGAAGG - Intergenic
1175565007 20:59967737-59967759 AAGGGGAAGGGAAGGGAGGAAGG - Intronic
1175657774 20:60786927-60786949 AAGGGGAGGAGGAAGGAGGAGGG - Intergenic
1175665230 20:60852946-60852968 TAGGCCAAGAAGAGGGAGGAGGG + Intergenic
1175707621 20:61192756-61192778 AAGGGGAAGGGGAAGGAGAAGGG - Intergenic
1175790319 20:61736592-61736614 AAGGGGAGAGGGAGGGAGGAAGG + Intronic
1176257266 20:64158865-64158887 TGGGGCAGGTGGAGGTAGGAGGG - Intronic
1176270506 20:64233427-64233449 AAGGGGAAGGTGAGGGGGGAGGG - Intronic
1176513650 21:7767340-7767362 AAGGGAAAGAGGAAGGGGGACGG - Intronic
1176866430 21:14057189-14057211 AAGGGCAAGGGTAGGGGGCAGGG + Intergenic
1176871252 21:14084556-14084578 GGGGGCAACAGGAGGGAGGAAGG + Intergenic
1177381814 21:20354254-20354276 CAAGGCAAGATGAGGGAGGAAGG + Intergenic
1178613926 21:34113605-34113627 AAATTCAAGTGGTGGGAGGAAGG - Intronic
1178647763 21:34397864-34397886 AAGGGAAAGAGGAAGGGGGACGG - Intronic
1178837612 21:36111830-36111852 GGGGGCAAGTGAAGGGAGGAAGG + Intergenic
1178857221 21:36260225-36260247 AAGGGGAAGGGAAGGGAGGAAGG + Intronic
1179086221 21:38220196-38220218 GAGGGCACAGGGAGGGAGGAGGG + Intronic
1179131187 21:38638803-38638825 AAGGGGATGTGGGAGGAGGAGGG - Intronic
1179407666 21:41138822-41138844 AAGGGGCAGTGGAGGTAGTAGGG - Intergenic
1179713351 21:43275409-43275431 CAGAGCAGATGGAGGGAGGAGGG - Intergenic
1179719408 21:43306777-43306799 TGGGGCTGGTGGAGGGAGGAGGG - Intergenic
1180182328 21:46123513-46123535 ATGGGCAAGTGGATGGGGGTGGG + Intronic
1180590166 22:16930604-16930626 AAGGGCAAGGGGAGTGTGGATGG + Intergenic
1180646023 22:17339766-17339788 AAAGGCAAGTGGAGGAGAGATGG - Intergenic
1180745771 22:18087977-18087999 TAGAGGAAGTGCAGGGAGGAAGG - Exonic
1181021684 22:20106858-20106880 CAGGGAAAGTGCAGGCAGGACGG - Intronic
1181080747 22:20413222-20413244 AAGGGGAAGGGGAGGAGGGAGGG + Intergenic
1181389803 22:22571959-22571981 AAGGGGAAGGGAAGGGAGGAAGG + Intergenic
1181479928 22:23192268-23192290 AAGGTCAAGTGGTTGGTGGAGGG + Intronic
1181716596 22:24735097-24735119 AGGGGCAGGTGGTGGTAGGAAGG + Intronic
1181850072 22:25743583-25743605 AAGGCCAAGTGGGTGGAGGAGGG + Intronic
1181885306 22:26017367-26017389 AAGGAGGAGGGGAGGGAGGAAGG - Intronic
1181975064 22:26723054-26723076 AAGGGGAAATGGATGGAGGAGGG - Intergenic
1181980257 22:26761081-26761103 AGGAGGAAGTGGAGGAAGGAGGG + Intergenic
1182344354 22:29650566-29650588 AAAAGGAAGGGGAGGGAGGAAGG - Intronic
1182410441 22:30180864-30180886 AAGGGAAAGGGAAGGGAAGAAGG - Intergenic
1182931468 22:34178288-34178310 AGGGGGAGGAGGAGGGAGGAGGG - Intergenic
1183024847 22:35057410-35057432 AAGGACAAGTGGAGTGGTGAGGG + Intergenic
1183306039 22:37083752-37083774 AAGGGCAAGAGCAGGGAAGAGGG + Intronic
1183354538 22:37351143-37351165 AAGGAGGAGAGGAGGGAGGAGGG - Intergenic
1183467670 22:37987819-37987841 CAGGGAAACTGGAGGTAGGAGGG - Intronic
1183637401 22:39072697-39072719 AGGGGCATGAGGAGGCAGGAGGG - Intronic
1183716468 22:39536094-39536116 ATGGGCTAGGGGAGGGAGGGCGG - Intergenic
1184191075 22:42894915-42894937 ATGGGCAAGGGGAGGGAAGGGGG + Intronic
1184252223 22:43267321-43267343 AAGGGAGAGAGGAGGGAGCAAGG + Intronic
1184469870 22:44690345-44690367 CAAGGCAGGGGGAGGGAGGAGGG + Intronic
1184533793 22:45072751-45072773 GAGGGCAAATGGAGAGATGAGGG - Intergenic
1184628582 22:45757282-45757304 TGGGGCTAGGGGAGGGAGGAGGG - Intronic
1184652600 22:45925968-45925990 CAGGGACAGGGGAGGGAGGAGGG - Intronic
1184730102 22:46367111-46367133 AAGGGGCCCTGGAGGGAGGAAGG + Exonic
1184885811 22:47343836-47343858 AAGGGCATTTGGAGAGGGGAGGG + Intergenic
1185191371 22:49438617-49438639 ACAGCCCAGTGGAGGGAGGAGGG + Intronic
1185343792 22:50302737-50302759 AGGGGCAGGTGGTGGGAGGGAGG - Intronic
1185360469 22:50403732-50403754 AAGGGCAGGTGGAGTGTAGAGGG - Intronic
949362158 3:3243502-3243524 AAGGGAAAGTGATGGGAAGATGG + Intergenic
949401096 3:3665940-3665962 AAGGACAGGGGGAGGGAGGGAGG + Intergenic
949409249 3:3745861-3745883 AAGGGGAAGTGGTGTTAGGAGGG - Intronic
949829516 3:8198969-8198991 GAGGGTAAGTGGAGAGAGGCTGG - Intergenic
949864485 3:8536176-8536198 AAGGCCAACTGCAGGGATGAGGG - Intronic
949883738 3:8679326-8679348 AAGAGCAAGGGGCGGGAAGAGGG - Intronic
950044885 3:9943246-9943268 ATGGGCAGGTGGGGGAAGGAAGG + Intronic
950149623 3:10676495-10676517 ATGGGGATGGGGAGGGAGGAGGG + Intronic
950398164 3:12750003-12750025 CCGGGGTAGTGGAGGGAGGAGGG + Intronic
950726247 3:14918836-14918858 ACGGGCAGGTGGAGGGAGGATGG + Intronic
950989860 3:17421968-17421990 AAGTAGAAGAGGAGGGAGGAAGG - Intronic
951038068 3:17955597-17955619 AAGGGAAAGGGAAGGAAGGAAGG - Intronic
951087352 3:18528947-18528969 AAAGGCAAGGGGATGCAGGATGG + Intergenic
951383194 3:22010903-22010925 GAGGGTGAGTGGTGGGAGGATGG - Intronic
951681033 3:25294808-25294830 AAGAGGGAGTGGAGGGGGGAAGG + Intronic
951881178 3:27483380-27483402 CAGGCCAAGTAGAAGGAGGAGGG - Intronic
952277794 3:31894300-31894322 GAGGACAAGGGGAGGCAGGAAGG + Intronic
952277855 3:31894932-31894954 AAAAGCAAGTGGAGGAGGGAGGG - Intronic
952484376 3:33795273-33795295 AAATGCAAGTGGAAGTAGGAGGG + Intergenic
952569211 3:34694402-34694424 AAGGGAAAGGGGAAGAAGGAAGG - Intergenic
952993286 3:38852168-38852190 AAGGGCAATGAGAGGAAGGAGGG + Intronic
953003185 3:38953253-38953275 ATGGGAAGGTGGAGGGTGGAAGG + Intergenic
953135105 3:40175466-40175488 AAGGACAAAAGGAGGGAGGGAGG - Intronic
953181106 3:40596168-40596190 AAGGGCAGGTGCAGGCAGGTAGG + Intergenic
953277302 3:41514774-41514796 AAGGGTGAGGGGTGGGAGGAAGG + Intronic
953289618 3:41648708-41648730 TAGGGAATGTTGAGGGAGGAGGG + Intronic
953340984 3:42134147-42134169 AAGGGGAAGGGGAGGAAGGAAGG - Intronic
953340998 3:42134183-42134205 AAGGGGAAGGGGAGGGGGAAGGG - Intronic
953866184 3:46585256-46585278 CAGGGCAAGGGGAGGCAGAATGG - Intronic
954093897 3:48307429-48307451 AAGAGGAAGTGGAAGAAGGAAGG - Intronic
954370180 3:50166103-50166125 AAGGGGGAGTAGGGGGAGGAAGG - Intronic
954414248 3:50385182-50385204 AAGGGGGAGGGGAGGGAAGATGG + Intronic
954439515 3:50514094-50514116 AAGGGGCAGGGGAGGCAGGAAGG - Intergenic
954505475 3:51067600-51067622 AAGTGCAAGGGGAGGAAGAAAGG - Intronic
954575873 3:51675945-51675967 AAGGGCAGGTGGAGGAGGGAAGG + Intronic
954581651 3:51706452-51706474 AAGGGCATCTGCAGGAAGGAAGG + Intergenic
954700425 3:52447926-52447948 AAGGGGCAGTGGGGGAAGGAGGG - Intergenic
955512484 3:59695370-59695392 TAGGGGAAATGGAGGGTGGAGGG - Intergenic
955611341 3:60760453-60760475 CAGGGCAAGTGGGTGGAGTAGGG + Intronic
955697240 3:61649120-61649142 AAGGGAAAAGGGAGGGAGGGAGG - Intronic
955703123 3:61701913-61701935 AAGAGGAAGGAGAGGGAGGAAGG + Intronic
955885722 3:63596325-63596347 AAGAGAAAGTGGAGGGGGAAGGG - Intronic
955932903 3:64075831-64075853 AAGGGTAGGGGGAGGGAGGTGGG - Intergenic
955986513 3:64579099-64579121 TTGGGCAAGTAGAGGAAGGAGGG - Intronic
956361419 3:68452041-68452063 AAGGCCAAGAGAGGGGAGGATGG + Intronic
956963422 3:74430628-74430650 TAGGGAAAGTGGAGGGAGATAGG + Intronic
957220169 3:77372138-77372160 AAGGGAAAGAGAAGGAAGGAGGG + Intronic
957383882 3:79470410-79470432 TGGGGCATGGGGAGGGAGGAGGG + Intronic
957467073 3:80608069-80608091 AAGGGGAGTGGGAGGGAGGAGGG + Intergenic
957640746 3:82850210-82850232 AAGGGAAAGGGGAAGGAGAAGGG - Intergenic
959543854 3:107571123-107571145 AAGGGGGAATGGAGGGTGGAAGG + Intronic
959574162 3:107916548-107916570 CGTGGCTAGTGGAGGGAGGAGGG - Intergenic
959970245 3:112400923-112400945 AAGAGAAAATAGAGGGAGGAAGG + Intergenic
960112176 3:113855797-113855819 AAAGGTAAGTGGTTGGAGGAAGG + Intronic
960884111 3:122376810-122376832 AAGGGCAAGGGTAAGGAGGAAGG + Intronic
961043802 3:123695103-123695125 AAGGGGATGTGGATGGAGGGAGG + Intronic
961345308 3:126260187-126260209 AGGGGGAAGAGAAGGGAGGAAGG - Intergenic
961564116 3:127751234-127751256 AGGTGCAAATGGAAGGAGGAGGG - Intronic
961660268 3:128464929-128464951 AGGGGGAAGGGGAGGGAGGAAGG - Intronic
962072339 3:132044940-132044962 AAGGGGAGGGGGAGGGGGGAGGG + Intronic
962076623 3:132088757-132088779 AAGGGAAGGGGGAGGGAGGGAGG + Intronic
962203054 3:133415766-133415788 AAGGGTAAGTGGAGGGGAGATGG - Intronic
962318970 3:134375521-134375543 CAGGGTAAGTGGAGAGAGGAGGG - Intergenic
962858424 3:139372092-139372114 AAAGGCAACTGGAGGCAGGAAGG + Intronic
962878611 3:139554853-139554875 AAGGGGAAGAGGAGGGAGAGAGG + Intergenic
962927928 3:140012204-140012226 AATGCCAAGAGAAGGGAGGAAGG + Intronic
963048531 3:141122914-141122936 GAGGGCAAGCGGAAGCAGGACGG - Intronic
963074604 3:141334369-141334391 AAGGAAAAATGGAGGGAGGGAGG - Intronic
963444246 3:145383345-145383367 AAGGAGAAAAGGAGGGAGGAAGG + Intergenic
963892716 3:150653589-150653611 ATGTGCGGGTGGAGGGAGGAGGG - Intergenic
964338694 3:155685258-155685280 AAGGGTAAGTGAGGGGATGATGG + Intronic
964349193 3:155786124-155786146 AAAGGGAAGGGGAGGGAGAAGGG + Intronic
964444596 3:156745445-156745467 AAGGGAAAGAGGAGGAAGCAGGG - Intergenic
964763156 3:160153377-160153399 AGGGGCAAGAGGAGGGAGGAAGG - Intergenic
965514715 3:169608544-169608566 AAACACAAATGGAGGGAGGATGG - Intronic
966398596 3:179525390-179525412 AAGGGGGAATGGAGGGTGGAAGG + Intergenic
966549124 3:181184370-181184392 AGGGTCACGTGGTGGGAGGATGG + Intergenic
966568641 3:181413423-181413445 AAGGGCAAGCAGAGGAAGGAAGG + Intergenic
966680706 3:182638887-182638909 AAAGCCAAGTGATGGGAGGAGGG - Intergenic
966739342 3:183217711-183217733 AGGGACAAGTGGAGGAAGGAAGG - Intronic
966743907 3:183257937-183257959 AGGGTGAAGTGGAGGGAGCAAGG - Intronic
966767417 3:183475883-183475905 AAGGGGAAGGGAAGGGAAGAAGG - Intergenic
966877562 3:184331851-184331873 ACAGACAAGTGGAGGGAGGTGGG + Intronic
966931229 3:184677112-184677134 AAGGGGAAGTTGCAGGAGGAAGG + Intronic
967095201 3:186172298-186172320 AAGGGGAAGTGGAGTGGGGGTGG - Intronic
967421482 3:189278118-189278140 AAGGGCATGTGGAAGGAGCATGG - Intronic
967478621 3:189949313-189949335 AAGGGGAAGAGAAGGGAAGAGGG - Intergenic
967712392 3:192724016-192724038 AAGGGAAAAGGGAGGGAGAAAGG + Intronic
968004204 3:195228347-195228369 AAGGGCAGGTGGAGGGAAAGGGG - Intronic
968005532 3:195240203-195240225 AAGGGACAGTGTAGGGAGGAGGG + Intronic
968284372 3:197499363-197499385 AAGGGCGGGTGGGGGGAGGAAGG + Intergenic
968546229 4:1200392-1200414 GGGAGCAAGTGGAGGGAGGAAGG + Intronic
968756008 4:2417092-2417114 GGCGGCCAGTGGAGGGAGGAGGG + Intronic
968881974 4:3305615-3305637 GAGGGAAAATGGAGGCAGGAAGG + Intronic
969022606 4:4147980-4148002 AAGAGCCAGTGGGGGGAAGAGGG + Intergenic
969139597 4:5056879-5056901 AAGGGCAAGTGGACGCTGGGTGG + Intronic
969143479 4:5100348-5100370 AAAGGCAGCTGGGGGGAGGAAGG - Intronic
969393438 4:6906138-6906160 AAGGGGATTGGGAGGGAGGATGG + Intergenic
969397674 4:6933272-6933294 AAGGGGAAGGGGAAGGGGGAGGG - Intronic
969674718 4:8608302-8608324 AAGGGAAAGTGCAGGGAGGGAGG - Intronic
969675159 4:8610425-8610447 CAGGGCAAGGGCAGGGAGGAGGG + Intronic
969861478 4:10039304-10039326 GAGGGCCAGTGCATGGAGGAGGG + Intronic
970047031 4:11866071-11866093 GAGGGCGAAGGGAGGGAGGAGGG + Intergenic
970146428 4:13041307-13041329 AGGGGCAAGTTTAGGGAGAAAGG + Intergenic
970554876 4:17220978-17221000 CAGGGCAAGTGGAGGGAGAAAGG - Intergenic
970689978 4:18611627-18611649 AAGGTGAAAGGGAGGGAGGAAGG + Intergenic
970690142 4:18612087-18612109 AAGGTGAAAGGGAGGGAGGAAGG + Intergenic
970690228 4:18612325-18612347 AAGGTGAAAGGGAGGGAGGAAGG + Intergenic
970760581 4:19481015-19481037 AAGGGAAAGAGAAGGAAGGAAGG - Intergenic
971141672 4:23931316-23931338 AAAGGCAAGGGCAGGAAGGAAGG + Intergenic
971162188 4:24144688-24144710 AGGGGAAAGTGGAGGGAGAAGGG - Intergenic
971413294 4:26398283-26398305 AGGGGTAAGTGGAGGGAGTGTGG - Intronic
971727746 4:30335615-30335637 AGGGGGGAGTGGAGGGGGGAGGG + Intergenic
971786838 4:31115079-31115101 AAGCGAAAGTGGAGGAGGGAGGG - Intronic
972924344 4:43984830-43984852 AAAGGAAAGGGAAGGGAGGAAGG + Intergenic
973076894 4:45940369-45940391 AAGGGAGGGAGGAGGGAGGAAGG + Intergenic
973242408 4:47970731-47970753 AAAGGCAGAGGGAGGGAGGAAGG - Intronic
973750975 4:54021058-54021080 AAGGGGGAATGGAGGGTGGAAGG - Intronic
973850721 4:54958911-54958933 AAACCAAAGTGGAGGGAGGAAGG + Intergenic
974088306 4:57284289-57284311 TAGGACAAGTGGAGGCAGAATGG + Intergenic
974247611 4:59340740-59340762 AAGGGAGAAGGGAGGGAGGAAGG + Intergenic
974737820 4:65961567-65961589 AAGTAGAAGTGGAGGGACGATGG + Intergenic
975151923 4:71032458-71032480 AAGGGGGAATGGAGGGCGGAAGG - Intergenic
975328580 4:73087974-73087996 AAGGAAAAGGGGAGAGAGGAAGG + Intronic
975672942 4:76800032-76800054 AAGAGCAAAGGAAGGGAGGAAGG + Intergenic
975712636 4:77175589-77175611 AAGGGGAAGATGCGGGAGGAGGG - Intronic
976367607 4:84247441-84247463 GAGGGGAGGTGGAGAGAGGACGG - Intergenic
976512530 4:85928300-85928322 GAGGGAAGGAGGAGGGAGGAAGG - Intronic
976753877 4:88477583-88477605 AAGGGAAGGAGGAGGGAGGGAGG + Intronic
977086686 4:92607973-92607995 GATGGCAAGTTGAGGGGGGAAGG + Intronic
977114819 4:93010516-93010538 AAGTGCAAGTGCTGGGAGGATGG - Intronic
977225485 4:94387905-94387927 AAGGGAGAATGGAGGGAGAATGG + Intergenic
977306295 4:95327773-95327795 AAGGGGAGCTGGAAGGAGGATGG - Intronic
977728070 4:100320798-100320820 AAGGAGAAGGGAAGGGAGGAAGG - Intergenic
977748702 4:100582184-100582206 AAAGGGAAGGGAAGGGAGGAAGG - Intronic
977860913 4:101958743-101958765 AAGAGCATGTGTAGAGAGGATGG - Intronic
978303379 4:107294905-107294927 AAGGGGTAATGGAGGGTGGAAGG + Intergenic
978409849 4:108415368-108415390 GAGGGCTAATGGAGGCAGGAAGG + Intergenic
978535340 4:109756309-109756331 AAGGAAAAGAGGAGGGAGGGAGG + Intronic
978543068 4:109839603-109839625 AAGGGTAGAGGGAGGGAGGAGGG - Intronic
978572786 4:110157121-110157143 AAGGCCAAGAAGAAGGAGGAGGG + Intronic
978776896 4:112514572-112514594 AGGGGCAGGGGAAGGGAGGAGGG + Exonic
978901641 4:113957138-113957160 AAGGGCAGGTTTGGGGAGGAAGG + Intronic
978987678 4:115034317-115034339 TACAGCAAGTGGAAGGAGGAAGG - Intronic
979146473 4:117253349-117253371 AAGGAGGAGTGGAGGGTGGAAGG - Intergenic
979677845 4:123429196-123429218 TAGGGTAAGTGGAGGGAAGATGG + Intergenic
979882947 4:125986011-125986033 AAGGGCAAGAGGAGGAGGGTGGG - Intergenic
980121189 4:128730224-128730246 AAGGGGAAGAGAAGGAAGGAGGG - Intergenic
980281208 4:130722651-130722673 TAGTGCAGGTGGAGGGAAGAGGG - Intergenic
980319159 4:131245618-131245640 AAAAGCATGTGGAAGGAGGAGGG - Intergenic
980505139 4:133709304-133709326 AAGGGGAAGGGGAAGGAGAAGGG - Intergenic
981263605 4:142753538-142753560 AAGAGCAAATGGAGAGAGGGGGG - Intronic
981369912 4:143948236-143948258 AAGGGGAAGGGAAGGAAGGAAGG - Intergenic
981482867 4:145256000-145256022 AAGGGGGAATGGAGGGTGGAAGG + Intergenic
981516348 4:145613828-145613850 AAGGGCAAGAGAGGGGAAGAGGG - Intergenic
981550687 4:145938025-145938047 GGGGGCAAGAGAAGGGAGGAGGG - Intronic
981557213 4:146008359-146008381 AAAGGGAAGAGAAGGGAGGAAGG - Intergenic
981616885 4:146651806-146651828 AGGGGAAAATGGAAGGAGGAAGG - Intergenic
981814005 4:148807656-148807678 AAGGGGAAGGGGAAGGAGGGTGG + Intergenic
982152132 4:152471504-152471526 AAGGGAATGGGGAGGGAGGGAGG + Intronic
982448264 4:155520944-155520966 AAGAACAAGTGGAGAGAGTAGGG - Intergenic
982618287 4:157670625-157670647 GGGGGCTATTGGAGGGAGGAGGG - Intergenic
982687814 4:158513038-158513060 AAGGGCAGGTGGGAGGAGGATGG - Intronic
982725682 4:158903272-158903294 GAGGGCAAGTAGAAGGAGGGTGG - Intronic
983344952 4:166516394-166516416 ACGGGCAACTAGAGGGAGGAAGG + Intergenic
983500940 4:168499241-168499263 AAGGGAGAAGGGAGGGAGGAAGG + Intronic
983932293 4:173465768-173465790 AGGGGGAAGCGGAGGGAGGAAGG - Intergenic
983949540 4:173622854-173622876 GAGGGCAAGTGGAAGCAGGGTGG - Intergenic
984070343 4:175103405-175103427 AAGGGAGAGGGGAGGGAGGAGGG + Intergenic
984070364 4:175103458-175103480 AAGGGAGAGGGGAGGGAGGAGGG + Intergenic
984201385 4:176724913-176724935 AGGGGCAAGGGTAGGGAGGATGG + Intronic
984205774 4:176786291-176786313 AAGGGAAACTGAAGGGAGCATGG - Intronic
984206438 4:176792720-176792742 TCGGGGAAGGGGAGGGAGGAGGG - Exonic
984908811 4:184652961-184652983 AAGGGAAAGAAGAGGGAGGGAGG + Intronic
984908826 4:184653020-184653042 AAGGGAAAGAAGAGGGAGGGAGG + Intronic
984911483 4:184677040-184677062 AAGGGGAAGGGGAGGGGAGAAGG - Intronic
985102340 4:186470865-186470887 AAGGGGAAAAGGAGGCAGGAGGG + Intronic
985586452 5:740122-740144 CAGGGGGAGTGGTGGGAGGAGGG + Intronic
985601040 5:832299-832321 CAGGGGGAGTGGTGGGAGGAGGG + Intronic
985610880 5:887811-887833 AAGTGCAAGTCAAGGGATGAAGG + Intronic
985955434 5:3262166-3262188 CAGGGCAACAGGAGGGAGAAGGG - Intergenic
986015202 5:3751549-3751571 AAGGGAGGGTGGAGGGAGGAAGG + Intergenic
986163325 5:5250886-5250908 AGGGACGAATGGAGGGAGGAAGG - Intronic
986530127 5:8727075-8727097 AAGAGCAAGGGAAGGAAGGAAGG + Intergenic
986583225 5:9287100-9287122 AAGTGCAGGTGGACGGGGGAGGG - Intronic
986769441 5:10958391-10958413 CAGGGGATGTGGAGGAAGGAGGG - Intergenic
987011455 5:13770329-13770351 AAGGGCAAGAAGAGGGAAGAGGG + Intronic
987033796 5:13999837-13999859 AAGGGCAAGTGTTGGAAAGATGG - Intergenic
987110761 5:14684439-14684461 AGGGGCCAGTGAAGGAAGGAAGG + Intronic
987447457 5:18037921-18037943 AAGGGCCAGTGGTAGAAGGATGG - Intergenic
987733936 5:21813821-21813843 AAAGGCATGTGGAGGGTGGAGGG - Intronic
988871073 5:35390572-35390594 ATGGGAAAGTGGAGGGTGGGAGG + Intergenic
989069647 5:37497233-37497255 AAGGGAAAAGGGAGGGAGGAGGG - Intronic
989069658 5:37497260-37497282 GAGGGAAAAGGGAGGGAGGAAGG - Intronic
989110385 5:37901764-37901786 GAGGGCAAGGGAAGGGAGGAAGG + Intergenic
989208952 5:38841218-38841240 AAAGCCTACTGGAGGGAGGAGGG - Intergenic
989267220 5:39489674-39489696 AATGGCAAGTGGGTGGAGGAAGG - Intergenic
989781456 5:45269907-45269929 AAGGGAAAGTAGAGGGAACATGG - Intronic
989999295 5:50874451-50874473 AAGGTCTAGGGGAGGAAGGAGGG - Intergenic
990046373 5:51437322-51437344 AAGGGCAAATGGTGGGCGGAGGG - Intergenic
990047889 5:51457168-51457190 GAGGGGCAGTGGAGGGAGGGAGG - Intergenic
990317931 5:54601635-54601657 ACAGGAAAGTGGGGGGAGGAGGG + Intergenic
990426070 5:55690438-55690460 AAGGGAAAGAGGATGGAGAAGGG + Intronic
990553610 5:56909203-56909225 GAGCTCAAGTGGACGGAGGATGG + Intergenic
990958070 5:61363832-61363854 AAAGGAAAGGGAAGGGAGGAAGG - Intronic
991359143 5:65802215-65802237 AAGGGCAAGTGGAGTGGCAAGGG + Intronic
991371655 5:65925858-65925880 GACGGCGAGGGGAGGGAGGACGG - Intergenic
991483001 5:67103509-67103531 GAGGGGAGGAGGAGGGAGGAAGG + Intronic
991539789 5:67714732-67714754 GAGGGCAGGTGGTGGGAGGAGGG - Intergenic
991693157 5:69245270-69245292 GAGGGGAAAAGGAGGGAGGACGG - Intronic
991968455 5:72114803-72114825 GAGGGCAAGAGGCGGGATGAGGG - Intronic
992161333 5:74006542-74006564 GAGGACTACTGGAGGGAGGAGGG - Intergenic
992299488 5:75363762-75363784 TAGGGCAGGTGGGGTGAGGATGG - Intergenic
992379570 5:76223916-76223938 ATGGGGAAGTGGTGGGGGGATGG + Intronic
992662669 5:78976858-78976880 AAGAGCTAGAGGAGGGAGGCTGG - Intronic
993026914 5:82657648-82657670 AAGGGCCATGGGAGGGAGGTTGG - Intergenic
993204587 5:84863344-84863366 AGGGGGGAGGGGAGGGAGGAAGG - Intergenic
993204609 5:84863402-84863424 GAGGGGAAGAGGAGGGAGGGAGG - Intergenic
993204634 5:84863465-84863487 AGAGGGAAGGGGAGGGAGGAAGG - Intergenic
993374628 5:87135646-87135668 AGGGGAGAGGGGAGGGAGGAGGG + Intergenic
993407951 5:87535504-87535526 AAGAGAAAGAGGAGGAAGGAAGG - Intergenic
993703231 5:91142986-91143008 AAGGGCGAGTGGAGTGGCGAGGG + Intronic
993704291 5:91152207-91152229 AAGGGAAAGTACAGGAAGGAAGG + Intronic
993831918 5:92770747-92770769 AAGGGGAAGGGAAGGAAGGAGGG + Intergenic
993914371 5:93724845-93724867 AAGGGCAAGAGTAGTGATGATGG - Intronic
994409395 5:99388088-99388110 AAGGGAAAAGGGAGGGAGGGAGG - Intergenic
994648703 5:102500430-102500452 AAGGGTCAGTGGAGGTAGGAGGG - Intergenic
994839770 5:104908648-104908670 AAGGGCTTTTGCAGGGAGGATGG - Intergenic
996017468 5:118556662-118556684 GAGGGCAAAAGGAGGGCGGAAGG - Intergenic
996423266 5:123285661-123285683 AAGGGGAAGGGGTGGGTGGAGGG - Intergenic
996799737 5:127389766-127389788 ATTGGCAAGTGGAGGGTGGGAGG + Intronic
997240514 5:132303416-132303438 AAGGGGAAGGGGAGGGCTGAAGG - Intronic
997292635 5:132748313-132748335 AAGAGCAGGTGGGGCGAGGAAGG - Intronic
997465696 5:134086683-134086705 AAGGGGAAGGGGAAGGAAGAAGG - Intergenic
997613273 5:135229939-135229961 CAGGGCAGGATGAGGGAGGAAGG - Intronic
997999162 5:138610525-138610547 AAGGTCTTGGGGAGGGAGGAGGG + Intergenic
998038374 5:138935535-138935557 GAGGGGAGGTGGAGGGAGCAAGG - Intergenic
998060700 5:139116552-139116574 AAGGGGAAGTGGAGGTAAGGAGG - Intronic
998173198 5:139884321-139884343 AGGGACAAGTGAGGGGAGGAGGG + Intronic
998234165 5:140383504-140383526 AGGAGGAAGTGGAGGGTGGAGGG + Intergenic
998504971 5:142665287-142665309 AAGGGCAAGGGGGTGGACGAGGG - Intronic
998653170 5:144143907-144143929 AAGGGCAACAGGAGATAGGAAGG + Intergenic
999236209 5:150097311-150097333 AAGGGGAAGGGGAAGGAGAAGGG + Intronic
1000115366 5:158148917-158148939 GAGGGGAAGGGGAGGGAGGGAGG - Intergenic
1000132128 5:158310074-158310096 GAGGGAAGGGGGAGGGAGGAAGG - Intergenic
1000251188 5:159497331-159497353 AAGGGGAAGCAGAGGGAGGAGGG + Intergenic
1000306737 5:160001627-160001649 AAGGGCAGGTGTCGGAAGGAAGG - Intergenic
1000465822 5:161575045-161575067 AAAGGCAATTTGATGGAGGAAGG + Intronic
1000486483 5:161850619-161850641 AAGGGAAAGTGGAGAATGGATGG + Intronic
1000612967 5:163395429-163395451 AGGGGGAAGGGGTGGGAGGAGGG + Intergenic
1001108496 5:168875791-168875813 AAGGGAAAGAGAAGGGTGGAGGG + Intronic
1001190956 5:169630762-169630784 AAGGGGAAATGGTGGGAAGAGGG - Intergenic
1001268291 5:170291156-170291178 GAGGACAAGGGAAGGGAGGAAGG + Intronic
1001331603 5:170766464-170766486 AAGGGGGAATGGAGGGTGGAAGG + Intronic
1001479958 5:172081874-172081896 AAGGGGAAGGGGAGGATGGAAGG - Intronic
1001530242 5:172456098-172456120 GAGGGCAAGAGGAGAGAGGGAGG + Intergenic
1001622188 5:173096501-173096523 AGGGGCAAGAGGGGAGAGGAGGG - Intronic
1001654678 5:173340452-173340474 AAGGGCCAGGGGAAGGAGTATGG + Intergenic
1001710024 5:173771168-173771190 AAGGGGGAGGGGAGGGAGGCGGG - Intergenic
1001765377 5:174241882-174241904 AAGGTCAGGGGGAGGGAGGAAGG - Intronic
1001855551 5:175007549-175007571 AAGGGAAAAGGGAGGGAAGAAGG - Intergenic
1001883895 5:175270994-175271016 AGGGGCATGTGAAGGGAAGAGGG + Intergenic
1001901308 5:175432542-175432564 AAGGGCAAGGGCTGGGAGCAGGG + Intergenic
1002705625 5:181159681-181159703 AAGGGCAGCAGGAGGGAGGCTGG - Intergenic
1002823776 6:754345-754367 AAGTGCAGGTGGAGGGACTAGGG + Intergenic
1002846319 6:948320-948342 AAAGGAAAGTGGATGGATGAGGG + Intergenic
1002852670 6:1010510-1010532 AAGGGAGAGGGGAGGGAGGGAGG - Intergenic
1003093933 6:3127424-3127446 AAGGGCCAGGGGAGGAAGGGTGG + Intronic
1003500454 6:6698645-6698667 AAAGGAAGGTGGTGGGAGGAAGG + Intergenic
1003514134 6:6804310-6804332 TAGGGCAAGGGGCAGGAGGAGGG + Intergenic
1003879040 6:10463813-10463835 AGGGGTAAGTGGAGTCAGGAAGG + Intergenic
1003904459 6:10686399-10686421 AAGGGAATGGGGAAGGAGGAGGG + Intronic
1003946021 6:11076757-11076779 AAGGGCACAGGGAGGGTGGAAGG - Intergenic
1004339777 6:14798193-14798215 AAGGGTTGGGGGAGGGAGGAAGG + Intergenic
1004949819 6:20656361-20656383 AGAGGCAAGGGAAGGGAGGATGG + Intronic
1005014806 6:21365943-21365965 AAGGGGGAATGGAGGGTGGAAGG + Intergenic
1005495387 6:26383494-26383516 AGGGGGAAGTGGAGGGACGAGGG + Intronic
1005500073 6:26421792-26421814 AGGAGGAAGTGAAGGGAGGAGGG + Intergenic
1005504549 6:26458310-26458332 AGGAGGAAGTGAAGGGAGGAGGG + Intronic
1005777618 6:29153388-29153410 AAGGGGAAGGGGAGGGAGAGGGG - Intergenic
1005804566 6:29462244-29462266 AAGGGCAAGTGGAGGGTGGATGG - Exonic
1005805573 6:29471424-29471446 ATGGGCAGGAAGAGGGAGGAGGG + Intergenic
1005819797 6:29588419-29588441 AAGGGCAGGTGCAGGGTGGATGG - Exonic
1005971424 6:30764810-30764832 AAAGGCAAATGGAGGCAGGGCGG + Intergenic
1006113563 6:31763259-31763281 GAGGGCAAGGGGAGGCAGGCGGG - Intronic
1006400692 6:33815426-33815448 ACAGGCCAGGGGAGGGAGGATGG + Intergenic
1006402520 6:33826085-33826107 AAGGAGAGGTGAAGGGAGGAGGG - Intergenic
1006446861 6:34084496-34084518 AGGGGCACCTGCAGGGAGGAGGG + Intronic
1006907685 6:37544144-37544166 ATGGGAGACTGGAGGGAGGAAGG + Intergenic
1006939468 6:37742445-37742467 TTGGGCAAGAGGAGGCAGGAAGG - Intergenic
1007134469 6:39507939-39507961 AAGGGGAAGGGGTGGGGGGAGGG - Intronic
1007222043 6:40286459-40286481 CAGGGCAAGAGCTGGGAGGAGGG + Intergenic
1007292744 6:40799585-40799607 AAGGGAAGAGGGAGGGAGGAAGG - Intergenic
1007371589 6:41429788-41429810 AGGGGGACGTGGAGGGAGGAAGG - Intergenic
1007531782 6:42549108-42549130 AAGGGGAAGAGGAGGGAGGCCGG + Intergenic
1007615808 6:43179371-43179393 AAGGGGAGGCTGAGGGAGGACGG - Exonic
1007704131 6:43780885-43780907 AAGGACCAGGGGAGGGAGGCAGG - Intronic
1007705098 6:43785679-43785701 AAGGACCAGGGGATGGAGGAAGG - Exonic
1007799715 6:44381727-44381749 AATGGCAACTGGATGGATGATGG + Intergenic
1008033162 6:46719554-46719576 AAAGGCAAGGGGAGAGGGGATGG + Intronic
1008280375 6:49589023-49589045 AAGAGCAAGAGGAGGGGGGAGGG - Intergenic
1008333448 6:50270943-50270965 ACGGGCAAGAGGAGAGAGGAAGG + Intergenic
1008362344 6:50635560-50635582 AAGGGGAAAGGGAGGGAGGGAGG + Intergenic
1008378997 6:50821802-50821824 GTAGGCAAGCGGAGGGAGGAAGG + Intronic
1008390207 6:50941745-50941767 TAGGGCCGGTGGAGGAAGGAGGG + Intergenic
1008495732 6:52132274-52132296 AAGGACAAGGGAAGGGAGAAAGG + Intergenic
1008921740 6:56850117-56850139 AAGGGGAGGTGGAGGGAGGATGG - Intronic
1010338900 6:74724310-74724332 TAGGGCAAGGGGAGGAGGGAGGG - Intergenic
1011525815 6:88263767-88263789 CAGGGCAGAAGGAGGGAGGAGGG + Intergenic
1011640757 6:89413932-89413954 ACAGGAGAGTGGAGGGAGGATGG - Intergenic
1012056924 6:94424934-94424956 AAAGGAAAATGGAAGGAGGAAGG - Intergenic
1012813095 6:103985869-103985891 AAGGACACCTGGAGGGTGGAGGG - Intergenic
1013205032 6:107936901-107936923 GAGGTCTAGTAGAGGGAGGAAGG - Intronic
1013414506 6:109912809-109912831 AAGAGAAAGTGGACAGAGGAGGG - Intergenic
1013668813 6:112376118-112376140 GAGGGCAAGTGCAGGAAAGAAGG - Intergenic
1013734207 6:113206676-113206698 AAGCGAAGGTGGAGGGAAGATGG + Intergenic
1014097330 6:117474569-117474591 TGGGGCAGGGGGAGGGAGGAGGG + Intronic
1014167435 6:118241315-118241337 AAGGGCAAGAGGATAGAGCAAGG - Intronic
1014211067 6:118708771-118708793 TAGGGAAAAGGGAGGGAGGAAGG - Intronic
1014351356 6:120350056-120350078 AAGAGCAAGAGGAGGGAGAGAGG + Intergenic
1015093286 6:129385039-129385061 AAGAGAAAGTGGGGGAAGGAAGG + Intronic
1015322256 6:131889375-131889397 GAGGGCAGGGGGTGGGAGGAGGG - Intronic
1015398204 6:132758945-132758967 AAGGAGAAGTAGGGGGAGGATGG - Intronic
1015428932 6:133107088-133107110 CAGAGCCAGTGGAGGGAGCAGGG - Intergenic
1015434965 6:133174725-133174747 AAGGGGAAGGGGAAGGAGAATGG - Intergenic
1015685669 6:135856954-135856976 AAGGAAGAGAGGAGGGAGGAAGG - Intronic
1015798742 6:137039420-137039442 AAGGGCAATAGGAGAGAGGCTGG + Intronic
1016352318 6:143181719-143181741 AAGGAAAACTGGAGGGAGAAAGG + Intronic
1016374039 6:143402325-143402347 ACGGGAAAGTGGGGGGAAGAGGG + Intergenic
1016463471 6:144302710-144302732 AGGGACACATGGAGGGAGGAAGG + Intronic
1016482509 6:144497137-144497159 AAGAGGAATTGGAGGGAGGCTGG + Intronic
1016919577 6:149278726-149278748 AAGGAGAAGTAGAGGAAGGAAGG + Intronic
1017067966 6:150547717-150547739 AAGAGGAAAGGGAGGGAGGAGGG + Intergenic
1017339578 6:153305237-153305259 AAGGGGAAGGGGAAGGAGAAGGG - Intergenic
1017339611 6:153305357-153305379 AAGGGGAAGGGGAAGGAGAAGGG - Intergenic
1017634549 6:156431077-156431099 AAGGGTAAGTTGAGGGAAGATGG - Intergenic
1017665118 6:156712564-156712586 AAGAGGAAGAGGAGGAAGGAAGG + Intergenic
1018423277 6:163658547-163658569 AAAGGGAAGGGGAGGGAGGAAGG - Intergenic
1018984764 6:168628063-168628085 AAGGGCTTGTGGGGTGAGGAAGG - Intronic
1019142899 6:169959503-169959525 CAGGGGGAGAGGAGGGAGGAGGG - Intergenic
1019327598 7:445967-445989 AAGGGAGAGAGGAGGGAGGATGG + Intergenic
1019404927 7:877960-877982 AAGGCCAGGAGGAGGGAGGCAGG - Intronic
1019494965 7:1333456-1333478 AGGGGGAGGAGGAGGGAGGAGGG - Intergenic
1019599635 7:1874816-1874838 AGGGGCAGGTATAGGGAGGAGGG + Intronic
1019738620 7:2662231-2662253 ATGGGCACGTGGAGGGACCACGG - Exonic
1019757379 7:2782802-2782824 AAGGTCAGGAGGAAGGAGGATGG - Intronic
1020012715 7:4815445-4815467 AGGGGCCTGTGGAGGGAAGAAGG + Exonic
1020080026 7:5282203-5282225 AAGGGGAAGGAGAGGGAGGGAGG + Intronic
1020590145 7:10124989-10125011 GAGGGCAAGTGGAAGCAGGGTGG - Intergenic
1021299165 7:18950223-18950245 CAGGGCAAGTAGAGGCAGAATGG - Intronic
1021481347 7:21121096-21121118 GAGGGCAAGAAGAGAGAGGAAGG - Intergenic
1021509998 7:21425275-21425297 GAGGGGAAAGGGAGGGAGGAAGG - Intergenic
1022106716 7:27201998-27202020 AATGCCACTTGGAGGGAGGAAGG - Intergenic
1022274420 7:28841811-28841833 AAGGGGAAGGGGAAGGAGAAGGG + Intergenic
1022447258 7:30480499-30480521 AAGGGGGAATGGAGGGTGGAAGG - Intergenic
1022574805 7:31487306-31487328 AAGGACAGGAGGAAGGAGGAAGG - Intergenic
1022977808 7:35575009-35575031 ATCTGCAGGTGGAGGGAGGACGG - Intergenic
1023770661 7:43553840-43553862 TTGTGCAAGTGGAGGGAAGAAGG - Intronic
1023805848 7:43872443-43872465 AAGGGCAGAAGAAGGGAGGAGGG + Intronic
1023856305 7:44186174-44186196 CAGGGCAGCTGGAGGGAGGAAGG + Intronic
1023911143 7:44557680-44557702 AAGGGGAAGGGGAGGGAGGAAGG + Intergenic
1024364080 7:48501155-48501177 AATGTCCAGTGGAGGGAGGTGGG + Intronic
1024685969 7:51745373-51745395 AATGGCAAGTGCAGTGTGGAGGG - Intergenic
1024851981 7:53729568-53729590 CAGGGCAAATGGTGGGAGGAGGG - Intergenic
1025086520 7:56027952-56027974 AAGAGCCTGTGGTGGGAGGATGG + Intronic
1025198890 7:56950013-56950035 AAGGGGAAGGAGAGGGAGGGAGG - Intergenic
1025673056 7:63626920-63626942 AAGGGGAAGGAGAGGGAGGGAGG + Intergenic
1025738375 7:64174753-64174775 AGAGGCAAGTGGATGCAGGATGG - Intronic
1025815627 7:64908402-64908424 GAGGCCAAGTTGAGGGTGGAGGG - Intronic
1025957420 7:66193587-66193609 AAGGGAAGGGGGAGGAAGGAAGG - Intergenic
1026123240 7:67556097-67556119 AAGGAGAAAGGGAGGGAGGAAGG - Intergenic
1026133194 7:67636985-67637007 AAGGAGAAGGGGAGGAAGGAAGG - Intergenic
1026178210 7:68016312-68016334 AAGGAAAGATGGAGGGAGGAAGG - Intergenic
1026191916 7:68136516-68136538 AGGGGAAGGAGGAGGGAGGAGGG + Intergenic
1026191924 7:68136535-68136557 AGGGGAAGGAGGAGGGAGGAGGG + Intergenic
1026206297 7:68260709-68260731 AAGGGAAAGAAGAAGGAGGATGG - Intergenic
1026238064 7:68545994-68546016 ATGGGAAAGTGGAGAGAGTAAGG - Intergenic
1026268524 7:68816452-68816474 AAGGGAAAAAGGAGGGAGGGAGG + Intergenic
1026308829 7:69166258-69166280 AAGGGGATGGGGAGGGGGGAAGG + Intergenic
1026308841 7:69166277-69166299 AAGGGGAGGGGGAGGGGGGAAGG + Intergenic
1026530069 7:71189530-71189552 AGGGGCAGTTGGAGGGAGGAAGG + Intronic
1026542790 7:71295403-71295425 AAGGGGAAGAGAAGGGAGAAAGG - Intronic
1027130136 7:75584822-75584844 AATGGAAAGTGGGAGGAGGAAGG - Intronic
1027141692 7:75662073-75662095 AAGGTGGAGGGGAGGGAGGAGGG + Intronic
1027159769 7:75793785-75793807 AAGGGGAAGGGGAGGAAGGAAGG + Intergenic
1027189876 7:75990360-75990382 AAGGGCTAGTGGGGGATGGAGGG - Intronic
1027354263 7:77340924-77340946 AAGGGGGAATGGAGGGTGGAAGG - Intronic
1027397151 7:77767786-77767808 AAGGGAAGGGGGAGGGAGAAGGG - Intronic
1027533581 7:79367140-79367162 ATGGGTAAGTGGAAGGAAGAGGG - Intronic
1027536869 7:79414296-79414318 AAGGACAACTTGAGAGAGGAAGG - Intronic
1028611522 7:92717362-92717384 AAGGGAAAGGGGAAGGAGAAGGG + Intronic
1028947645 7:96599043-96599065 AGGGGCAGAGGGAGGGAGGAAGG + Intronic
1028994629 7:97086162-97086184 CAGGGCAGGTAGAGGGAGGCAGG + Intergenic
1029148999 7:98466968-98466990 AAGGGAAAGGGGAGGAAAGAAGG - Intergenic
1029164209 7:98575157-98575179 GAGGGCAGGGGGTGGGAGGAGGG - Intergenic
1029348622 7:99997202-99997224 AAGGACAGAGGGAGGGAGGAGGG - Intergenic
1029697165 7:102221076-102221098 AAGGGCGGGTGGAAGGAGGGAGG - Intronic
1030655531 7:112163267-112163289 AATGGGGAGGGGAGGGAGGAGGG - Intronic
1031037794 7:116807182-116807204 AAAGGCAGGGGGAGGGAGGAAGG + Intergenic
1031045078 7:116878655-116878677 AGGGTCAAGTGGAGGGGGAAGGG + Intronic
1031323673 7:120365147-120365169 AAGGGAAAATGGAGGGTGGGAGG + Intronic
1031378451 7:121056520-121056542 AAGGGGATGTGGAGAGAGAATGG - Intronic
1031464941 7:122097514-122097536 AAGGGTAAAAGGTGGGAGGAGGG - Intronic
1031493668 7:122420905-122420927 CTGGGGAAGGGGAGGGAGGATGG + Intronic
1031696178 7:124857682-124857704 AAGGGGAAGTGAAAAGAGGATGG - Intronic
1031865986 7:127039618-127039640 AAGGGGAAGGGGAAGGAGAAGGG + Intronic
1031915621 7:127560185-127560207 GAGGGAAAGTGGAAGGTGGAAGG - Intergenic
1032236917 7:130132610-130132632 AATGGCAAGATGTGGGAGGATGG - Exonic
1032428118 7:131838111-131838133 AAGGAGAAGTGGAGGGAGTGGGG + Intergenic
1032526526 7:132581956-132581978 AAGGGGAGATGGAGGGAGGGAGG + Intronic
1033116824 7:138632710-138632732 AGGGGGTTGTGGAGGGAGGATGG + Intronic
1033269118 7:139914678-139914700 AAGTGCATGTGGATGGAGGCAGG - Intronic
1033361221 7:140640440-140640462 GAGGGAAAGGGGACGGAGGAGGG - Intronic
1033804381 7:144937562-144937584 AAGGGGAAGGGGAAGGAGAAAGG - Intergenic
1034273845 7:149815609-149815631 AAGGCCATGGGGTGGGAGGAGGG + Intergenic
1034412095 7:150947123-150947145 AAGGGGAAGGGGAGGGGGGAGGG + Intronic
1034426442 7:151016642-151016664 AGGGGCATGTGGAGGGGGGTGGG - Intronic
1034434081 7:151054883-151054905 GAGGGCAAGGGGAGAGAGCAGGG - Intronic
1034629643 7:152521212-152521234 AAGGGGAGGATGAGGGAGGATGG - Intergenic
1034889543 7:154827744-154827766 GAGCCCAAGTGGAGTGAGGAGGG + Intronic
1034918836 7:155062283-155062305 CAGGAGAAGGGGAGGGAGGAGGG + Intergenic
1034995100 7:155572039-155572061 AGGGGCATGGGGAGAGAGGAAGG + Intergenic
1035025071 7:155819908-155819930 TTGGGTAAGGGGAGGGAGGAGGG + Intergenic
1035058507 7:156052239-156052261 ATGGGCAAATGGAGGGATGGAGG - Intergenic
1035059417 7:156058111-156058133 AAGGGCATATGTGGGGAGGAAGG - Intergenic
1035093242 7:156331544-156331566 AGGGGCAACTGGAGGAAAGACGG + Intergenic
1035338390 7:158144637-158144659 AAGGGGAAGGGGAAGGAGAAGGG + Intronic
1035408645 7:158619095-158619117 AGGGGCTAGGGGACGGAGGATGG + Intergenic
1035435850 7:158858824-158858846 AGGGGAAAGGGGAGGGGGGAGGG - Intronic
1035435894 7:158858919-158858941 AAAGGAAAGGGGAGGGGGGAGGG - Intronic
1036154173 8:6326261-6326283 AAGGGAAGAGGGAGGGAGGAAGG + Intergenic
1036203386 8:6787594-6787616 GGTGGCAAGTGGAGGGAGGAGGG - Intergenic
1036472491 8:9063909-9063931 AAGGGGGAATGGAGGGTGGAAGG + Intronic
1036505040 8:9347462-9347484 AAGGGGAAGGGAAGGGAGGAGGG + Intergenic
1036633425 8:10531252-10531274 AGGGGCAAGTGGAAGGGGAAGGG - Intronic
1036718035 8:11144882-11144904 AAGGGGAAGGGGAAGGAGAAGGG + Intronic
1036718066 8:11144993-11145015 AAGGGAGAAGGGAGGGAGGAAGG + Intronic
1036954418 8:13171855-13171877 AGGGTCAATTGGAGGGAGAAGGG + Intronic
1037097972 8:15008575-15008597 GAGGGGGAGGGGAGGGAGGAAGG + Intronic
1037098032 8:15008739-15008761 GAGGGGAAGAGGGGGGAGGAGGG + Intronic
1037373028 8:18200534-18200556 AAGGGTAAAGGGTGGGAGGATGG + Intronic
1037485480 8:19342855-19342877 AAGGGAAAGAGGAGGGAGTCAGG + Intronic
1037923658 8:22828128-22828150 AAGGGAAAATGGAGGCAGCAGGG + Intronic
1038054130 8:23842320-23842342 AGGGGGAATTGGAGGGAGTAGGG + Exonic
1038103746 8:24410292-24410314 AATGGCGGGTGGAGGGTGGAAGG - Intergenic
1038150959 8:24942146-24942168 AAGGAGAAGGGGAGGGAGGTGGG - Intergenic
1038173165 8:25157039-25157061 AGGGGCAAGAGAAGGGAGGCAGG + Intergenic
1038232412 8:25714785-25714807 AAGGGAAGGAGGAGGAAGGAAGG - Intergenic
1038610385 8:29055367-29055389 AAGGGGAAGGGAAGGAAGGAGGG - Intronic
1038761042 8:30384482-30384504 AGGGGAGAGGGGAGGGAGGAAGG + Intronic
1039065974 8:33607804-33607826 AAGGAAGAGAGGAGGGAGGAGGG - Intergenic
1039147481 8:34465196-34465218 AAGGCCTGGTGGAGGGAAGAAGG - Intergenic
1039314503 8:36356530-36356552 AAAGGGAAGGGAAGGGAGGAAGG + Intergenic
1039359917 8:36864920-36864942 AAGGAAAAGGGCAGGGAGGAGGG - Intronic
1039433648 8:37545131-37545153 AAGGGGAAGGGTGGGGAGGAAGG + Intergenic
1039798101 8:40932641-40932663 AAAGGCAAGAGAAGGGAGGTGGG - Intergenic
1039812653 8:41063380-41063402 AAGGGGAAAGGGAGGGAGGGAGG + Intergenic
1039927590 8:41950932-41950954 AAGGGAGAGGGGAGAGAGGAAGG + Intronic
1040280588 8:46039860-46039882 GGGGGCAACAGGAGGGAGGAAGG + Intergenic
1040538833 8:48333220-48333242 CAAGGCAAGTGGAGGCAGGGTGG + Intergenic
1041005649 8:53494948-53494970 AAGGCCTAGAGGAGGGAGGAGGG + Intergenic
1041413945 8:57587036-57587058 AAGGGAATGTGAAGAGAGGAAGG + Intergenic
1041753625 8:61288561-61288583 AAGGGAAAGTGAAGGCAGGAGGG + Intronic
1041884480 8:62792662-62792684 AAGGAAAAGTGGATTGAGGAAGG + Intronic
1042206279 8:66332913-66332935 AAGGGTCAGTGATGGGAGGACGG - Intergenic
1042576041 8:70219671-70219693 AAGGGCAGGAGGAGGGTGGAGGG + Intronic
1042781910 8:72500563-72500585 AAGGGAAAGTGGGGGGATAAGGG + Intergenic
1043060842 8:75500849-75500871 AGAGGCAAGGGGAGGGAGGTCGG + Intronic
1043282796 8:78489338-78489360 AAGGCCTATTGGAGGGTGGAGGG - Intergenic
1043719441 8:83528542-83528564 AGGGGCAAAGGGAGGGAGAAGGG + Intergenic
1043938288 8:86167979-86168001 AAGGGGAAGGGGAAGGGGGAGGG + Intergenic
1044289101 8:90446905-90446927 GAGGGCAATAGTAGGGAGGAAGG - Intergenic
1044392562 8:91669143-91669165 CTGGGCGTGTGGAGGGAGGAAGG - Intergenic
1044542997 8:93428896-93428918 AGGGGCATGGGGAGGGAGGGAGG - Intergenic
1044624162 8:94219878-94219900 AAGGGCAAGTGATGAGAGAAGGG - Intergenic
1044681111 8:94778526-94778548 AAGTGGAAGCGGAGGGAGCAGGG - Intronic
1044871559 8:96625329-96625351 GAGGACAAGAGGAGTGAGGAAGG - Intergenic
1045015058 8:97994212-97994234 AAGGGAAAGAGGAAGGAGAAGGG + Intronic
1045015069 8:97994240-97994262 AAGGGAAAGAGGGAGGAGGAGGG + Intronic
1045127123 8:99104556-99104578 AAGGGAGAGGGGAGGGGGGACGG - Intronic
1045412083 8:101929535-101929557 AAAGGAAAGGGGAGGGGGGAGGG + Intronic
1045487103 8:102640346-102640368 AAGGAGAAATGGAGGGAGGGAGG + Intergenic
1046981057 8:120336715-120336737 AACTCCAAGTGAAGGGAGGATGG - Intronic
1047368793 8:124237705-124237727 ACGGGCAAGTGGAGCTAGAAGGG + Intergenic
1047525033 8:125625897-125625919 AAGGATAAAAGGAGGGAGGAGGG - Intergenic
1047572264 8:126111867-126111889 ATGGGCAAGAGGGAGGAGGAAGG - Intergenic
1047966927 8:130051829-130051851 CAGGGCAAGAAGAGGGTGGAGGG - Intergenic
1048007620 8:130431972-130431994 AAGGGGAAGGGGAGGAAAGAAGG + Intronic
1048588913 8:135802929-135802951 AAGGGCAAGAGGAAGGGGAAGGG - Intergenic
1048748870 8:137648241-137648263 AAGGGCACGTGGGTGAAGGAGGG + Intergenic
1048761973 8:137805023-137805045 AAGGAAGAATGGAGGGAGGAAGG + Intergenic
1049155292 8:141062534-141062556 ATGGGGAAGTGGAGGGATCATGG + Intergenic
1049276609 8:141723253-141723275 AAGAGGAAGAGGAGGGAGGAAGG - Intergenic
1049323708 8:142010932-142010954 AAGGGCAAGCGGAGAGAGAAGGG - Intergenic
1049370263 8:142261028-142261050 GAGAGAAAGAGGAGGGAGGAAGG + Intronic
1049402146 8:142433230-142433252 AAGGGAAGGAGGAGAGAGGATGG - Intergenic
1049429017 8:142550673-142550695 AAGGGGAGGTGGGGGGAGGAAGG + Intergenic
1049495086 8:142926317-142926339 AAGGCATAGAGGAGGGAGGACGG - Intergenic
1049712388 8:144071220-144071242 AAGGGGGAGGGGAGGGGGGAGGG - Intergenic
1049815521 8:144597379-144597401 AAGAGCACGTGGAGGGAGGGCGG + Intronic
1049832060 8:144707250-144707272 GAGAGCCAGTGGATGGAGGATGG + Intergenic
1051457291 9:17272886-17272908 AAGGGCAGAAGGAGGGAGGGAGG - Intronic
1051487300 9:17622952-17622974 AAAGGAAAAGGGAGGGAGGAAGG - Intronic
1052370869 9:27663179-27663201 AATGGCAAGGGAAAGGAGGATGG - Intergenic
1052970407 9:34373800-34373822 GAGGGGGAGAGGAGGGAGGAAGG + Intronic
1053054707 9:34987778-34987800 AAGGGGGAGGGGAGGGAGGAGGG - Intergenic
1053060119 9:35024099-35024121 AAGGGGGAATGGAGGGCGGAAGG + Intergenic
1053174086 9:35909893-35909915 AGGGACATGAGGAGGGAGGAAGG - Intergenic
1053317462 9:37064116-37064138 GAGGGAAAAGGGAGGGAGGAAGG - Intergenic
1054750338 9:68898700-68898722 AAGAGGGAGAGGAGGGAGGAAGG - Intronic
1055166297 9:73199512-73199534 AAGGGCACTGAGAGGGAGGATGG + Intergenic
1055581479 9:77711145-77711167 GAGGGGAAGGGGAAGGAGGAGGG - Intergenic
1055664813 9:78542815-78542837 AAGGGAAAGTGGACAGAGGCAGG - Intergenic
1055797061 9:79986168-79986190 AAGGGAAATAGGAGGGAGGTGGG + Intergenic
1056381748 9:86062605-86062627 GAGGGCAAGAGGAGGATGGAGGG + Intronic
1056391725 9:86147034-86147056 AAGGGGGAATGGAGGGTGGAAGG - Intergenic
1056591592 9:87969513-87969535 GAGGGCAAGGGGATGGATGAAGG - Intronic
1056772989 9:89492997-89493019 ATGGTCAAGTGGAGGGAGATGGG - Intronic
1056778652 9:89532971-89532993 CAAGGCAGGTGGAAGGAGGATGG + Intergenic
1056882831 9:90413834-90413856 AAGGACGAATGGAGGGTGGAAGG - Intergenic
1057175375 9:92993606-92993628 TGGGGTAAGGGGAGGGAGGAGGG - Intronic
1057234695 9:93348864-93348886 AAGGACGAATGGAGGGTGGAAGG - Intergenic
1057892695 9:98881345-98881367 GGGGGCAAGGGGTGGGAGGAAGG - Intergenic
1057944576 9:99314168-99314190 AAGAGAGAGAGGAGGGAGGAAGG - Intergenic
1058297183 9:103324007-103324029 AAGGGGAAGGGGAAGGAGAAAGG - Intergenic
1059172048 9:112134593-112134615 GAGGACAAATAGAGGGAGGAGGG + Intronic
1059208321 9:112486960-112486982 AAAGGTAAGTGGAGCGGGGAAGG - Exonic
1059309929 9:113381341-113381363 AAAGGGAAGGGAAGGGAGGAGGG - Intergenic
1059322167 9:113478223-113478245 AAGAGAAAGAGCAGGGAGGAAGG - Intronic
1059517278 9:114907640-114907662 AAGGGAAAGGGGAGGAGGGAAGG - Intronic
1059653717 9:116338190-116338212 AAGAATAAATGGAGGGAGGAGGG - Intronic
1060027768 9:120187506-120187528 AAGGGCCAGTAGTGGGGGGAAGG - Intergenic
1060069929 9:120537363-120537385 GAGGGCAAGGGCAGGGAGGAGGG - Intronic
1060124850 9:121033877-121033899 AAGAGGGAGGGGAGGGAGGAAGG - Intronic
1060205793 9:121682138-121682160 ACGGGCTAGGGGAGGGAGGAGGG - Intronic
1060529933 9:124342164-124342186 TAGGGCAAGTGGGGGCAGGGCGG - Intronic
1061291837 9:129654898-129654920 TAGGGCCCGGGGAGGGAGGAAGG + Intergenic
1061331894 9:129899818-129899840 AAGGGGAAGGGAAGGTAGGAAGG + Intronic
1061377602 9:130235499-130235521 AAGGGCAGGACGATGGAGGAAGG - Exonic
1061466610 9:130785508-130785530 AAGGGCAGGTAGAGTGAAGAGGG - Intronic
1061824425 9:133248895-133248917 AGGGTCCTGTGGAGGGAGGAGGG + Intergenic
1061962919 9:133997676-133997698 AGGGGCAGGTGGAGGGATGATGG - Intergenic
1061987208 9:134136522-134136544 AAGGGGCAGTGGAGGGAGAGGGG - Intronic
1062080852 9:134622623-134622645 AAGAGAAAGAGGAGGGAGGAGGG - Intergenic
1062080883 9:134622722-134622744 AAGAGAAAGAGGAGGGAGGAGGG - Intergenic
1062080914 9:134622823-134622845 AAGAGAAAGAGGAGGGAGGAGGG - Intergenic
1062194172 9:135263979-135264001 AAGGGGAGGGGGAGGGAGGGTGG - Intergenic
1062314580 9:135960516-135960538 AAGGGGAAGAGGAAGGAGAAGGG + Intronic
1062321142 9:135991028-135991050 AATGGCAGGATGAGGGAGGAGGG - Intergenic
1062362608 9:136194757-136194779 AAGGGGAAGGGGAGGGAAGAGGG - Intergenic
1062469611 9:136696830-136696852 GAGGGGGAGGGGAGGGAGGAGGG - Intergenic
1062469621 9:136696848-136696870 GAGGGGGAGGGGAGGGAGGAGGG - Intergenic
1062469631 9:136696866-136696888 GAGGGGGAGGGGAGGGAGGAGGG - Intergenic
1062469653 9:136696910-136696932 GAGGGGGAGGGGAGGGAGGAGGG - Intergenic
1062469663 9:136696928-136696950 GAGGGGGAGGGGAGGGAGGAGGG - Intergenic
1062469686 9:136696973-136696995 GAGGGGGAGGGGAGGGAGGAGGG - Intergenic
1185581340 X:1213184-1213206 GAGGGGGAGGGGAGGGAGGAGGG - Intergenic
1185581511 X:1213610-1213632 GAGGGAGAGGGGAGGGAGGAGGG - Intergenic
1185583090 X:1226126-1226148 ATGGGTGGGTGGAGGGAGGAAGG + Intergenic
1185608429 X:1380436-1380458 AAGGGGAAGAGGGGGGAGGAGGG + Intronic
1185627578 X:1493356-1493378 GAGGGGAGGGGGAGGGAGGAAGG + Intronic
1185668908 X:1790178-1790200 AAGGGAAAATGGGGGGAGAAAGG - Intergenic
1185756923 X:2659753-2659775 AGGGGGAAGGGGAGGGGGGAGGG - Intergenic
1185822440 X:3218481-3218503 AAGGGGAAGGGAAGGGAGGGAGG + Intergenic
1185867546 X:3637043-3637065 AAGGGAAAGGGAAGGGAGGAAGG + Intronic
1186145761 X:6622038-6622060 AAGGGAAGGAGGAGGGAGAAAGG + Intergenic
1186473778 X:9841471-9841493 AAGGGAAGGAGGAGGCAGGAGGG + Intronic
1187213148 X:17249422-17249444 AAAGGGAAATGGAGGCAGGAAGG - Intergenic
1187381665 X:18807478-18807500 AAGAGCAAGAAGAGGGTGGAAGG - Intronic
1187757789 X:22546037-22546059 ACTGGCAAGTAGAGGGATGATGG - Intergenic
1187801615 X:23069787-23069809 AAGGGCAGGAGGAGGAAGAATGG + Intergenic
1187817355 X:23247205-23247227 AAGAGAAAGTAGGGGGAGGAAGG - Intergenic
1188004043 X:25005322-25005344 AAGGGAAGGTGGAGGGTGGGAGG + Intronic
1188033336 X:25289151-25289173 AAGGGGAAGGGGAAGGAGAAGGG - Intergenic
1188332841 X:28895041-28895063 AAGTGCAAGTGAAGAGAGGCTGG + Intronic
1188430873 X:30104600-30104622 AAGGGGGAATGGAGGGTGGAAGG - Intergenic
1188595347 X:31893570-31893592 AAGGGGAAAGGGAGGGAGGGAGG + Intronic
1188741210 X:33784760-33784782 AAGGGAAAGGGAAGGGAAGAAGG - Intergenic
1188821012 X:34775075-34775097 GGGGGAAAGTGGAGGGAGGGAGG + Intergenic
1189110705 X:38286413-38286435 AAGGGAAAGGGGAGGAAGAAGGG - Exonic
1189110794 X:38286716-38286738 AAGGGAAAGAGGAAGGAGAAGGG - Exonic
1189230795 X:39451036-39451058 AAGGGGAAGCAGAGGGAGGAAGG - Intergenic
1189370118 X:40421227-40421249 GAGGCCATGTGGAGGGAGAAAGG - Intergenic
1189571235 X:42300088-42300110 AAGGCCTACTGGAGGGTGGAGGG - Intergenic
1189681164 X:43518220-43518242 AGTGGGAAGTGGAGGGAGAAAGG - Intergenic
1189988781 X:46575489-46575511 AGGGGGAAGTGTAGGGGGGAGGG + Intronic
1190286725 X:48966405-48966427 ATGGGCAAGGGAAGGGAAGAGGG - Intronic
1190296136 X:49029102-49029124 TAGGGCAAGAGGATGAAGGAAGG - Exonic
1190417970 X:50199793-50199815 AATGGAAAGGGGAGGGAGGGAGG - Intronic
1190561936 X:51694944-51694966 AAGGGGAAGGGGAAGGAGAAAGG + Intergenic
1190642288 X:52492431-52492453 AAGGACAAATGGAGCGAGGGAGG - Intergenic
1190645385 X:52520436-52520458 AAGGACAAATGGAGCGAGGGAGG + Intronic
1190752137 X:53371998-53372020 AAGGGAATTTGGGGGGAGGAGGG - Intergenic
1191805962 X:65134117-65134139 AAGGGGGAATGGAGGGTGGAAGG + Intergenic
1192017732 X:67349772-67349794 AAGGGCAAGAGAAGGCAAGAGGG + Intergenic
1192065300 X:67879019-67879041 TAAGGTAAGTGGAAGGAGGAAGG + Intergenic
1192448957 X:71230897-71230919 AAGGGGAAGGGGAAGGAAGAGGG + Intergenic
1192706317 X:73530961-73530983 AAGTGAAAGTGAAGGGAGGCTGG - Intergenic
1193716226 X:84937409-84937431 AAGGGGAGATGGAGGGATGAAGG + Intergenic
1194044843 X:88989787-88989809 AAGAGCAAATAGTGGGAGGAAGG - Intergenic
1194348513 X:92796029-92796051 AGGGGGAAGGGGAGGGGGGAAGG + Intergenic
1194465996 X:94236359-94236381 AAGGGAAAGGAGAGAGAGGAAGG - Intergenic
1194486166 X:94489976-94489998 AAGGGCAAATGGGGGGAAGAAGG - Intergenic
1194912487 X:99664060-99664082 AAAGACAGGTGGAGAGAGGAAGG - Intergenic
1194929932 X:99875455-99875477 GAGGGCAGGGGGTGGGAGGAGGG - Intergenic
1194992922 X:100564085-100564107 AAGGGGAGGTGGATGGGGGAGGG + Intergenic
1195234922 X:102887828-102887850 AAGGGAAAGGGAAGGGAGGAAGG - Intergenic
1195390134 X:104353088-104353110 AAGGGAAAGTGATGGGAGGTGGG + Intergenic
1195557220 X:106240876-106240898 AAGGGAGAGTAGGGGGAGGAGGG + Intergenic
1195676895 X:107513427-107513449 AATGGCAAGGGGCAGGAGGATGG - Intergenic
1196030575 X:111091712-111091734 ATGGGCATGGGGAGGCAGGAAGG + Intronic
1196305301 X:114095538-114095560 ATGGGGAATGGGAGGGAGGAGGG - Intergenic
1196812673 X:119641128-119641150 AAGGGGAAGTGGAATGAGGGGGG + Intronic
1196883275 X:120219940-120219962 AAGGGCAAGTAGACAGAGGCTGG - Intergenic
1196898418 X:120360268-120360290 AGGGACAAGGGGAGGGAGAAAGG - Intergenic
1196913226 X:120505531-120505553 AAGGGAAGGGGGAGGGAGGAAGG - Intergenic
1196923397 X:120607787-120607809 TTGGGGAAGTGGGGGGAGGAAGG - Intronic
1196976571 X:121164182-121164204 ACTGGAGAGTGGAGGGAGGAGGG - Intergenic
1197470811 X:126864352-126864374 AAGGGGGAATGGAGGGTGGAAGG - Intergenic
1197734726 X:129842575-129842597 AAGGTGAAGTGGAGGAAGGGAGG - Intronic
1197841687 X:130754736-130754758 AAGGGGGAGGGGAGAGAGGAAGG + Intronic
1198875155 X:141216749-141216771 AAGGGAAGGTGGTTGGAGGATGG + Intergenic
1199039868 X:143100166-143100188 AAGGGGAATTGACGGGAGGAGGG + Intergenic
1199264762 X:145817753-145817775 AAGGGAGGGAGGAGGGAGGAGGG - Intergenic
1199303547 X:146240744-146240766 AAGGGGATAGGGAGGGAGGAGGG - Intergenic
1199433786 X:147789745-147789767 AAGGCCATAGGGAGGGAGGAAGG + Intergenic
1199547526 X:149021937-149021959 AAGGGAAAAGGGAGGGAGAAAGG - Intergenic
1199617744 X:149671374-149671396 TTGGGGAAGTGGATGGAGGAGGG + Intergenic
1199624898 X:149731875-149731897 TTGGGGAAGTGGATGGAGGAGGG - Intergenic
1199811504 X:151354411-151354433 AAGGACAAGTGCATGGAGGCAGG + Intergenic
1199812577 X:151365333-151365355 AAGGGGAAGGGGAAGGAGAAGGG - Intergenic
1199846718 X:151697024-151697046 GAAGGGAAGGGGAGGGAGGAAGG - Intronic
1200094749 X:153652075-153652097 AAGGGCAGCTGGAGGGTGGCGGG + Intergenic
1201230147 Y:11856278-11856300 AAGGGGAAGGGGAAGGAGAAGGG + Intergenic
1202021132 Y:20466288-20466310 AATGGAAATTGAAGGGAGGAGGG - Intergenic