ID: 1085614867

View in Genome Browser
Species Human (GRCh38)
Location 11:77989644-77989666
Sequence ATTTGGAAGCCCAAGGAGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 65486
Summary {0: 1, 1: 6, 2: 232, 3: 5594, 4: 59653}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085614863_1085614867 -8 Left 1085614863 11:77989629-77989651 CCTGTAATCTCAGCAATTTGGAA 0: 12
1: 1195
2: 34246
3: 350954
4: 328709
Right 1085614867 11:77989644-77989666 ATTTGGAAGCCCAAGGAGGGTGG 0: 1
1: 6
2: 232
3: 5594
4: 59653

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085614867 Original CRISPR ATTTGGAAGCCCAAGGAGGG TGG Intronic
Too many off-targets to display for this crispr