ID: 1085618110

View in Genome Browser
Species Human (GRCh38)
Location 11:78017216-78017238
Sequence TGAGTTCCACACCACCACCC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 303
Summary {0: 1, 1: 1, 2: 0, 3: 21, 4: 280}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085618110_1085618117 15 Left 1085618110 11:78017216-78017238 CCAGGGTGGTGGTGTGGAACTCA 0: 1
1: 1
2: 0
3: 21
4: 280
Right 1085618117 11:78017254-78017276 TCCACAACAGTAGACATCTGGGG 0: 1
1: 0
2: 0
3: 8
4: 146
1085618110_1085618115 13 Left 1085618110 11:78017216-78017238 CCAGGGTGGTGGTGTGGAACTCA 0: 1
1: 1
2: 0
3: 21
4: 280
Right 1085618115 11:78017252-78017274 GCTCCACAACAGTAGACATCTGG 0: 1
1: 0
2: 1
3: 32
4: 420
1085618110_1085618119 16 Left 1085618110 11:78017216-78017238 CCAGGGTGGTGGTGTGGAACTCA 0: 1
1: 1
2: 0
3: 21
4: 280
Right 1085618119 11:78017255-78017277 CCACAACAGTAGACATCTGGGGG 0: 1
1: 0
2: 2
3: 7
4: 103
1085618110_1085618116 14 Left 1085618110 11:78017216-78017238 CCAGGGTGGTGGTGTGGAACTCA 0: 1
1: 1
2: 0
3: 21
4: 280
Right 1085618116 11:78017253-78017275 CTCCACAACAGTAGACATCTGGG 0: 1
1: 0
2: 2
3: 7
4: 143
1085618110_1085618120 25 Left 1085618110 11:78017216-78017238 CCAGGGTGGTGGTGTGGAACTCA 0: 1
1: 1
2: 0
3: 21
4: 280
Right 1085618120 11:78017264-78017286 TAGACATCTGGGGGCACAAGAGG 0: 1
1: 0
2: 1
3: 13
4: 142

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085618110 Original CRISPR TGAGTTCCACACCACCACCC TGG (reversed) Exonic
900469958 1:2848894-2848916 TCAGTTCCACACTCCCACCCAGG - Intergenic
900470007 1:2849084-2849106 TCAATTCCACACTCCCACCCAGG - Intergenic
900470102 1:2849402-2849424 TCAATTCCACACTCCCACCCAGG - Intergenic
900470190 1:2849720-2849742 TCAATTCCACACTTCCACCCAGG - Intergenic
900550997 1:3255503-3255525 TGAATGCCACACCTCCTCCCAGG - Intronic
902645638 1:17796099-17796121 TGACTTCAACATCTCCACCCTGG - Intronic
902743162 1:18454586-18454608 TGGGTTCCTGACCACCACCTAGG + Intergenic
903725903 1:25444231-25444253 TGAGTTTCACTCTATCACCCAGG - Intronic
904678892 1:32215313-32215335 TGCATTCCCCACCACCTCCCAGG - Intronic
905694420 1:39964530-39964552 TGAGTTCCACACCATCAAAAGGG - Intronic
906009378 1:42509471-42509493 TGAGTTTGAGACCCCCACCCAGG + Intronic
906837647 1:49101211-49101233 AGAGTTTCACTCCATCACCCAGG + Intronic
907461672 1:54609028-54609050 TGAGTTCTACACCACCTTCAAGG + Intronic
909581965 1:77246709-77246731 TGAGTTTCACTCTATCACCCAGG - Intergenic
911195051 1:94986198-94986220 TGTGTCTCACACCACCACCCGGG + Intronic
912580874 1:110719822-110719844 TCAGTTCCTCACCAACACCCAGG - Intergenic
916805603 1:168257531-168257553 TGCCCTCCCCACCACCACCCTGG + Intergenic
917219083 1:172708256-172708278 TGATTTCCACACCCCCGGCCAGG - Intergenic
918126500 1:181588621-181588643 TGAATTTCACACCACGAACCAGG + Intronic
918362302 1:183771780-183771802 TGCGTTTCCCAACACCACCCTGG + Intronic
920380968 1:205534359-205534381 TGAGTTCCACACCCCCAGGCTGG - Intergenic
921187430 1:212682752-212682774 TGTGGTCAACACCACCACCACGG - Intergenic
922163058 1:223092507-223092529 TTACTTCCACACCACAGCCCAGG + Intergenic
922360843 1:224819826-224819848 TGATTTCCAAACCATCTCCCTGG + Intergenic
922751628 1:228072850-228072872 GGGCTTCCACACCACCAGCCTGG + Intergenic
922753175 1:228080477-228080499 TGGGCTCCCCACCACCACCGGGG - Intergenic
922767146 1:228162127-228162149 TGAGCCCCACACCACCACGCAGG + Intergenic
922772141 1:228191512-228191534 TGGGTTTCACACTATCACCCAGG + Intergenic
923957389 1:239038655-239038677 AGAGTTTCACGCCATCACCCAGG - Intergenic
1063306991 10:4911393-4911415 TGAGTACCAGGCCACCACACAGG - Intergenic
1063307456 10:4918324-4918346 TGAGTACCAGGCCACCACACAGG + Intergenic
1064104780 10:12491811-12491833 AGAGTCTCACACCATCACCCAGG + Intronic
1065318658 10:24488318-24488340 TAAGTTCCCTACCACTACCCAGG - Intronic
1069095292 10:64252000-64252022 TGATGTACATACCACCACCCAGG - Intergenic
1069509477 10:69031022-69031044 AGAGTTTCACTCCACCACCCAGG + Intergenic
1069560809 10:69428009-69428031 CCAGGTGCACACCACCACCCCGG + Intergenic
1070157290 10:73843270-73843292 GGAGTTCGAGACCACCAGCCTGG - Intronic
1070818918 10:79343443-79343465 TGAGCTCCACCCTACCACACTGG + Intergenic
1071895773 10:90065182-90065204 TGAGTTCCACACTGCCCCACTGG - Intergenic
1072233375 10:93431953-93431975 AGAGTTCAAGACCACCAGCCTGG - Intronic
1072966563 10:99978779-99978801 GGAGTTCAAGACCACCAGCCTGG - Intronic
1073114348 10:101082864-101082886 AGACTTCCGCACCACCACCAGGG - Intergenic
1074871909 10:117583571-117583593 AGAGTTCAAGACCACCACCCTGG - Intergenic
1076694396 10:132240147-132240169 TGGGTTTCAGGCCACCACCCAGG - Intronic
1080021973 11:27571673-27571695 TGAGTTCCACACAACACCCTGGG + Intergenic
1083053192 11:59795196-59795218 TGACTGCCACCCCACCACCAAGG + Intronic
1083278841 11:61613046-61613068 GGAGTTCAAGACCACCAGCCTGG - Intergenic
1083540128 11:63506596-63506618 TCCTTTCCACCCCACCACCCAGG - Intronic
1083745741 11:64735629-64735651 CGAGTTGCACCCCACCACCCCGG - Exonic
1084248212 11:67874922-67874944 AGAGTTTCACTCCATCACCCAGG - Intergenic
1085618110 11:78017216-78017238 TGAGTTCCACACCACCACCCTGG - Exonic
1087268611 11:96087979-96088001 TGATTTCCCCACTGCCACCCAGG + Intronic
1088244276 11:107801900-107801922 TGAGCTACACATCACCTCCCTGG + Intronic
1089698990 11:120232913-120232935 TGAGTCTCACTCCATCACCCAGG - Intergenic
1090793877 11:130117103-130117125 GGAGTCTCACACCATCACCCAGG - Intronic
1091047193 11:132335149-132335171 TGAGTGCCACTTCCCCACCCGGG + Exonic
1092061358 12:5553543-5553565 TGTGATCCACACCACCAGCTTGG - Intronic
1092156775 12:6287674-6287696 TCAGGTGCACACCACCACACCGG - Intergenic
1093091242 12:14923046-14923068 AGAGTTCCACTCTGCCACCCAGG - Intronic
1093811692 12:23499661-23499683 GGAGTCTCACTCCACCACCCAGG - Intergenic
1094149095 12:27262677-27262699 AGAGTCCCACTCCATCACCCAGG - Intronic
1094223549 12:28021364-28021386 TGAGTTTCACTCTGCCACCCAGG + Intergenic
1094472587 12:30817314-30817336 TGAATTCCAGGTCACCACCCAGG - Intergenic
1094554751 12:31487489-31487511 GGAGTTCAAGACCACCAGCCTGG + Intronic
1096162749 12:49393886-49393908 GGAGTTCAACACCACCAGCCTGG - Intronic
1096987282 12:55768448-55768470 TGAGTCCCACTCCATCGCCCAGG + Intronic
1097221953 12:57456272-57456294 TGAGCACCACATCACCAACCTGG + Exonic
1098643874 12:72873220-72873242 TGAATTCCAGGTCACCACCCAGG - Intergenic
1100233532 12:92634319-92634341 TGAGTACCAAGCCACCACACAGG + Intergenic
1101611393 12:106295760-106295782 TGAGTTTCACTCTGCCACCCAGG + Intronic
1101739527 12:107490183-107490205 TTAGTTCCACTCCACCGCCCAGG + Intronic
1101979660 12:109394902-109394924 ACAGGTACACACCACCACCCTGG + Intronic
1102453709 12:113058260-113058282 CCACTCCCACACCACCACCCGGG - Exonic
1102687272 12:114734717-114734739 TGAGTCCCGCTCCACCAACCTGG - Intergenic
1103003182 12:117401608-117401630 TGACTTCCCCAACACTACCCAGG - Intronic
1103256939 12:119549750-119549772 GGAGTTCGAGACCACCAGCCTGG + Intergenic
1103613016 12:122135503-122135525 GGAGTTCCACAGCAGCATCCTGG + Exonic
1104216829 12:126741947-126741969 TGACATCAACACCATCACCCCGG + Intergenic
1104673910 12:130699877-130699899 AGAGTCTCACACCATCACCCAGG - Intronic
1104714294 12:131006234-131006256 TGACCTCCACTCCACCAGCCTGG - Intronic
1107455881 13:40554115-40554137 TGTATTACCCACCACCACCCAGG + Intergenic
1109863621 13:68232869-68232891 TGAATTCCAGGTCACCACCCAGG + Intergenic
1110080855 13:71309403-71309425 AGAGTCTCACTCCACCACCCAGG + Intergenic
1111131762 13:83986107-83986129 TGAGTCTCACTCCATCACCCAGG + Intergenic
1114539279 14:23442880-23442902 TTTGTTCCACACCACCCCCATGG - Intergenic
1115223935 14:31084628-31084650 TCAGTTCCACTCCACCCGCCCGG + Intronic
1115398633 14:32935042-32935064 TGAGTCCCACCCCAGCACCCCGG - Intronic
1116347736 14:43816728-43816750 GGAGTTCGAGACCACCAGCCTGG + Intergenic
1116947659 14:50850947-50850969 TAACTTCCACAACACTACCCAGG + Intergenic
1118272124 14:64353095-64353117 TGAGTCTCACTCCATCACCCAGG - Intergenic
1118329854 14:64806704-64806726 TGAGTTCCCCACCACCACCCAGG - Intronic
1118768661 14:68927336-68927358 TCAGCTCCACACCCCCAGCCTGG + Intronic
1120424336 14:84328359-84328381 GGAGTTCGAGACCACCAGCCTGG + Intergenic
1121583410 14:95046928-95046950 TGGGTTCCACACCCCCGGCCTGG + Intergenic
1124578542 15:30930631-30930653 GGAGTTCCACACCACCAGGTCGG - Exonic
1126765553 15:52007870-52007892 GGAGTTCCACTCCGTCACCCAGG + Intronic
1130059920 15:80562098-80562120 TGAGTCTCACTCCATCACCCAGG + Intronic
1130602846 15:85288895-85288917 TGAGTTTCACTCCGTCACCCAGG - Intergenic
1131184427 15:90262903-90262925 TAAGTCCCAAACCATCACCCAGG - Intronic
1132203488 15:99970906-99970928 GGGGTTCCACACCACCACAGTGG - Intergenic
1132743102 16:1425778-1425800 CGAGGTCCCCGCCACCACCCGGG - Intergenic
1133566367 16:6998892-6998914 TGAGTTTCACTCTATCACCCAGG + Intronic
1133608754 16:7413477-7413499 TGAGGTCAACACTACCAGCCTGG + Intronic
1134184910 16:12077065-12077087 GGAGTTCAACACCACCAGTCTGG + Intronic
1134242175 16:12514099-12514121 TGAGTTCCACACCTCCCAGCTGG + Intronic
1135646728 16:24169440-24169462 TGCGTCCCTCAGCACCACCCTGG + Intronic
1136567225 16:31077683-31077705 AGAGGACCCCACCACCACCCTGG + Exonic
1138190385 16:55009441-55009463 TGACTGCCACACCCCCAGCCCGG - Intergenic
1138568303 16:57850191-57850213 GAAGTTCCAGACCACCAGCCTGG + Intronic
1138853567 16:60659409-60659431 TTAGAACCCCACCACCACCCTGG - Intergenic
1139405782 16:66716708-66716730 TGAGTCCCACTCCATAACCCAGG + Intergenic
1139523010 16:67495969-67495991 AGAGTTCCCCACCCACACCCCGG - Intergenic
1139720149 16:68845876-68845898 AGAGTTTCACTCCATCACCCAGG + Intronic
1141080928 16:81051843-81051865 TGAGTCTCACTCCATCACCCAGG + Intergenic
1143127194 17:4650266-4650288 AGAGTTCAAGACCACCAGCCTGG - Intergenic
1143537213 17:7548817-7548839 TGAGTTCCCCACCTCCCCGCAGG + Intergenic
1143645134 17:8225064-8225086 GGAGTTCCAGACCAGCAGCCTGG - Intergenic
1143794001 17:9321659-9321681 ACAGGTGCACACCACCACCCTGG + Intronic
1143849892 17:9802965-9802987 TGAATTCCTCACAGCCACCCTGG - Intronic
1143965047 17:10751050-10751072 GGAGTTCAAGACCACCAGCCTGG + Intergenic
1144730359 17:17522443-17522465 TGTGCTCCCCACCCCCACCCTGG - Intronic
1148943538 17:51237268-51237290 GGAGTCTCACACCATCACCCAGG - Intronic
1152401939 17:80071624-80071646 TGAGTCCCACACAACCTCCCTGG + Intronic
1152756045 17:82087517-82087539 GGAGTTCCACAGCACCAACCAGG - Intronic
1152902308 17:82949878-82949900 TGAGTGCCACAACACCAGCGTGG + Intronic
1157504669 18:48218024-48218046 AGACTGCCACACCACCACCATGG + Intronic
1158627607 18:59085061-59085083 TGACTTCCACAGCACCCCCATGG + Intergenic
1159208287 18:65281877-65281899 TGAGTTTCACTCCTTCACCCAGG - Intergenic
1159215196 18:65383672-65383694 TGAGTTTCTCAAGACCACCCTGG + Intergenic
1160320781 18:77892478-77892500 TTAGTAACCCACCACCACCCTGG + Intergenic
1161690529 19:5730706-5730728 GGAGTTCAATACCACCAGCCTGG + Intronic
1162476709 19:10904815-10904837 AGAGTGCCACAAAACCACCCTGG - Intronic
1162752540 19:12837865-12837887 AGAGGTGCACACCACCACACCGG + Intronic
1162882021 19:13666835-13666857 TGAGTCTCACTCCATCACCCAGG + Intergenic
1163341169 19:16708172-16708194 TGGGTTCCACTCCACCTCCCGGG + Intergenic
1163798530 19:19350992-19351014 GGAGTTCAAGACCACCAGCCTGG + Intronic
1163935031 19:20434793-20434815 ACAGGTGCACACCACCACCCTGG - Intergenic
1164764829 19:30756442-30756464 TGTGTTCCCCAGCCCCACCCTGG + Intergenic
1164960812 19:32427995-32428017 AGAGTTTCACTCCATCACCCAGG + Intronic
1165559680 19:36668152-36668174 GGAGTTCGAGACCACCAGCCTGG - Intergenic
1165570821 19:36773212-36773234 TGAGTTCCAAACTAACAGCCAGG - Exonic
1165639717 19:37374007-37374029 TGGATTCCACCCCGCCACCCTGG + Intronic
1165897722 19:39153282-39153304 AGAGTCCCACTCCATCACCCAGG + Intronic
1166538147 19:43588691-43588713 GGAGTTTCACTCCATCACCCAGG - Exonic
1166752753 19:45172493-45172515 TGGGTTCCCCACCACACCCCTGG - Intronic
1168596737 19:57683582-57683604 TGTGATCCACAGCTCCACCCCGG - Intronic
925003176 2:422473-422495 TGTGCTCCACAACACCGCCCAGG + Intergenic
925024157 2:594800-594822 GGAGATCCACACCGCCATCCAGG + Intergenic
925053002 2:831515-831537 TGGCTTCCATACCACCCCCCAGG + Intergenic
925865650 2:8223854-8223876 TGTGTTTCCCACCCCCACCCAGG - Intergenic
926121524 2:10243622-10243644 TGACTTCCACAACGCCACACAGG + Intergenic
927997046 2:27494080-27494102 GGAGGTGAACACCACCACCCGGG - Exonic
928570155 2:32598994-32599016 GGAGTTTCACTCCACCGCCCAGG - Intronic
929130555 2:38565497-38565519 GGAGTTCAAGACCACCAGCCTGG + Intronic
930649674 2:53952227-53952249 GGAGTTCGAGACCACCAGCCTGG + Intronic
930761856 2:55047118-55047140 GGAGTTCAAGACCACCAGCCTGG + Intronic
931237816 2:60426442-60426464 TCAGATCCTCACCACAACCCTGG + Intergenic
932618577 2:73251911-73251933 GGAGTCTCACACTACCACCCGGG - Intronic
935230172 2:101089141-101089163 GGAGTTCAAGACCACCACCCTGG + Intronic
940115202 2:150201057-150201079 AGAGTTCAACACCAGCCCCCGGG + Intergenic
941022400 2:160422784-160422806 TGAGTTACTCACAACCTCCCAGG + Intronic
941709141 2:168693432-168693454 TTACTTCCACATCACCACCTGGG - Intronic
944540018 2:200745794-200745816 TGAATTCCACCCGGCCACCCGGG - Intergenic
944920204 2:204404711-204404733 TGTGTTCCACACCATTTCCCAGG - Intergenic
947837871 2:233188335-233188357 TCTGTGCGACACCACCACCCTGG - Intronic
948129690 2:235591394-235591416 TGCGTTTCACACCAAGACCCGGG - Intronic
948456561 2:238107197-238107219 TGTGGTCCACAGCACCAGCCAGG - Intronic
1169349507 20:4856642-4856664 TCAGTTCCCTTCCACCACCCAGG - Exonic
1169966674 20:11225386-11225408 TGAGTTCCCCACCAACCTCCAGG - Intergenic
1170697596 20:18673765-18673787 AGAGTCCCACAAAACCACCCTGG + Intronic
1171184361 20:23114306-23114328 TGAGGTCTACACCACCTCTCTGG + Intergenic
1172141600 20:32726179-32726201 GGAGTTCAAGACCACCAGCCTGG + Intronic
1172677432 20:36683589-36683611 GGAGTTTCACTCCATCACCCAGG - Intronic
1172935329 20:38616070-38616092 AGAGGGCCACCCCACCACCCAGG + Intronic
1174000913 20:47374066-47374088 TGAGTTTCACTCTATCACCCAGG + Intergenic
1174237461 20:49105565-49105587 GGAGTTCAAGACCACCAGCCTGG - Intergenic
1176024636 20:62979494-62979516 TGAGCTCAACAGCACCACGCGGG + Intergenic
1176040665 20:63064260-63064282 CGAGGTCCACACCAACACCCGGG - Intergenic
1179493255 21:41755362-41755384 TGACCTCCTCACCACCGCCCTGG + Intronic
1179652360 21:42819823-42819845 GGAGTCCCACACTATCACCCAGG - Intergenic
1180153130 21:45962656-45962678 TGAGTTCCAGGCCACCACACAGG + Intergenic
1180931906 22:19598057-19598079 TGAAGCCCCCACCACCACCCAGG - Intergenic
1182607568 22:31518194-31518216 GGAGTTCAAGACCACCAGCCTGG - Intronic
1182704246 22:32265812-32265834 AGAGTCCCACTCCATCACCCAGG - Intergenic
1184675765 22:46042283-46042305 GGAGATCGAGACCACCACCCTGG + Intergenic
1184847790 22:47099810-47099832 TGTGTTCCACACCACCCTCCAGG + Intronic
1184914949 22:47562992-47563014 GGAGTTCCAGACCACCAGGCTGG - Intergenic
949631563 3:5933676-5933698 ACAGTTGCACACCACCACACTGG + Intergenic
950604111 3:14063014-14063036 TCAGTTTCACTCCATCACCCAGG - Intronic
950854894 3:16095700-16095722 TAAGATCCCCACCACCATCCAGG - Intergenic
952303707 3:32126855-32126877 TGAGTCCCAGACCACACCCCAGG - Intronic
954364172 3:50137592-50137614 TGCATTCCCCACCACCACACCGG + Intergenic
954936669 3:54333203-54333225 TGTCTTCCTCACCACCTCCCAGG + Intronic
955390534 3:58519356-58519378 AGAGTCTCACTCCACCACCCAGG - Intronic
960893660 3:122478510-122478532 GGAGTTCAAGACCACCAGCCTGG + Intronic
962715365 3:138121382-138121404 GGAGTTCGAGACCACCAGCCTGG - Intergenic
964281140 3:155067334-155067356 TGAGTCTCACTCCATCACCCAGG + Intronic
964499052 3:157327964-157327986 TGTGTTCCTAACCACCACCTTGG - Intronic
966466522 3:180235733-180235755 TGAATTCCAAGCCACCACACAGG - Intergenic
966822068 3:183932956-183932978 GGAGTTCAAGACCACCAGCCTGG + Intronic
967258758 3:187620912-187620934 TGATTTGCACACCGCCACTCTGG - Intergenic
967968836 3:194984760-194984782 AGTGTTCAACACCCCCACCCTGG + Intergenic
968113597 3:196070864-196070886 TGCATTCTCCACCACCACCCAGG - Intronic
968118662 3:196109039-196109061 AGAGTCTCACACCATCACCCAGG + Intergenic
968799671 4:2733683-2733705 AGAGTTCCCCATCACCACTCAGG - Intergenic
970141435 4:12986703-12986725 TGAGTCTCACTCCATCACCCAGG + Intergenic
970307763 4:14751013-14751035 TGATTTCCACTCCCCCAACCAGG + Intergenic
970384448 4:15542371-15542393 TTGTTTCCCCACCACCACCCAGG + Intronic
976940676 4:90698957-90698979 ACAGGTGCACACCACCACCCTGG - Intronic
978358597 4:107904400-107904422 TGACTTCCACACCACCAATTAGG - Intronic
980288548 4:130813543-130813565 TGAGAGCCACACCAGCACACTGG - Intergenic
981158737 4:141471616-141471638 TGATTGCCACACCACAACTCAGG - Intergenic
981324116 4:143427139-143427161 TGAATTCCAGGCCATCACCCAGG + Intronic
981782944 4:148445773-148445795 GGAGTCCCACGCCCCCACCCCGG + Intergenic
982212658 4:153051575-153051597 AGATTTCCAAACCAACACCCTGG - Intergenic
983058131 4:163123587-163123609 GGAGTTCAAGACCACCAACCTGG - Intronic
983133074 4:164045484-164045506 GGAGTCTCACTCCACCACCCAGG - Intronic
983450009 4:167897206-167897228 TGAATTCCAGGCCACCACACAGG + Intergenic
985128491 4:186718777-186718799 GGAGTTTCACAGCACCGCCCTGG + Intronic
985239828 4:187918132-187918154 AGAGTTTCACACTGCCACCCAGG - Intergenic
985489820 5:172583-172605 AGCGTCCCACACCCCCACCCCGG - Intronic
987239301 5:15977627-15977649 TGATTTCTAAACCACCACACAGG + Intergenic
987935961 5:24465087-24465109 TGAGTACCACGTCACCACACAGG - Intergenic
988304602 5:29478789-29478811 TGAATACCAGGCCACCACCCAGG - Intergenic
992748869 5:79843861-79843883 CGAGTTCCACACCCCCACATGGG + Intergenic
993166217 5:84357860-84357882 TGAGTCTCACTCCATCACCCAGG - Intronic
994366345 5:98921941-98921963 GGAGTTCAAGACCACCAGCCTGG + Intronic
994979622 5:106856952-106856974 TGAATCCCAGACCACCACACAGG + Intergenic
996168959 5:120264838-120264860 TGTGTCCCCCACCACGACCCTGG + Intergenic
998473830 5:142404393-142404415 TGCTTTCCCCGCCACCACCCCGG - Intergenic
998905963 5:146905448-146905470 GGAGTTCAAGACCACCAGCCTGG - Intronic
999186328 5:149712799-149712821 GGAGTTCGAGACCACCATCCTGG - Intergenic
1000770761 5:165350978-165351000 ACAGGTGCACACCACCACCCCGG + Intergenic
1001427641 5:171634178-171634200 TGTGTTCCACATCATCTCCCAGG + Intergenic
1001649500 5:173305326-173305348 TGAGATCAGGACCACCACCCCGG - Intergenic
1001958384 5:175864141-175864163 TTAGAGCCACACAACCACCCTGG + Intronic
1002297326 5:178238918-178238940 TGGGTTATACACCATCACCCAGG + Intronic
1002362021 5:178679814-178679836 AGAGTTCGAGACCACCAGCCTGG + Intergenic
1004288136 6:14341886-14341908 GGAGTTTCACTCCATCACCCAGG + Intergenic
1005689011 6:28283887-28283909 TGAGTTGCACACCTGCTCCCAGG - Exonic
1006454199 6:34122687-34122709 TCAGTTCCACACCAAGGCCCCGG + Intronic
1007096068 6:39213998-39214020 AGAGTCTCACACCATCACCCAGG - Intronic
1007138241 6:39543775-39543797 TGAGTTCCACCCAACCCCACAGG + Intronic
1007240841 6:40424170-40424192 TTGGTTCCACTCCACCACCTGGG - Intronic
1008130506 6:47715348-47715370 AGATTTCCACCCAACCACCCTGG - Intronic
1008833586 6:55799734-55799756 GGATTCCCACACCATCACCCAGG - Intronic
1010425327 6:75723018-75723040 GGAGTTCAAGACCACCAGCCTGG + Intergenic
1011818318 6:91220139-91220161 AGAGTTCAAGACCACCAGCCTGG + Intergenic
1011991145 6:93519170-93519192 GGAGTTCGAGACCACCAGCCTGG - Intergenic
1012222429 6:96665060-96665082 TTAGTTCCCCACTACCACCCAGG + Intergenic
1012804802 6:103879848-103879870 TGAATCCCAGACCACCACACAGG - Intergenic
1013875463 6:114821317-114821339 GGAGTCTCACTCCACCACCCAGG + Intergenic
1017473928 6:154768919-154768941 TTAGGTGCACACCACCACACTGG - Intronic
1018111935 6:160544691-160544713 CGAGTTACAGAACACCACCCTGG - Intronic
1019170495 6:170130845-170130867 AGGGTTCCACACCCCTACCCTGG + Intergenic
1019377217 7:699196-699218 TGGGTTCCCCACCATCAGCCAGG - Intronic
1019857332 7:3622269-3622291 GGAGTTCGACACCACCAGCCTGG + Intronic
1020056729 7:5122743-5122765 AGAGTTTCACTCCATCACCCAGG - Intergenic
1021416157 7:20387541-20387563 TGAGAACCACACCACCAGCAGGG - Intronic
1023805801 7:43872196-43872218 TGGGTTCCACACCACCTCTGTGG + Intronic
1027067357 7:75134360-75134382 AGAGTTTCACTCCAGCACCCAGG - Intronic
1027374872 7:77538437-77538459 CAAGTTCCCCACCCCCACCCCGG - Intronic
1030902106 7:115137348-115137370 TGAGTCCCACACGACCACAAAGG + Intergenic
1031064211 7:117086988-117087010 TGGGTTACACACCCTCACCCAGG + Intronic
1032055319 7:128679912-128679934 TGAGTTTCACACCCTAACCCTGG - Intronic
1033483445 7:141764290-141764312 TGACTTCATCATCACCACCCTGG + Exonic
1033593088 7:142831056-142831078 TGAGTCCCCCACCACCCACCAGG + Intergenic
1034348953 7:150404350-150404372 TGTGTTCCACTGCACCGCCCTGG - Intronic
1036286216 8:7446075-7446097 TGAGTCTCACTCCATCACCCAGG - Intronic
1036335259 8:7865453-7865475 TGAGTCTCACTCCATCACCCAGG + Intronic
1039184668 8:34903818-34903840 TGAGTTCCACATCATCAACTGGG + Intergenic
1040993891 8:53381126-53381148 GGAGTCTCACTCCACCACCCAGG - Intergenic
1041797604 8:61761740-61761762 TTAGTTCCAAACCACCTCCCCGG - Intergenic
1041882269 8:62765219-62765241 GGAGTCTCACACCATCACCCAGG - Intronic
1044959865 8:97519680-97519702 TGACTTCCTCTCCTCCACCCAGG - Intergenic
1046524253 8:115364017-115364039 TGGGTTTCACTCCATCACCCAGG + Intergenic
1049227335 8:141461854-141461876 GGAGTTCAAGACCACCAGCCTGG + Intergenic
1051025834 9:12609905-12609927 TGAATCCCACCCCACCACCATGG + Intergenic
1056188123 9:84156728-84156750 AGAGTCTCACACTACCACCCAGG - Intergenic
1056758862 9:89400530-89400552 TGAGTTCCTGAACAGCACCCAGG + Intronic
1057656185 9:96954883-96954905 TGAGCTGCACACCAGCACCATGG + Intronic
1057780749 9:98048037-98048059 GGAGTCTCACACCATCACCCAGG - Intergenic
1058106289 9:100975831-100975853 CGAGTTCCACAGCACCATCAAGG + Intergenic
1058334248 9:103805740-103805762 AGAGTTCAAGACCACCAACCTGG + Intergenic
1058429056 9:104901773-104901795 TGAGGTCCACACCACTAACAAGG - Intronic
1058657384 9:107235969-107235991 TCAGTTCCAAACCACAACCTCGG + Intergenic
1059160898 9:112034420-112034442 TAAGTACCCCACCACCACTCTGG - Intergenic
1059487135 9:114635468-114635490 AGAGTTCAACACCAGCAGCCTGG + Intronic
1061384604 9:130281570-130281592 TGAGTCTCACTCCATCACCCAGG - Intergenic
1062642787 9:137529681-137529703 GGAGTTTCACTCTACCACCCAGG + Intronic
1191135539 X:57059966-57059988 TGAGTCTCACTCCATCACCCTGG + Intergenic
1191254031 X:58272130-58272152 TGAGTTTCTGACCCCCACCCGGG - Intergenic
1192183261 X:68929509-68929531 TGTGTTCCCCTCCCCCACCCAGG + Intergenic
1192449616 X:71235815-71235837 GGAGTTTCACACTGCCACCCAGG + Intergenic
1194692994 X:97009891-97009913 TCAGCCCCCCACCACCACCCAGG - Intronic
1195167861 X:102238375-102238397 TGAGTTTGCCACCAACACCCAGG - Intergenic
1195190996 X:102448712-102448734 TGAGTTTGCCACCAACACCCAGG + Intronic
1195232311 X:102861935-102861957 GGAGTTCGAGACCACCAGCCTGG - Intergenic
1198566661 X:137912192-137912214 AGAGTTCCTCACCCCCACTCTGG - Intergenic
1199856726 X:151765080-151765102 TTAACTCCACACCAGCACCCAGG + Intergenic
1200765299 Y:7075952-7075974 TGAGTCTCACTCCATCACCCAGG + Intronic
1201699839 Y:16868773-16868795 TCAGGTGCACACCACCACACTGG + Intergenic
1202050644 Y:20777047-20777069 TGAGGTGCCCACCACCACACTGG + Intronic