ID: 1085619022

View in Genome Browser
Species Human (GRCh38)
Location 11:78023292-78023314
Sequence GAGCCTCGGTGTTCCCACCT AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 215
Summary {0: 1, 1: 0, 2: 3, 3: 22, 4: 189}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085619022_1085619027 -10 Left 1085619022 11:78023292-78023314 CCTAGGTGGGAACACCGAGGCTC 0: 1
1: 0
2: 3
3: 22
4: 189
Right 1085619027 11:78023305-78023327 ACCGAGGCTCAAGGCGGGACGGG 0: 1
1: 0
2: 0
3: 9
4: 61
1085619022_1085619030 1 Left 1085619022 11:78023292-78023314 CCTAGGTGGGAACACCGAGGCTC 0: 1
1: 0
2: 3
3: 22
4: 189
Right 1085619030 11:78023316-78023338 AGGCGGGACGGGGCTGAGCCAGG 0: 1
1: 1
2: 7
3: 52
4: 533
1085619022_1085619031 6 Left 1085619022 11:78023292-78023314 CCTAGGTGGGAACACCGAGGCTC 0: 1
1: 0
2: 3
3: 22
4: 189
Right 1085619031 11:78023321-78023343 GGACGGGGCTGAGCCAGGCGTGG 0: 1
1: 0
2: 2
3: 54
4: 605
1085619022_1085619033 22 Left 1085619022 11:78023292-78023314 CCTAGGTGGGAACACCGAGGCTC 0: 1
1: 0
2: 3
3: 22
4: 189
Right 1085619033 11:78023337-78023359 GGCGTGGCTTGCAGTGAGACTGG 0: 1
1: 0
2: 11
3: 439
4: 1399
1085619022_1085619034 23 Left 1085619022 11:78023292-78023314 CCTAGGTGGGAACACCGAGGCTC 0: 1
1: 0
2: 3
3: 22
4: 189
Right 1085619034 11:78023338-78023360 GCGTGGCTTGCAGTGAGACTGGG 0: 1
1: 0
2: 3
3: 36
4: 774
1085619022_1085619029 -9 Left 1085619022 11:78023292-78023314 CCTAGGTGGGAACACCGAGGCTC 0: 1
1: 0
2: 3
3: 22
4: 189
Right 1085619029 11:78023306-78023328 CCGAGGCTCAAGGCGGGACGGGG 0: 1
1: 0
2: 0
3: 3
4: 87

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085619022 Original CRISPR GAGCCTCGGTGTTCCCACCT AGG (reversed) Exonic
900097920 1:947864-947886 CAGCCTTGTGGTTCCCACCTGGG + Intronic
902045014 1:13517637-13517659 AAGCCTCAGTTTTCCCATCTAGG + Intergenic
902554545 1:17239186-17239208 CAGCCTCAGTGTTCTCATCTGGG + Intronic
902744607 1:18465109-18465131 GAGCCTCATTTTTCCCACCTAGG + Intergenic
903320334 1:22539203-22539225 GAGCCTCGAGGTTCCCAACATGG + Intergenic
903828677 1:26162097-26162119 GAGCCGCGGCGGTCACACCTCGG - Exonic
905009553 1:34738011-34738033 GTGCCTCAGTCTCCCCACCTGGG + Intronic
910539456 1:88339183-88339205 GAGCCCAAGTGTTCCCAGCTAGG - Intergenic
911550981 1:99280220-99280242 GAGTCTGGGTGTTCCCAATTTGG + Intronic
914196625 1:145451190-145451212 GAGCCTCCGTGTTCTCACCTGGG - Intergenic
914375711 1:147071959-147071981 GAGCCTAGATCTGCCCACCTAGG - Intergenic
918113709 1:181480065-181480087 GAGCCTAGGAGTTGCCAGCTAGG + Intronic
919821448 1:201475524-201475546 GAGGCTCTATGTGCCCACCTTGG - Intergenic
920502115 1:206491986-206492008 GAGCCTCAGTTTCCTCACCTAGG - Exonic
920657985 1:207890596-207890618 GAGCCTGGGTTTTCCTGCCTTGG - Intronic
922704201 1:227780419-227780441 GAGCCTTTGCGTTACCACCTGGG - Intronic
922786850 1:228287143-228287165 GAGCCTGGGTGCTCCTGCCTTGG - Intronic
922956608 1:229607204-229607226 GAGCCTTGGAGATTCCACCTTGG + Intronic
923565383 1:235072483-235072505 GAGCCCAGGAGTTCCCAGCTTGG + Intergenic
1063685661 10:8235348-8235370 GGGCCTCGTCGTTGCCACCTTGG + Intergenic
1067995963 10:51273479-51273501 GCGCCACTGGGTTCCCACCTGGG + Intronic
1069774584 10:70919115-70919137 GGGCCTCAGTGTTCTCATCTTGG - Intergenic
1070798283 10:79229960-79229982 GAGCCTCAGTTTCCTCACCTGGG - Intronic
1071501834 10:86209893-86209915 GAGCCTCAGTTTCCCCATCTGGG + Intronic
1071577486 10:86739959-86739981 GCGGGCCGGTGTTCCCACCTCGG + Intergenic
1073022028 10:100453121-100453143 GAGTCTCCCTGTTGCCACCTGGG - Intergenic
1073439942 10:103546610-103546632 AAGCCTCAATGTTCCCATCTAGG + Intronic
1075161404 10:120027855-120027877 CAGCCTCAGTGTCCCCACCTAGG - Intergenic
1075468026 10:122666051-122666073 GAGCCTCTGGGCTCCCGCCTGGG + Intergenic
1076131913 10:128019252-128019274 GAGCCTCAGTTTCCCCAGCTGGG + Intronic
1076887048 10:133267752-133267774 AAGCCTCAGTGTTCCCAGCAGGG + Intronic
1077052374 11:573081-573103 GAGCCCAGGAGTTCCAACCTGGG - Intergenic
1077171363 11:1167704-1167726 GTGCCTGGGTGTCCACACCTGGG + Intronic
1077317586 11:1926233-1926255 GAGCCTCAGTTTCCCCACCTGGG + Intronic
1077373195 11:2193214-2193236 GGGCCTCAGTGTCCCCACCTGGG + Intergenic
1077494730 11:2881453-2881475 GGGCCTCGGTTTCCCCATCTGGG - Intergenic
1079088699 11:17465406-17465428 GAGCCTCGGATTCCCCACCTGGG - Intronic
1081853037 11:46286973-46286995 GAGCCTGGGAGTACGCACCTGGG - Intronic
1082028478 11:47588941-47588963 GAGCCTCCAAGTTCCCATCTGGG + Exonic
1082801013 11:57414873-57414895 GAGGCTCTGTGTTCCCAGCTGGG + Intronic
1084080826 11:66823266-66823288 GAGTCTCGCTGTTGTCACCTGGG - Intronic
1084177020 11:67428274-67428296 GACCCTCGGTCTTCCCAGCAAGG - Intergenic
1084341609 11:68507295-68507317 AAGTCTTGGTGTTCCTACCTCGG + Intronic
1084467597 11:69335291-69335313 GAGCCTCGGTGGACACACCTGGG + Intronic
1084668866 11:70593481-70593503 CAGCCTCAGTTTCCCCACCTGGG + Intronic
1085395414 11:76204789-76204811 GGGTCTCGGTGTTCCCACTGTGG + Intronic
1085411875 11:76296299-76296321 GGGCCTCAGTTTCCCCACCTGGG - Intergenic
1085619022 11:78023292-78023314 GAGCCTCGGTGTTCCCACCTAGG - Exonic
1087582052 11:100069366-100069388 TAGCCTGGGAGTTCCCAGCTCGG - Intronic
1089636950 11:119820931-119820953 GACCCTGGGGGTTCCCACCCTGG + Intergenic
1090206355 11:124886675-124886697 GAGTCTTGCTGTGCCCACCTCGG - Exonic
1091834524 12:3576261-3576283 GAACCTCAGTTTTCTCACCTGGG - Intronic
1091930122 12:4389316-4389338 CAGCCTCGCTGTCCCCACCCAGG + Intergenic
1094664401 12:32504302-32504324 GAGCATCTGTGATCCCAACTAGG + Intronic
1094828953 12:34291125-34291147 GAGCCTGGGTTTTCCCACGGAGG - Intergenic
1100211636 12:92404912-92404934 AAGCCTCAGTGTACCAACCTAGG - Intergenic
1101812668 12:108121151-108121173 GAGCCTCCGTCTTCCCATTTGGG + Intergenic
1102213048 12:111140869-111140891 TTGGCTCAGTGTTCCCACCTGGG + Intronic
1102466337 12:113132916-113132938 GAGCCTCAGTTTCCCCATCTGGG + Intronic
1103003863 12:117406376-117406398 AAGGCTCCATGTTCCCACCTGGG - Intronic
1109004379 13:56852590-56852612 GATCCCAGGTGTTCCCTCCTTGG - Intergenic
1109300183 13:60583155-60583177 GAGCCTCGGTTTCCCCATTTGGG + Intergenic
1116761461 14:49020209-49020231 GAGCCCAGGTGAGCCCACCTGGG + Intergenic
1117599280 14:57357596-57357618 GAGCCACGTTGTGCCCACCTGGG - Intergenic
1118019196 14:61694194-61694216 AAGCCTGGGTGTTCCAGCCTAGG - Intergenic
1118406910 14:65433828-65433850 TAGCCACTGTGTTCCAACCTGGG - Intronic
1119616106 14:76100142-76100164 CAGCCAGGGTGCTCCCACCTTGG + Intergenic
1122116620 14:99530755-99530777 GAGTCTCAGTGTCCTCACCTGGG - Intronic
1122954572 14:105064655-105064677 GAGCCTCTGCTCTCCCACCTCGG + Intronic
1123931649 15:25174863-25174885 GAGCCTTGGTGAGCCCATCTAGG + Intergenic
1125724316 15:41860623-41860645 GGGCCTCGGGGTGCCCACCCTGG + Exonic
1126459017 15:48895616-48895638 GAGCCAGGCTGTGCCCACCTGGG + Intronic
1127980462 15:64031132-64031154 GAGCCTCATTGTCCTCACCTGGG + Intronic
1128149835 15:65355868-65355890 GAGCCTCGGATTCCCCAGCTGGG + Intronic
1128348903 15:66876189-66876211 CAGCCTCGGTCTCCCCACCTCGG - Intergenic
1128744328 15:70103051-70103073 GGAGCTGGGTGTTCCCACCTGGG - Intergenic
1129221215 15:74132747-74132769 GAGCCGCGATGTTCCCCCTTCGG + Exonic
1129607167 15:77030598-77030620 GAGCCTCGTTTTCCCCAGCTGGG + Intronic
1129893718 15:79089185-79089207 GGGCCTCAGTGTCCCCATCTAGG + Intronic
1129925197 15:79357822-79357844 GAGCCTCAGCTTTCCCATCTGGG + Intronic
1130666101 15:85871463-85871485 GACCCCAGGTGATCCCACCTCGG + Intergenic
1131033950 15:89208870-89208892 GAGGCTTGTTGTTCCCACCAAGG - Intergenic
1131998545 15:98157057-98157079 GAGTCTCAGTGTCCTCACCTGGG + Intergenic
1132090110 15:98941152-98941174 GAGCCTCAGTTTCCTCACCTCGG + Intronic
1132581402 16:686314-686336 GAGCCTCAGCTTTCCTACCTGGG - Intronic
1132606747 16:796857-796879 GAGCCTGGGTGGGCTCACCTGGG - Exonic
1133421175 16:5648264-5648286 GAGCCTCAGTTTTCACATCTGGG + Intergenic
1134131140 16:11651024-11651046 GAGCCTCAGTTTCCCCACCTGGG - Intergenic
1134880255 16:17740007-17740029 GAGCCTCGGTGTGTCCACGGTGG + Intergenic
1134926550 16:18168008-18168030 GTGCCACTGTGCTCCCACCTGGG - Intergenic
1138605705 16:58086819-58086841 GAGCCTCGGGCTCCCCACGTGGG + Intergenic
1141174796 16:81711824-81711846 GAGCCTCAGATTTCCCGCCTGGG - Intergenic
1141663098 16:85452348-85452370 GAGCCTGTGTGTTCCCACTCTGG + Intergenic
1141854380 16:86671050-86671072 GAGCCTCAGTTTTCTCATCTGGG + Intergenic
1142032826 16:87846922-87846944 GAGCCTCGGTGTCTTCCCCTGGG - Intronic
1142140124 16:88469071-88469093 GAAACTCGCTGTTCCCATCTGGG - Intronic
1142148972 16:88504426-88504448 GGGCCTTGGTCTTCCCGCCTGGG - Intronic
1142835454 17:2582465-2582487 GAGCCTCGCTCTTGTCACCTAGG - Intergenic
1142994889 17:3754744-3754766 CAGCCTCGGTGTCCCCATCTCGG + Intronic
1143373964 17:6456639-6456661 GGGCCTCTGAGTTCCCAACTGGG + Intronic
1145889855 17:28406674-28406696 GAGCCTAGGTGCTCCAACCCAGG - Intronic
1148038720 17:44689436-44689458 GAGGCTCAGTGGTCTCACCTGGG - Intronic
1149455057 17:56781034-56781056 GTGCCTCGGTTTTCTCATCTGGG - Intergenic
1151413159 17:73944332-73944354 AAGCCTCAGTTTCCCCACCTGGG - Intergenic
1151612191 17:75183241-75183263 GAGCCTCATCGTTCCCACCGAGG - Intergenic
1152041469 17:77906496-77906518 GAGACCCTGTGTTCCCAGCTCGG - Intergenic
1152072900 17:78142885-78142907 GGGCCTCGGTGTGCTCACCCAGG + Exonic
1152999057 18:436487-436509 GAGTCTCGCTGTTGTCACCTGGG - Intronic
1159769708 18:72535371-72535393 GAGCTTCGGTTTTCTCATCTGGG - Intergenic
1160588600 18:79927255-79927277 GAGCCCCTGTGTGCCCGCCTGGG - Intronic
1161699607 19:5787549-5787571 GTGCCTCGGTTTCCCCATCTGGG - Intronic
1163676533 19:18658140-18658162 GGGCCGCGGTGTTCCCATCTTGG + Intronic
1166568454 19:43779254-43779276 GGGTCACTGTGTTCCCACCTCGG + Intronic
1166810245 19:45509781-45509803 GAGCCTCAGTTTCCCCAGCTGGG - Intronic
1167449661 19:49559786-49559808 GAGCCTCTGTATTCTCACATGGG - Intronic
925289749 2:2739483-2739505 GTGCCTGGGTGTTACCACCTAGG - Intergenic
925451110 2:3969752-3969774 AAGCAACAGTGTTCCCACCTGGG - Intergenic
926308124 2:11654641-11654663 AAGGCTCAGTGTTACCACCTGGG + Intergenic
927147938 2:20179212-20179234 GAGCCCAGGTGTTCTCATCTGGG + Intergenic
927275460 2:21258566-21258588 GAACCTCAGTGTTCTCATCTGGG + Intergenic
931882459 2:66581752-66581774 GAGCCTCTGCGCTCACACCTGGG - Intergenic
933024141 2:77233346-77233368 GAGCCTCTGTACTCCCAACTGGG + Intronic
933044064 2:77511987-77512009 TAGCCTCTGTGCTCCAACCTGGG - Intronic
934558722 2:95301166-95301188 GGGCCTCAGTCTTCCCATCTGGG + Intronic
937915303 2:127095982-127096004 AAGCCTCAGTGTACCCACCTGGG - Intronic
944705615 2:202285552-202285574 GAGCCTGGGAGTTCCAGCCTGGG - Intronic
946358585 2:219205304-219205326 GAGCCTAGGAGTTCCAGCCTGGG - Intronic
948634593 2:239327214-239327236 GAGCCTAGCCGTACCCACCTGGG + Intronic
1171234089 20:23510242-23510264 GAGCCTCAGGGCTCACACCTGGG + Intergenic
1172874647 20:38156789-38156811 GAGCCTCAGTTTTCTCACCTGGG - Intronic
1173443930 20:43100802-43100824 TAGCCTAGGTTCTCCCACCTGGG - Intronic
1173945144 20:46944378-46944400 CAGCCTCGGTCTCCTCACCTGGG + Intronic
1174823080 20:53744204-53744226 GCGCCACTGTATTCCCACCTGGG - Intergenic
1175874279 20:62222052-62222074 GAGCCTCAGTGTCCCCATCTTGG + Intergenic
1178303428 21:31471191-31471213 GGGCTTCGTTGTGCCCACCTGGG - Intronic
1179723791 21:43330673-43330695 GAGCCTCGGTTTTCCCATCTGGG + Intergenic
1180081782 21:45490534-45490556 GGGCCTCCGTGTGCCCTCCTGGG + Intronic
1180085247 21:45505321-45505343 GTGGCTTCGTGTTCCCACCTTGG + Intronic
1181179250 22:21055535-21055557 GAGGCCTGGTGTTCCCAGCTGGG + Intronic
1181751292 22:24990865-24990887 GAGCCTCGGTTTCCCCAGCTGGG - Intronic
1181759776 22:25050252-25050274 GAGCTTCAGTGTGCCCACATGGG + Intronic
1182093120 22:27609442-27609464 GAGCCTCAGTTTCCACACCTGGG - Intergenic
1182111454 22:27726694-27726716 GAGCCTCGGTGTCCCTAGCAGGG + Intergenic
1182226529 22:28802706-28802728 GAGCCTAGGAGTTCCAGCCTAGG - Intergenic
1182355143 22:29719591-29719613 CAGCCTCAGTTTCCCCACCTTGG + Intergenic
1185162504 22:49238349-49238371 GAGCCTCAGTTTCCTCACCTGGG - Intergenic
950675040 3:14549608-14549630 GAGCCTCAGTTTCCCCACTTGGG - Intergenic
951731698 3:25816469-25816491 CAGCCTGGAAGTTCCCACCTTGG + Intergenic
953198225 3:40753939-40753961 GGGCCTCGGTGCTCACACTTGGG - Intergenic
957423413 3:80002743-80002765 GAGCCTCGCTCTTGTCACCTAGG - Intergenic
960967702 3:123116587-123116609 GACCCACGATGTTCCGACCTTGG - Intronic
961822068 3:129580317-129580339 GGGCCTCCGTGTTCCTACCAAGG + Intronic
964902419 3:161675574-161675596 GCGCCTGGGTGCTCCCTCCTTGG - Intergenic
968079181 3:195834844-195834866 GAGCCTCAGTGTATCCATCTGGG - Intergenic
968118137 3:196105277-196105299 GTGCCACTGTGTTCCAACCTGGG + Intergenic
969451079 4:7273788-7273810 GAACCTCAGTGTGCCCAGCTGGG + Intronic
969656225 4:8500150-8500172 GAGCCTAGGAGTTCCAGCCTGGG + Intergenic
972298217 4:37760691-37760713 GAACCTCAGTGTTCTCAACTGGG - Intergenic
972496256 4:39637964-39637986 CAGCCTCGGTTTTGCCAACTGGG + Intronic
972585850 4:40436575-40436597 GGGCCTAGGGGTTCCTACCTCGG - Exonic
975720976 4:77248345-77248367 GTGACTCAGTGTTCCCACCTGGG - Intronic
977583265 4:98747563-98747585 GAGCCTCCGTGTTTCCACTCAGG - Intergenic
978071679 4:104480479-104480501 GAGCATTGGTTTTCCCATCTTGG + Intronic
982941850 4:161569205-161569227 TAGCCTCAATGTTCCCTCCTTGG + Intronic
988066162 5:26230316-26230338 CAGCCTCGGTGTCCCCACGCTGG + Intergenic
992071456 5:73152797-73152819 GAGTCTCAGTGTTACCTCCTGGG - Intergenic
992558860 5:77930314-77930336 GAGCCCTGGTGTTCACACTTGGG + Intergenic
995070864 5:107920228-107920250 GAGTCTCGCTGTTGTCACCTGGG + Intronic
997950795 5:138241322-138241344 GAACCTTGGTTTTCCCATCTAGG - Intergenic
999000969 5:147922487-147922509 GTACCAGGGTGTTCCCACCTTGG + Intergenic
1000138925 5:158382291-158382313 GAGGCCCTGTGTTCCAACCTGGG - Intergenic
1001541554 5:172543140-172543162 ATGCCTGGGTGCTCCCACCTTGG + Intergenic
1004291862 6:14374720-14374742 GAGCTCCGGTGATCCCACCAGGG - Intergenic
1006350872 6:33520237-33520259 GTGCCACGGTATTCCAACCTGGG - Intergenic
1006419218 6:33923074-33923096 GAGCCTATGTGAGCCCACCTGGG + Intergenic
1013714673 6:112944697-112944719 GAGTCTCACTGTTGCCACCTGGG - Intergenic
1015534663 6:134255605-134255627 GAGCCTCGCTCTTGTCACCTAGG + Intronic
1018003603 6:159600890-159600912 AAGCCTGGGTGTTCCCTCTTTGG + Intergenic
1018059444 6:160079065-160079087 GAGCCAGGGTGTTGACACCTGGG - Intronic
1021293184 7:18870874-18870896 GAGCCTAGGGGTTCCACCCTGGG - Intronic
1021651746 7:22839630-22839652 GTGCCACTGTATTCCCACCTGGG - Intergenic
1025096512 7:56099831-56099853 GGGCTTCTGTGATCCCACCTCGG + Intergenic
1026355033 7:69550154-69550176 GAGCCTCAGTTTCCCCATCTAGG - Intergenic
1026806427 7:73432136-73432158 GAGACTCAGTTTCCCCACCTGGG + Intergenic
1027427970 7:78081243-78081265 GAGTCTCTGTCTTCCCTCCTAGG + Intronic
1029159847 7:98543820-98543842 GAGCCTCAGGGTCCCCAGCTGGG - Intergenic
1029204855 7:98863492-98863514 GAGCCTCAGTTTCTCCACCTGGG - Intronic
1029697329 7:102222441-102222463 GAGCCTCTGTTTTCTCACCTGGG + Intronic
1029724914 7:102396431-102396453 GGGCCTCGGTGGTCGCACCGAGG - Exonic
1035041309 7:155929701-155929723 CAGCCTCGGGGCTCCAACCTGGG + Intergenic
1035365337 7:158345623-158345645 CAGCCTCAGTTTCCCCACCTGGG - Intronic
1036756836 8:11476738-11476760 GAGCCCAGGTGTTTGCACCTGGG + Intergenic
1036797823 8:11769033-11769055 CAGCCTGGGTGTTCCCACAATGG - Intergenic
1037941851 8:22957527-22957549 AAGCCACGCTGTTCCCACCTGGG + Intronic
1039557563 8:38487594-38487616 GGGCCTCAGTTTTCTCACCTAGG - Intergenic
1042479898 8:69291260-69291282 GAGCCTGGGAGTTCCAGCCTGGG + Intergenic
1044691929 8:94889120-94889142 GAGCCTCGCTGTTGTCACCCAGG - Intronic
1045556558 8:103219998-103220020 GAGCCTCTGTTTTCCCAGGTAGG - Intronic
1048254719 8:132896981-132897003 GAGCCTCTGTGTCCTCACCTGGG + Intronic
1048462156 8:134629896-134629918 GAGCCTGGGTGGTTTCACCTTGG - Intronic
1048956021 8:139536726-139536748 GAGCCTATGAGTTCCCAACTTGG + Intergenic
1050460283 9:5871676-5871698 GAGTCTCGCTGTTGTCACCTAGG - Intergenic
1057983904 9:99690002-99690024 GTGCCTCAGTTTTCCCATCTGGG - Intergenic
1059436486 9:114279808-114279830 GAGCCACTGTGTTCCAGCCTGGG + Intronic
1061238939 9:129358084-129358106 GAAGCTTGGTGCTCCCACCTGGG - Intergenic
1061659650 9:132120461-132120483 GAGCCTCAGTGTTCTCAGCTGGG - Intergenic
1062393600 9:136343670-136343692 GTGCCTCAGTGTCCCCATCTGGG + Intronic
1062698107 9:137885644-137885666 GAGCCTCCGTGTTCTCACCTGGG + Intronic
1185485773 X:481143-481165 GAGCCTAGGGGTTCCCAACCAGG - Intergenic
1189380383 X:40498637-40498659 GAGCCCCGGAGGTCCCAACTGGG - Intergenic
1192085984 X:68097846-68097868 GAACTTCAGTTTTCCCACCTGGG + Intronic
1194629452 X:96265631-96265653 GAGTCTCGCTGTTGTCACCTGGG + Intergenic
1195131830 X:101861014-101861036 GGGCCTGGGTGCTCCTACCTTGG - Intergenic
1195777347 X:108422160-108422182 GAGCCCAGGAGTTCCCAGCTTGG + Intronic
1200217631 X:154374981-154375003 GGGCCTCGGCCTTTCCACCTGGG - Intergenic