ID: 1085619956

View in Genome Browser
Species Human (GRCh38)
Location 11:78030605-78030627
Sequence GTGAGTGAGGGGAGGGCAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1490
Summary {0: 1, 1: 0, 2: 7, 3: 183, 4: 1299}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085619956_1085619966 6 Left 1085619956 11:78030605-78030627 CCTTCTGCCCTCCCCTCACTCAC 0: 1
1: 0
2: 7
3: 183
4: 1299
Right 1085619966 11:78030634-78030656 CTGTTCTTCAGGAGACAATGCGG 0: 1
1: 0
2: 2
3: 22
4: 223
1085619956_1085619962 -5 Left 1085619956 11:78030605-78030627 CCTTCTGCCCTCCCCTCACTCAC 0: 1
1: 0
2: 7
3: 183
4: 1299
Right 1085619962 11:78030623-78030645 CTCACTCCCCTCTGTTCTTCAGG 0: 1
1: 0
2: 0
3: 29
4: 299
1085619956_1085619967 27 Left 1085619956 11:78030605-78030627 CCTTCTGCCCTCCCCTCACTCAC 0: 1
1: 0
2: 7
3: 183
4: 1299
Right 1085619967 11:78030655-78030677 GGCCAGCCCCTCTCCCCTCCAGG 0: 1
1: 2
2: 9
3: 120
4: 730
1085619956_1085619969 30 Left 1085619956 11:78030605-78030627 CCTTCTGCCCTCCCCTCACTCAC 0: 1
1: 0
2: 7
3: 183
4: 1299
Right 1085619969 11:78030658-78030680 CAGCCCCTCTCCCCTCCAGGCGG 0: 1
1: 1
2: 15
3: 74
4: 518

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085619956 Original CRISPR GTGAGTGAGGGGAGGGCAGA AGG (reversed) Intronic
900158909 1:1214187-1214209 GTGGAGGAGGGGAGGGGAGAGGG + Intergenic
900345656 1:2209128-2209150 GCGAGGGAGGGGGTGGCAGATGG - Intronic
900433010 1:2611770-2611792 GTGAGAGTGGGCTGGGCAGAAGG - Intronic
900476984 1:2880524-2880546 GTGAGGCAGGGAAGGGCAGCTGG + Intergenic
900509540 1:3051982-3052004 GTGGGTGAGTGGATGGAAGATGG - Intergenic
900527044 1:3134470-3134492 GTGCGGGAGGGGAGGGCAGGAGG - Intronic
900836075 1:5005158-5005180 GTGAGTGAGGAGTGGGAAGAAGG - Intergenic
901005856 1:6171206-6171228 GTGGGTAAGGGGAGGACAAAGGG + Intronic
901125895 1:6928520-6928542 GTTAGGGTGGGGAGGGCAGATGG - Intronic
901519090 1:9768991-9769013 GTGAGGGAGGGGGGAACAGAAGG + Intronic
901664616 1:10819333-10819355 GGGAGAGAGGGATGGGCAGATGG + Intergenic
901751783 1:11414404-11414426 ATGAGGGATTGGAGGGCAGAGGG + Intergenic
901758088 1:11453554-11453576 GTGGGTGATGGGAGGGGAGAGGG + Intergenic
902659322 1:17890434-17890456 GGGAGAGAGGGGAGGGCACAGGG - Intergenic
902724074 1:18323632-18323654 GCGGGTGAGGGGAGGGCTTAGGG + Intronic
902833212 1:19030702-19030724 GGGAGGGAGGGGAGGGGAGGGGG + Intergenic
902882844 1:19384242-19384264 GGCAGTGAGGGGAGGGCAGTGGG - Intronic
903134292 1:21299221-21299243 GTGGGTGAGGGCTGGGCAGAGGG + Intronic
903328813 1:22586528-22586550 GTGGCTGTGGGGAGGGCAGCGGG - Exonic
903353308 1:22731074-22731096 GTGAGTGGGGGCAGGCCAGAGGG - Intronic
903374978 1:22860199-22860221 GTGGGTGGGAGGAGGCCAGATGG + Intronic
903744423 1:25577085-25577107 GTGAATGCGGGGATGGCACAGGG - Intergenic
903809116 1:26024747-26024769 GTGAGGGAGGGCATGGCAAAGGG - Intronic
903867625 1:26410678-26410700 GAGAGGGAGGGGAGGGGAGGGGG + Intergenic
904067136 1:27762072-27762094 GTGGGTGAGGAGTGGGGAGAAGG - Intronic
904213066 1:28898398-28898420 GTGAGTGACTGGAGGCCACATGG - Intronic
904376592 1:30085848-30085870 GAGAGAGAGAGGAGGCCAGAGGG - Intergenic
904382449 1:30120517-30120539 GGGAGTGAGGGGAGACAAGAGGG - Intergenic
904441656 1:30535722-30535744 GTGAGGGTGGGGAAGGGAGAGGG + Intergenic
904450065 1:30605331-30605353 TGGGGTGAGCGGAGGGCAGAGGG + Intergenic
904532681 1:31179932-31179954 GTGAGAGAGGTGAGGGCTGGAGG + Exonic
905037121 1:34925511-34925533 CTGAGTGAGGGGAGGGGAGAGGG + Intronic
905267221 1:36762882-36762904 GTGAGTGAGGGGAGGAGCGGAGG + Intergenic
905387845 1:37616461-37616483 GTGAGTGTGGGCAGGGCTGTCGG - Intronic
905527263 1:38648504-38648526 GTGAGTGTCTGGAGTGCAGATGG - Intergenic
905665666 1:39761607-39761629 GTGAGTGGGAGGAGGGCGGAGGG - Intronic
905673293 1:39807613-39807635 GGGAGAGGGGAGAGGGCAGAGGG - Intergenic
905881257 1:41465690-41465712 GTGACTGAAAGGAGGGCAGGAGG - Intergenic
905888899 1:41507678-41507700 GTGACTGGGAGCAGGGCAGAAGG + Exonic
906000615 1:42421361-42421383 GAGGGTGAGGGGAGTGCAGAAGG + Exonic
906106732 1:43299162-43299184 TTGAGAGTGGGGAGGGCAGATGG + Intergenic
906319881 1:44809227-44809249 CTGAGTGAGTGGAGGGAGGAGGG - Intronic
906509079 1:46400881-46400903 GTGAGGAAGGGAAGGGGAGAAGG + Intronic
906650500 1:47509219-47509241 GGGAGGGCGGGGAGGGCAGAAGG - Intergenic
906986263 1:50686605-50686627 GGGAGGGAGGGGAGGGGAGCGGG + Intronic
907157364 1:52346591-52346613 GGGTGGGATGGGAGGGCAGAGGG + Exonic
907247469 1:53117172-53117194 GTGAGACAGTGGAAGGCAGAAGG + Intronic
907255131 1:53173408-53173430 GAGAGGGAGGGGAGGGGAGAGGG - Intergenic
907303712 1:53502752-53502774 GGGAGAGAGGAGAGGGGAGAGGG + Intergenic
907326021 1:53638957-53638979 GGCAGGGAGTGGAGGGCAGAAGG + Intronic
907380421 1:54082706-54082728 GAAAGTGAGGGGAGGGAGGAAGG + Intronic
907462745 1:54614970-54614992 TGGAGTCAGGGGAGGGCGGAAGG + Intronic
908014301 1:59815181-59815203 GTGAGTGCGAGGAGGCGAGAGGG + Intronic
908146238 1:61247614-61247636 ATGTGTGAGGGGAGGTGAGAGGG + Intronic
908519472 1:64927206-64927228 GGGAGTGGGGGGAGGGGACACGG - Intronic
908699065 1:66878746-66878768 GTAAGTAATTGGAGGGCAGATGG - Intronic
908703303 1:66924904-66924926 GAGGCGGAGGGGAGGGCAGAGGG + Intronic
909099936 1:71337525-71337547 AAGAGAGAGGGGAGGGGAGAGGG - Intergenic
909115021 1:71522714-71522736 GTGTGTAAGGGGGGGGTAGAGGG - Intronic
910240351 1:85079681-85079703 TTGAGAGAGGGGAGGGCAGCAGG + Intronic
910451552 1:87351754-87351776 GTGTGGGTGGGTAGGGCAGAGGG - Intergenic
910502411 1:87908034-87908056 GTGGGGGTGGGGTGGGCAGAAGG + Intergenic
910886875 1:91973157-91973179 TAGAGTGAGGTAAGGGCAGAGGG + Intronic
911319931 1:96401448-96401470 GTGACTGAGGGCAGGACAAAGGG + Intergenic
911667853 1:100574381-100574403 GAGAGTGAAGGGTGGGAAGAGGG + Intergenic
911724944 1:101233384-101233406 CTGGGTCAGGGGAGGGAAGAGGG + Intergenic
912163997 1:107020643-107020665 GAGAGAGAAGGGAGGGGAGAAGG + Intergenic
912573401 1:110641796-110641818 GTGTGTGTAGGGAGGGAAGATGG + Intergenic
912727015 1:112067609-112067631 GAGAGTGGGAGGAGGGCAGAGGG - Intergenic
912742892 1:112217644-112217666 TGGGGTGAGGGGAGGGGAGAGGG + Intergenic
912746189 1:112247483-112247505 GTGTGAAAGGGGAGGTCAGAAGG + Intergenic
912880810 1:113412014-113412036 GGGGGTGGGGGGAGGGGAGAGGG - Intronic
913324517 1:117615120-117615142 CTGAGTGAGGTAAGGCCAGATGG - Intronic
913433537 1:118822891-118822913 GTGGGTGGGGGGAGGGGGGAGGG - Intergenic
914776211 1:150737966-150737988 GTGAGAGAGGGGAGAGTAGTTGG + Intronic
915034341 1:152909826-152909848 CTGACTGAGGGCAGGGGAGAGGG - Exonic
915106374 1:153537198-153537220 GGGAGGGAGAGGAGGGCAGGGGG + Exonic
915446847 1:155978848-155978870 GGGAAGAAGGGGAGGGCAGAGGG - Intronic
915479143 1:156173297-156173319 GTGAGTGGGTGGAGGGGAGCTGG + Intronic
915626237 1:157115622-157115644 GTGAGTGAGGGGAGTTGAGGCGG - Intergenic
915719835 1:157976789-157976811 GGGCCTGAGGGGAAGGCAGAAGG - Intergenic
915780564 1:158545327-158545349 GTGGGTGGGGGGAGGGGGGAGGG + Intergenic
915782474 1:158567979-158568001 ATGACTGAGGGGTGGGCAGGAGG - Intergenic
915834237 1:159162092-159162114 GTGAGTGAGGCTATGGCTGATGG - Intergenic
915851745 1:159331748-159331770 TGGAGTGAGGGGAGGGGGGAGGG - Intergenic
915907230 1:159887774-159887796 GGGAATAAGGGGAGGGCGGAGGG + Intronic
916301867 1:163284775-163284797 GGGAGGGAGGGGAGGAGAGAGGG - Intronic
916564751 1:165964795-165964817 TTGGGTGAGGGGAGGGGGGAGGG - Intergenic
917058689 1:171013000-171013022 ATGAGAGAGAGGAGGGGAGAGGG - Intronic
917105003 1:171483319-171483341 GGGAGGGAGGGGAGGGGAGAAGG + Intergenic
917374364 1:174333163-174333185 GAGAATGAGGAGAGGGTAGATGG + Intronic
917411262 1:174762113-174762135 GAGAGTGAGGGAAGGGCGGTAGG + Intronic
917421249 1:174866079-174866101 GTGAAGGAGAGGAGGGGAGAGGG + Intronic
917591467 1:176480761-176480783 CTGAGGGAGGGGTGGGGAGAGGG - Intronic
917871723 1:179248142-179248164 GAGAGAGAGGGGAGGAAAGAAGG + Intergenic
918104594 1:181405647-181405669 AGGAGTGAGGGGAGGAGAGAGGG - Intergenic
918217028 1:182400700-182400722 GTGAGAGAGCAGTGGGCAGAAGG - Intergenic
918224622 1:182470368-182470390 ATGAGTGAGGGGAGGGAAGTAGG - Intronic
918316047 1:183323527-183323549 GGTAATGAGGGTAGGGCAGAAGG - Intronic
918316668 1:183328254-183328276 GTGAGAGGGGGTAGAGCAGATGG - Intronic
918404702 1:184200277-184200299 GCGAGTGAGAAGAGGGCTGAAGG - Intergenic
919289726 1:195614169-195614191 TTGGGTGAGGGGAGGGGGGAAGG - Intergenic
919583057 1:199400969-199400991 GGGAGGGAGGGGAGGGGGGAGGG + Intergenic
919735763 1:200949464-200949486 GTGAGGGAGAGGAGCGCAGATGG + Intergenic
919824117 1:201491893-201491915 GTGAGAGAGGAGCTGGCAGAGGG - Intronic
920131679 1:203736894-203736916 GTGAGGGAGGAGAGGGCATGGGG - Intronic
920222903 1:204417042-204417064 GAGTGTGGGGGGAGGGGAGAGGG + Intergenic
920254825 1:204647537-204647559 GGGAGTGAGGGGAGAGGAGGTGG + Intronic
920358952 1:205398778-205398800 GACAGTGAGGGGAAGGAAGAGGG + Intronic
920388753 1:205585933-205585955 GCAGGTGTGGGGAGGGCAGAGGG - Intronic
920428299 1:205896678-205896700 GGGAGGGAGGGGAGGGAAGGAGG - Intergenic
920687544 1:208120810-208120832 GTCTGTGAGGGGAGGTCAGAGGG + Intronic
920729530 1:208469998-208470020 GTGTATGAGAGCAGGGCAGATGG - Intergenic
920849998 1:209622353-209622375 GAGTGGGTGGGGAGGGCAGACGG + Intronic
920855204 1:209656231-209656253 GTGAGGGTGGGGAGAGGAGAAGG - Intergenic
921364984 1:214365129-214365151 ATCAGTGAGGGGAAGGAAGAAGG - Intronic
921624199 1:217359956-217359978 TTGGGTGAGGGGAGGGGGGAGGG + Intergenic
921813864 1:219544958-219544980 GGGAGAGGGGGGAGGGGAGAGGG - Intergenic
921813875 1:219544979-219545001 GGGAGAGAGGAGAGGGGAGAGGG - Intergenic
922581164 1:226699047-226699069 GGGGGTGAGGGGAGGCCAGAGGG - Intronic
922663292 1:227448335-227448357 GTGAGAGAGGGTCGGGGAGAAGG - Intergenic
922749831 1:228065115-228065137 GTGGGAGAGGAGAGGGCAGAGGG + Intergenic
922787271 1:228289232-228289254 GGGAGTGGGGGGATGGCAGGTGG + Intronic
922807596 1:228398713-228398735 GTGAGGGAGGGGTGTGCACAGGG + Intronic
922933338 1:229407026-229407048 GGGCGGGAGGGGAGGGGAGAGGG - Intergenic
923256241 1:232223933-232223955 GGGAGCGAGGAGAGGGCAGTGGG - Intergenic
923514117 1:234680305-234680327 GTGTGTGTGGGGGGGGCATATGG + Intergenic
923669689 1:236029797-236029819 GTGAGCCTGGGGCGGGCAGAAGG - Intronic
924309095 1:242721338-242721360 CTGAGAAAGCGGAGGGCAGATGG + Intergenic
924577583 1:245294274-245294296 GAGAGGGAGGGGAGGGGAGAGGG - Intronic
924717456 1:246590477-246590499 GTGGGAGAGAGGAGGGCAGCAGG + Intronic
924806110 1:247363186-247363208 GTGAGAGAGGGGAGAGGAGAAGG - Intergenic
924806117 1:247363214-247363236 GTGAGAGAGGGGAGAGGAGAAGG - Intergenic
924806140 1:247363300-247363322 GTGAGAGAGGGGAGAGGAGAAGG - Intergenic
1062968862 10:1630546-1630568 GTGACTCTGGGCAGGGCAGAGGG + Intronic
1063382949 10:5597578-5597600 GTGGCTGAGGAGAGGGCAGCAGG + Intergenic
1063491820 10:6471022-6471044 GTCAGAGAGGGGTGGGAAGAGGG + Intronic
1063624018 10:7672256-7672278 GGGAGGGAGGGGAGGGGGGAAGG + Intergenic
1063812480 10:9728488-9728510 GTGTGTCGGGGGAGGGCAGGGGG - Intergenic
1063993361 10:11591629-11591651 GTGAGAGAGGGAAAGGGAGAGGG + Intronic
1064217417 10:13411973-13411995 GGGACTGAGGGGAGGGGAAATGG - Intergenic
1064405554 10:15059135-15059157 GAGAGGGAGGGAAGGGGAGAGGG - Intronic
1064721195 10:18230975-18230997 GTCAGTTAGGGGAGGAGAGAAGG + Intronic
1064806572 10:19141370-19141392 GGGTTTGAGGGGAGGGGAGATGG + Intronic
1065178828 10:23104840-23104862 GAGAGTGTGGGGAGGGATGACGG - Intronic
1065358826 10:24869862-24869884 GTAAGAGAGGACAGGGCAGAGGG - Intronic
1065446032 10:25800529-25800551 GTGGGTGGGGGGAGGGGGGAGGG + Intergenic
1065794815 10:29296495-29296517 GTGAGTGAGGGGCAGTCAGTAGG - Intronic
1066051990 10:31644475-31644497 GTGAGACAGGGAAGGGCAGCAGG + Intergenic
1066159074 10:32709320-32709342 GTGGGTGGGGGGAGGGGGGAGGG + Intronic
1066578809 10:36857182-36857204 GTGGGTGGGGGGAGGGGGGAGGG + Intergenic
1067258578 10:44666555-44666577 GTGAGTGGGGGGTGGGGAGGGGG + Intergenic
1067286037 10:44908325-44908347 GTGAGACGGGGGAGGACAGAGGG - Intergenic
1067440962 10:46309022-46309044 GAGAGTGAGGAGTGGGCAGATGG + Intronic
1067523827 10:47026737-47026759 GTGGGGAGGGGGAGGGCAGAGGG + Intergenic
1067577089 10:47415729-47415751 GAGAATGAGGAGTGGGCAGATGG + Intergenic
1067848803 10:49742471-49742493 GTGAGTGGGGGGAGTGTATAGGG - Intronic
1068610901 10:59058872-59058894 ATGAGACAGGGGAGTGCAGAAGG - Intergenic
1068841690 10:61621773-61621795 GAGGGTAAGGGCAGGGCAGAGGG + Intergenic
1068866777 10:61903178-61903200 GCGGGGGAGGGGAGGGCAGAGGG + Intronic
1068873934 10:61977000-61977022 TGGGGTGAGGGGAGGGGAGAGGG - Intronic
1069183466 10:65392429-65392451 TGGGGTGGGGGGAGGGCAGAGGG + Intergenic
1069224748 10:65929017-65929039 GTGGGTGAGGGGAGGGGGGAGGG - Intronic
1069784099 10:70977065-70977087 GGGAGAGAGGGGAGGGAAGGGGG + Intergenic
1069800923 10:71080956-71080978 GTGAGGGAGGGGAGCCCAGGAGG - Intergenic
1069876687 10:71567483-71567505 ATGAGTGAGTCAAGGGCAGAAGG + Intronic
1069885701 10:71622305-71622327 GTGAGGCAGGGGAGGGCTGCAGG - Intronic
1070145901 10:73773042-73773064 GTGAGTGAGGGCGGGCCGGAGGG + Intronic
1070607005 10:77905800-77905822 GTGGGTGAGGGGAGGGAAATGGG - Intronic
1070729634 10:78817459-78817481 GGGAGAGAGGGAAGGGGAGAGGG + Intergenic
1070839673 10:79475406-79475428 GGCTGTGAGGGGTGGGCAGAGGG + Intergenic
1071204195 10:83255014-83255036 GTGGGGGAGGGGAGGGGGGAGGG - Intergenic
1071568037 10:86681559-86681581 GCGAGTGAGGAGAAGGCGGAGGG - Exonic
1072281972 10:93873881-93873903 CTCAGTCAGGGGAGGTCAGAGGG + Intergenic
1072545167 10:96431790-96431812 GCTGGTGGGGGGAGGGCAGAAGG + Intronic
1072639995 10:97204806-97204828 GTGGCTGTGGGGAGGCCAGAGGG - Intronic
1072661090 10:97363963-97363985 GTGAGCCAGGAGGGGGCAGAAGG - Intronic
1072731712 10:97850653-97850675 GTGTGTGAGGGGAGGGAAGGCGG + Intronic
1072802781 10:98404992-98405014 GTGAGGGAGGGGAGGGAGGATGG + Intronic
1072914172 10:99527012-99527034 GGAAGTGGGGGAAGGGCAGAAGG + Intergenic
1073037509 10:100574645-100574667 GAGAGGGAGGGTAGGGGAGAGGG - Intergenic
1073104955 10:101027257-101027279 GTGAGGGAGGGGAGGGTGGAGGG - Intronic
1073122461 10:101131180-101131202 GCGAGGGAGGGGAGGGGAGGGGG - Exonic
1073442100 10:103558249-103558271 GTGAGTGAGGGGAGGGTGACAGG + Intronic
1073489224 10:103841645-103841667 GTGAGAGAGGGGAGAGCAGCAGG - Intronic
1073777082 10:106798429-106798451 GTGGGTGGGGGGAGGGAGGAAGG - Intronic
1073993809 10:109293549-109293571 GTGAGTGAGAGAAGAGAAGAGGG - Intergenic
1074388280 10:113034951-113034973 GGGAAGGAGGGGAGGGGAGAGGG - Intronic
1074416357 10:113270334-113270356 GTGGCTGAGGGGAAGGGAGAAGG + Intergenic
1074465404 10:113677398-113677420 GCGGGTGGGGGGAGGGGAGAGGG + Intergenic
1074528234 10:114279315-114279337 GGGAGGGATGGGTGGGCAGACGG - Intronic
1074627721 10:115211753-115211775 GTGGGTGAGGGGAGGGGGGAGGG - Intronic
1074658487 10:115622003-115622025 GTGTGGAAGGGGAGAGCAGAGGG + Intronic
1074676799 10:115860346-115860368 GTGAGCAAAGGGAAGGCAGATGG - Intronic
1074815612 10:117139524-117139546 GTGAATGAGGGCAGGGAACACGG - Intergenic
1074831103 10:117250061-117250083 GTCATTGAGTGGTGGGCAGAAGG - Intronic
1075070778 10:119318714-119318736 GTGCTTGTGGGGAGGGCAGTGGG - Intronic
1075075713 10:119349026-119349048 GTGGGTGGGAGGAGGGCGGAGGG - Intronic
1075123532 10:119681663-119681685 GTGAGTGAGGGGCTGGCAGAAGG - Intergenic
1075489977 10:122858403-122858425 TTGGGTGAGGGGAGGGGGGAGGG + Intronic
1075947805 10:126453420-126453442 GGGAGTGAGAGGAGAGGAGAGGG + Intronic
1076039780 10:127236329-127236351 GGGAAGGAGGGGAGGGGAGAGGG - Intronic
1076165722 10:128281044-128281066 GGCAGAGAGAGGAGGGCAGATGG + Intergenic
1076192089 10:128490127-128490149 ATGAGAGAGGGAAGGGGAGAAGG - Intergenic
1076257976 10:129043805-129043827 GTTAGAGGGGGAAGGGCAGATGG - Intergenic
1076392053 10:130110660-130110682 GTTAGGGACGGGAGGGCGGATGG - Intergenic
1076713930 10:132353853-132353875 CACAGTGAGGGGAGGGCAGCTGG - Intronic
1076731535 10:132441408-132441430 GTGAGTGCGGGGAGGTCGGGTGG - Intergenic
1076737618 10:132465803-132465825 CTGAGCGAGGGGGCGGCAGAAGG + Intergenic
1076754968 10:132564672-132564694 GGCAGTGAGTGCAGGGCAGACGG + Intronic
1077109453 11:855635-855657 GTGAGGGAACGGAGGACAGATGG + Intronic
1077319104 11:1933073-1933095 GTGAGTGAGTGGATGATAGATGG - Intronic
1077373467 11:2194468-2194490 GGGAGGGAGGGGACAGCAGATGG + Intergenic
1077533146 11:3106663-3106685 GTGAGTGACGGGAGGGAGGATGG - Intronic
1077533400 11:3107748-3107770 GTGAGTGGGGCGAGGGCACAGGG - Intronic
1077544189 11:3161970-3161992 GAGAGGGAGGGGAGGGGAGGGGG + Intronic
1077548910 11:3190744-3190766 GGAAGGGAGGGGAGGGCAGAAGG + Intergenic
1077634291 11:3831486-3831508 GTGGGTCAGGGAAGGGCATAAGG + Intronic
1077644605 11:3912218-3912240 ATAAGGGAGGGGAGGGGAGAAGG - Intronic
1077807973 11:5608582-5608604 GTGGGTGATGGGAGGTCAGTAGG + Intronic
1078250133 11:9609956-9609978 GTGGGGGAGGGGATGGCAGATGG + Intergenic
1078541715 11:12218351-12218373 ATGAGTGGGGGGATGGAAGAAGG - Intronic
1079055250 11:17200585-17200607 GGGAGTGAGGGGTGGGCTGAAGG + Intronic
1079094370 11:17501348-17501370 GTGGGAGAGGGGAGGACAGTGGG + Intronic
1079098446 11:17526270-17526292 GTGAGGAAGGGGAGGGCAATAGG + Intronic
1079304292 11:19308779-19308801 AAGAGTGAGGAGTGGGCAGAGGG - Intergenic
1079512584 11:21228717-21228739 GGGAGGGAGGGGAGGGAAGGAGG - Intronic
1079812539 11:25013218-25013240 GTGAGTTGGGGGAGGGGAGGAGG + Intronic
1079954952 11:26850911-26850933 GTGCGGGAGGGAAGGACAGAAGG - Intergenic
1080305241 11:30828118-30828140 GTGAGTGAGGAGAAGACAGCAGG - Intergenic
1080740457 11:35059111-35059133 GAGAGAGAGGGGAGGCCACAGGG + Intergenic
1080749346 11:35138632-35138654 GGGAGTGAGGGGTGGGGAGTTGG - Intergenic
1080779111 11:35414524-35414546 CGGGGTGAGGGGCGGGCAGAGGG + Intronic
1081326902 11:41756201-41756223 GTGGGTGGGGGGAGGGGGGAGGG - Intergenic
1081497698 11:43632001-43632023 GTGAGTGAGGGAGGGGGAGGAGG + Intronic
1081591125 11:44423914-44423936 GTGAGTGAGGCGGGGGGAGGGGG - Intergenic
1081654977 11:44851139-44851161 GTGAGTGCGTGGAGAGAAGAGGG + Intronic
1081691770 11:45083221-45083243 GTCGGAGAGGGGATGGCAGAAGG - Intergenic
1081731836 11:45377205-45377227 GAGAGGGAGGGGAGGTGAGAGGG - Intergenic
1081742397 11:45449774-45449796 GTGAGTGAGAAGAGGCCAGTTGG - Intergenic
1081793640 11:45805329-45805351 GGGAGGGAGGGGCGGGCAGGGGG - Exonic
1081813237 11:45924764-45924786 GTCTGGGAGGGGAGGGCATAAGG - Exonic
1082743532 11:56937800-56937822 GTGGGTGGGGGGAGGGGGGAGGG - Intergenic
1082835875 11:57649802-57649824 GTGGGTGGGGGGAGGGTAGTTGG + Intronic
1083117441 11:60475782-60475804 TGGGGTGGGGGGAGGGCAGAGGG + Intergenic
1083311609 11:61786614-61786636 ATGAGTCAATGGAGGGCAGACGG + Exonic
1083553262 11:63606761-63606783 AGGCGTGCGGGGAGGGCAGAGGG + Intronic
1083654712 11:64224029-64224051 AGGAGAGAGGTGAGGGCAGAAGG + Intronic
1083741714 11:64714734-64714756 TTGGGTGGGGGGTGGGCAGAGGG - Intronic
1083746667 11:64740925-64740947 GTGCGTGGGGGGAGCACAGAGGG - Intronic
1083750704 11:64759204-64759226 GTGGGGGAGGGGCGGGCAGACGG - Intronic
1083835558 11:65264552-65264574 GAGAGTGAGGGTGGGACAGAAGG - Intronic
1083837647 11:65282366-65282388 GTGTGTGATGGGAGGACAGTGGG - Intronic
1083857435 11:65400095-65400117 CTGAGTGGAGGGAGGGCAGCAGG + Intronic
1083880927 11:65547901-65547923 GTGGGTGAGCGCAGGGCAGGCGG - Exonic
1084085565 11:66853530-66853552 TGGAGTGAGGAGAGGGCTGAGGG - Intronic
1084123502 11:67083369-67083391 GTGAGGGAGGGAGGGGGAGAAGG - Intergenic
1084220420 11:67674399-67674421 AGGGGTGAGGGGCGGGCAGAGGG - Intronic
1084343918 11:68530250-68530272 GTGAGAGAAGGGAGTGCTGAAGG + Intronic
1084364768 11:68690418-68690440 AGGAGTGAGGGGAGGGGAGCGGG + Intronic
1084421611 11:69063315-69063337 GAGTGGGAGGGGACGGCAGAGGG - Intronic
1084668006 11:70586912-70586934 GTGAGGTGGGGGAGGGAAGAGGG - Intronic
1084785708 11:71440573-71440595 ATGGGTGATGGGAGGGTAGATGG + Intronic
1084870018 11:72092119-72092141 GAGAGTGAGGGTAGGGAGGAAGG - Intronic
1085307936 11:75498774-75498796 GTGAGAAAGGGGTGTGCAGAAGG - Intronic
1085619956 11:78030605-78030627 GTGAGTGAGGGGAGGGCAGAAGG - Intronic
1086306425 11:85485564-85485586 GTGAGTAAGGAGAGGGAAGGGGG + Intronic
1086344512 11:85882567-85882589 CTGAGTGAAGAGAAGGCAGAGGG + Exonic
1086477846 11:87198566-87198588 GAGAGAGAGGGGAGCGGAGAGGG - Intronic
1086485243 11:87293494-87293516 GGGAGTGAGGGGAGGGAAGTTGG - Intronic
1086585407 11:88445674-88445696 GAGAGTGAAGGGTGGGAAGAGGG - Intergenic
1086734078 11:90283872-90283894 GTGGGTGAGGGGATGGAGGAAGG + Intergenic
1086954545 11:92922381-92922403 GTGTGTCTGGGGAGGGAAGAGGG - Intergenic
1087100255 11:94356960-94356982 TTGATTGAGGGGAGGCTAGATGG + Intergenic
1087452426 11:98342265-98342287 GTGGGTGGGGGGAGGGGGGAGGG - Intergenic
1087527154 11:99330164-99330186 GGGAGGGAGGGGAGGGAGGAGGG + Intronic
1087719406 11:101644886-101644908 GTGGGTGGGGGGATGGGAGAGGG + Intronic
1087736940 11:101844703-101844725 GGGAGGGAGGGGAGGGGAGTGGG + Intronic
1087842064 11:102930785-102930807 GGGAGGGAGGGGAGGAAAGAAGG + Intergenic
1088585000 11:111354088-111354110 GGGAGGGAGGGGAAGGAAGAAGG + Exonic
1088696391 11:112369803-112369825 GGGAGTGAGGGTAGGGGAGCAGG + Intergenic
1088795832 11:113266078-113266100 GTTAGTCAAGGGAGGGCTGAGGG + Intronic
1088920598 11:114257708-114257730 CTGAGGGAGGGGAGGGGAGCTGG - Intergenic
1089355990 11:117854239-117854261 GTGAGAGAGGGAAGGACAAATGG + Intronic
1089534356 11:119151419-119151441 GTCATCGAGGGGAGGGCAGGGGG - Intronic
1089650794 11:119911495-119911517 GTGGGACTGGGGAGGGCAGATGG - Intergenic
1089795265 11:120975243-120975265 GTGAGTGATGGGAGTGGAGGGGG + Intronic
1089887753 11:121844875-121844897 GGGAGTGGAGGGAGGGGAGAGGG - Intergenic
1089990035 11:122850466-122850488 GTGAGTGTGGGGTGGGGACATGG - Intronic
1090359121 11:126160508-126160530 TGGAGTGAGGGGAGGGCAGCAGG + Intergenic
1090482731 11:127082299-127082321 CAGAGTGAGGGAAGGGCACAAGG - Intergenic
1090623585 11:128585298-128585320 GGGAGGGAAGGGAGGGAAGAAGG + Intronic
1090817906 11:130314791-130314813 GGGACTGAGGGGAGGGGAGGGGG + Intergenic
1090829793 11:130413285-130413307 GTTATTGAGGGGAGAGCAGAGGG - Intronic
1091314810 11:134606829-134606851 GTGAGGGTGGGGAGTGCTGAAGG + Intergenic
1091361038 11:134978599-134978621 GCGAGGGAGGGAAGGGCAGAGGG + Intergenic
1091390533 12:123607-123629 GAGAGTGCTGGGAGGGCAGATGG + Intronic
1091395585 12:152439-152461 GTGAGGGAGAGGAGGGCACAGGG + Intronic
1091546026 12:1501854-1501876 GTCAGTGAGGGGACAGGAGAAGG - Intergenic
1091611896 12:2017543-2017565 GGGAGTGAGGGGAGAAGAGATGG + Intronic
1091667577 12:2430540-2430562 CTGAGTCAGGGGTGGGCAGGTGG - Intronic
1091744049 12:2979887-2979909 GTGAGTGAATGAAGGGCACAAGG + Intronic
1091908269 12:4206825-4206847 GTGGGTGGGGGGTGGGCGGAGGG + Intergenic
1091926357 12:4353811-4353833 GTGACAGAGGGGATGACAGAGGG + Exonic
1092056535 12:5512381-5512403 GAGAATGAGGGGAAGCCAGAGGG + Intronic
1093010358 12:14100982-14101004 TTGTTTGAGTGGAGGGCAGAGGG + Intergenic
1093632459 12:21425538-21425560 GTCAGTGGGGAGAGGGAAGAAGG - Intergenic
1093675850 12:21939650-21939672 GAGAGAGAAGGGAGAGCAGATGG + Intronic
1093798100 12:23337597-23337619 ATGAGTGGGGGGAGGGTACACGG + Intergenic
1093930065 12:24947156-24947178 GTGTGTGTGTGGAGGGAAGACGG - Intronic
1094292180 12:28863807-28863829 GGGAGGGAGGGGAGGGAGGAAGG - Intergenic
1095556628 12:43513910-43513932 GCGGGTGAGGGGAGGGGGGAGGG + Intronic
1095770608 12:45952201-45952223 GTGGCTGAGGGGAGGGGTGAAGG - Intronic
1095886440 12:47193451-47193473 GTGATTGAGGGTTGGGGAGAAGG - Intronic
1095991374 12:48036908-48036930 GTGAGTGAGGGGATGTGAGATGG + Intergenic
1095996037 12:48085448-48085470 GAGAATGAGGGAAGGGCTGAGGG - Intronic
1096036239 12:48473565-48473587 GTGAGGGAAGGGAGGGGAGGAGG + Exonic
1096127107 12:49128067-49128089 GTGGGTGAGGGGATGGAGGAAGG - Exonic
1096145080 12:49273102-49273124 GTGGGTGAGGGGATGGAGGAAGG + Exonic
1096155499 12:49339331-49339353 GTGAGTGGAGGGAGGGAAAAGGG - Intergenic
1096319444 12:50598796-50598818 GGGGGAGAGGGGAGGGGAGAGGG - Intronic
1096465293 12:51845347-51845369 GTGAGGGAGATCAGGGCAGAGGG - Intergenic
1096477268 12:51915926-51915948 GACAGAGAGGGGAAGGCAGATGG - Intronic
1096488015 12:51996646-51996668 GTGTGTGGGGTAAGGGCAGAAGG - Intronic
1096626887 12:52901364-52901386 GTGAGGGTGGAGAGGGCAGCTGG - Intronic
1096685125 12:53283258-53283280 GTGAGTCTGGGGAGGACAGCAGG + Intronic
1096792027 12:54051469-54051491 GTGAGTGAGGGGGCGGAGGAAGG - Intronic
1096792804 12:54055384-54055406 GGGAGGGAGAGGAGGGCAGGGGG - Exonic
1096977782 12:55709091-55709113 GTGAGAGAGAGAAGGGAAGATGG - Intronic
1097080015 12:56423080-56423102 GTGAGTGAGGAGGGGGCAGCTGG - Intronic
1097188539 12:57208671-57208693 GTGAGTGTGGGCAGGCCGGAGGG - Intronic
1097223416 12:57463191-57463213 CTGAGTGAGGGGAGGGGTAAGGG - Intronic
1097270625 12:57771955-57771977 GCTAGTGAGGAGTGGGCAGAGGG - Exonic
1097287667 12:57890030-57890052 GTGAGGCAGGGGAGGCCAGAGGG + Intergenic
1097477219 12:60073127-60073149 TTGAGTGAGGGGAGAGGAGGAGG - Intergenic
1097863908 12:64543468-64543490 GGGAGTGGGGGGTGGGCAGGCGG - Intergenic
1097958741 12:65512279-65512301 GAGAGGGAGGGGAGGACAGAAGG - Intergenic
1097991072 12:65834554-65834576 GTGAGGGAGGGAAGGAAAGAAGG - Intronic
1098230031 12:68363846-68363868 GTGAGAGAAGGGAGGACAGATGG - Intergenic
1098288697 12:68934110-68934132 GGGAGAGAGGGAAGGGGAGAGGG - Intronic
1098377924 12:69837270-69837292 GTGAGTGAGAGGAGGATAGAAGG - Intronic
1098389705 12:69956592-69956614 GGGAGAGAGGGGAGGACAGAGGG - Intronic
1099267862 12:80470422-80470444 GGGAGTGAAGATAGGGCAGAAGG + Intronic
1100250411 12:92815972-92815994 AAGAGTGAGAGGAAGGCAGAAGG + Intronic
1100467107 12:94855955-94855977 GTGAGTGAGGTGATACCAGAAGG + Intergenic
1100535319 12:95503438-95503460 GTGAGGGAGTGGAGGGGAAAGGG + Intronic
1101032978 12:100678136-100678158 GGCAGAGAGGGAAGGGCAGAGGG - Intergenic
1101056129 12:100916012-100916034 GTGAGTGAGTGGAGGGCAAGTGG + Intronic
1101099803 12:101380493-101380515 TTGAATGAGTGGAGGGTAGAAGG + Intronic
1101434051 12:104650055-104650077 GTCAGAGAGGGCAGGGGAGAGGG + Intronic
1101604120 12:106234942-106234964 GAGAGCAAGGGGAGGGCAGGTGG - Intergenic
1101814247 12:108133740-108133762 GTGAGGGAGGCGGGGGCAGGGGG - Intronic
1101838256 12:108310193-108310215 GTGTGTTAGGGGAGGGGAGAAGG + Intronic
1101909161 12:108849861-108849883 GGGAGCTAGGGGAGGGCAGATGG + Intronic
1101909255 12:108850094-108850116 GTGAGCTGGGGGAGGGGAGATGG + Intronic
1101909304 12:108850214-108850236 GGGAGCTGGGGGAGGGCAGATGG + Intronic
1102026820 12:109718400-109718422 GTGAGGGATGGGAAGGCAGAGGG - Intronic
1102214574 12:111151578-111151600 CTGAATGCGTGGAGGGCAGACGG + Intronic
1102517523 12:113459869-113459891 GGGAGAGAGGGGAGGGGAGGAGG - Intergenic
1102774697 12:115508327-115508349 CTCAGTGACGAGAGGGCAGAGGG - Intergenic
1102959858 12:117085407-117085429 GTGAGGGTCGGGAAGGCAGAAGG + Intronic
1103348310 12:120265594-120265616 GTGAGTGAGCGGGAGGCCGAGGG - Intronic
1103524383 12:121558103-121558125 GTGAGTGCCGTGAGGGCAGGAGG + Intronic
1103568768 12:121830521-121830543 GAGAGAGAGGGGAGGAGAGACGG - Exonic
1103825107 12:123731816-123731838 GGGAGGGAGGGGATGGCAGGAGG - Intronic
1103929908 12:124444625-124444647 GTGAATCTGGAGAGGGCAGAAGG + Intronic
1103941235 12:124502376-124502398 GGGAGTAAGAGGATGGCAGAAGG + Intronic
1103949558 12:124543471-124543493 GCCAGTGAGGGGCGGGGAGACGG + Intronic
1104376625 12:128268879-128268901 GTGAGAGAGGGGGGGGAAGAAGG + Intronic
1104433331 12:128734580-128734602 ATCAGTGAGGGGAAGGGAGAAGG + Intergenic
1104544435 12:129698597-129698619 GGGAGGGAGGGGAGGGGAGACGG + Intronic
1104591168 12:130085670-130085692 GGGGCAGAGGGGAGGGCAGAGGG - Intergenic
1104908468 12:132228192-132228214 CTGCATGAGTGGAGGGCAGAGGG - Intronic
1104920899 12:132290238-132290260 CTGTGTGTGGTGAGGGCAGACGG - Intronic
1105038940 12:132946843-132946865 GCGCGTGAGGGAAGGGCTGAAGG - Intronic
1105213656 13:18272365-18272387 CTGTGTGTGGGGAGGGCACAGGG - Intergenic
1105509685 13:21040774-21040796 GGGAATGAGAGGAGGGGAGAGGG + Intronic
1105592139 13:21802251-21802273 GCGAATGAGTGGAGTGCAGATGG + Intergenic
1105767321 13:23574734-23574756 CTCTGTGATGGGAGGGCAGAGGG + Intronic
1106763779 13:32893658-32893680 GTGAGAGAAGGGAAGGCTGAAGG - Intergenic
1107172990 13:37365376-37365398 GTGTGTGTGGGCAGGGCAGGGGG + Intergenic
1107788488 13:43977802-43977824 GGGAGGGAAGGGAGGGGAGAGGG - Intergenic
1108035520 13:46286514-46286536 GTGGGTGGGGGGAGGGGGGAGGG - Intergenic
1108592154 13:51921784-51921806 GGGAGAGAGGGGAGAGCAGGGGG - Intergenic
1108851395 13:54736095-54736117 GTGAGGGAAGGGAAGGGAGAGGG - Intergenic
1109400922 13:61827853-61827875 GTGGGTGGGGGGAGGGAGGAGGG - Intergenic
1110086261 13:71384702-71384724 GTGGGTGGGGGGAGGGGGGAGGG - Intergenic
1110189718 13:72716314-72716336 GTGACTGGGGAGAGGGCAGAAGG + Intronic
1110314001 13:74083960-74083982 GTGAGATAGGGAATGGCAGATGG + Intronic
1110577493 13:77075678-77075700 GGGGGTGAGGGGAATGCAGAGGG + Intronic
1110641517 13:77830182-77830204 GGGAGGGAGGGGAGGGAAGAAGG - Intergenic
1110641536 13:77830223-77830245 GGGAGGGAGGGGAGGGAAGAAGG - Intergenic
1110788998 13:79566861-79566883 GTGAGAGGGAGGAGGGGAGAAGG - Intergenic
1111136155 13:84047018-84047040 GTGGGTGGGGGGAGGGGGGAGGG - Intergenic
1111650722 13:91087726-91087748 TTTAGTAAGGTGAGGGCAGAGGG - Intergenic
1112012927 13:95307248-95307270 GTGGGTGGGGGGAGGGGGGACGG + Intergenic
1112157453 13:96833199-96833221 CTGAGAGAGGAGAGGGCAGGAGG - Exonic
1112439604 13:99416255-99416277 GTGAGTCTGGGGAGGTCAGCAGG + Intergenic
1112454682 13:99548207-99548229 ATTAGTGAGTGGAGTGCAGATGG - Intronic
1112552440 13:100434284-100434306 GTGAGAGACAGGAAGGCAGAAGG + Intronic
1112601069 13:100856483-100856505 GGGAGAGGGGGCAGGGCAGATGG + Intergenic
1112714278 13:102165664-102165686 GTGGGTGGGGGGAGGGGGGAGGG + Intronic
1112799645 13:103096421-103096443 GGGAGTGAGGGCAGGGAAGGCGG - Intergenic
1112854792 13:103754509-103754531 GTGGGTGAGGGGCGGGGGGAGGG + Intergenic
1113548699 13:111175353-111175375 GAGAGTGAGGGAATGGGAGAGGG + Intronic
1113934067 13:113984203-113984225 GTGAGTGATGGATGGACAGATGG - Intronic
1113934420 13:113986201-113986223 GTGAGTGATGGATGGACAGATGG - Intronic
1113934764 13:113988191-113988213 GTGAGTGATGGATGGACAGATGG - Intronic
1113935063 13:113989569-113989591 GTGAGTGATGGGTGGATAGATGG - Intronic
1114069540 14:19096602-19096624 GTGAGTGTGTGGGGGGGAGAGGG + Intergenic
1114092722 14:19303401-19303423 GTGAGTGTGTGGGGGGGAGAGGG - Intergenic
1114455201 14:22849404-22849426 TGGGGTGAGGGGAGAGCAGAGGG + Intergenic
1114645304 14:24252721-24252743 GTGAGGGAGGGGTGGGCAAGTGG + Intronic
1115119627 14:29925498-29925520 GAGAGTGAGACGAGAGCAGAGGG - Intronic
1115262240 14:31466108-31466130 GCGAGAGAGGGCAGGGCACAGGG - Intergenic
1116036462 14:39633679-39633701 TGGAGTGAGGGGAGGGGGGAGGG - Intergenic
1116282678 14:42928757-42928779 GTAAGTGAGGGGATGGCTGTAGG + Intergenic
1116475226 14:45331500-45331522 GGGAGGGAGGGGAGGGAAGGAGG - Intergenic
1116950697 14:50875964-50875986 GTGAGTGAGGGGAGCTTAGAAGG + Intronic
1116958620 14:50947956-50947978 GAGAGAGAGGGAAGGGTAGAAGG + Intergenic
1116971027 14:51066111-51066133 GGGAGGGAGGGGAGGGGAGGGGG + Intronic
1117021292 14:51573402-51573424 GAGAGAGAGGGGAGGAAAGAAGG + Intronic
1117324263 14:54654314-54654336 GGGAGTCACGGGAGGTCAGATGG + Intronic
1117663124 14:58029091-58029113 GGGAGTGAGGGGAATGGAGAGGG - Intronic
1117745347 14:58863737-58863759 GTCAGTGAAGGGAGGACAGCAGG - Intergenic
1118063300 14:62164241-62164263 GTTAATGAGGTGACGGCAGAAGG + Intergenic
1118158930 14:63269603-63269625 GGGGGTGAGGGGAGGAGAGAGGG + Intronic
1118467248 14:66042138-66042160 GTGAGGGAGAGGAGAGCAGCAGG + Intergenic
1118935030 14:70279865-70279887 GAGAGTGGGGGGAGGGAGGAGGG + Intergenic
1119191903 14:72688661-72688683 ATGAATGAAGGGAGGGCAGCTGG - Intronic
1119776204 14:77250356-77250378 GTGTCTGAGGGAAGGGCAGTGGG - Intronic
1119932034 14:78556956-78556978 GGGAGGGAGGGGAGGGGAGGGGG - Intronic
1119997641 14:79271360-79271382 GTAAGGGAGGGGAGGGGAGAGGG - Intronic
1121234118 14:92379901-92379923 GTGAGGGTGGAGAGGGGAGAGGG - Intronic
1121255131 14:92525431-92525453 GAGATTGAGGGGAGGGAAGGAGG + Intronic
1121321695 14:92995266-92995288 GTGGGTGAGCAGAGGGCAGGGGG - Intronic
1121524947 14:94613258-94613280 GGAAGGGAGGGGAGGGGAGAGGG - Intronic
1121545986 14:94764017-94764039 GTTGGTGAGGGGAGGGCAATGGG - Intergenic
1121895102 14:97639662-97639684 GTGAGGGAAGGGAGGCAAGAAGG - Intergenic
1122108247 14:99476996-99477018 GGGAAGTAGGGGAGGGCAGAGGG - Intronic
1122160886 14:99783133-99783155 GTGGGTGGGGGGAGGGGGGAGGG - Intronic
1122269630 14:100562766-100562788 GTGAGTGGGGGGCGGGGAGCAGG - Intronic
1122366582 14:101198106-101198128 GCCAGTGAGGAGAGGGCAGGTGG + Intergenic
1122452563 14:101822073-101822095 GTGTGTGGGGGGGGGGCAGGGGG - Intronic
1122674088 14:103396007-103396029 CTGAGTCGGGAGAGGGCAGAAGG + Intronic
1122886781 14:104713773-104713795 GTGAGTGGAGGGAGGGATGAGGG - Intronic
1122931197 14:104933698-104933720 CTGAGTGAGGGAAGGGCGGGAGG + Exonic
1122931224 14:104933766-104933788 CTGAGTGAGGGGAGGGTGGGAGG + Exonic
1122931268 14:104933869-104933891 CTGAGTGAGGGGAGGGCGGGAGG + Exonic
1122931307 14:104933971-104933993 CTGAGTGAGGGGAGGGTGGGAGG + Exonic
1123541081 15:21292151-21292173 GAAAGGGAGGGGAGGGGAGAAGG + Intergenic
1123668387 15:22628573-22628595 GTGAGGGAGGTTTGGGCAGATGG - Intergenic
1123819160 15:24010332-24010354 TTGAGTGGGGGGAGGGGGGACGG - Intergenic
1124524364 15:30435034-30435056 GTGAGGGAGGTTTGGGCAGATGG - Intergenic
1124534301 15:30531189-30531211 GTGAGGGAGGTTTGGGCAGATGG + Intergenic
1124626850 15:31312568-31312590 GTGGGTGGAGGGAGAGCAGAAGG + Intergenic
1124649104 15:31462006-31462028 GTGATGGAGGAGGGGGCAGAGGG - Intergenic
1124680337 15:31725009-31725031 GTGAGTGATTGCGGGGCAGAGGG + Intronic
1124764347 15:32476422-32476444 GTGAGGGAGGTTTGGGCAGATGG - Intergenic
1124774287 15:32572676-32572698 GTGAGGGAGGTTTGGGCAGATGG + Intergenic
1124789982 15:32718189-32718211 GTGAGTGGGCGGAGGGAAGAGGG + Intronic
1125194270 15:37028878-37028900 GGGAGATAGGGGTGGGCAGAAGG - Intronic
1125281231 15:38044351-38044373 GTAGGGGAGGGGAGGGAAGAAGG + Intergenic
1126163103 15:45632184-45632206 GGGAGGGAGGGGAGGGGAGGGGG - Intronic
1126558869 15:50021624-50021646 GAGAGTGATGGGATGGGAGATGG - Intronic
1126933546 15:53681275-53681297 GGCAGCGTGGGGAGGGCAGATGG + Intronic
1127065559 15:55234187-55234209 GTGTTGGAGGGGAAGGCAGAAGG - Intronic
1127088941 15:55447792-55447814 GGGAGAGGGGAGAGGGCAGAGGG + Intronic
1127088949 15:55447813-55447835 GGGAGAGGGGAGAGGGCAGAGGG + Intronic
1127088957 15:55447834-55447856 GGGAGAGGGGAGAGGGCAGAGGG + Intronic
1127395665 15:58542171-58542193 GTGGATGAGGAGAGGGGAGAAGG - Intronic
1127412268 15:58721550-58721572 GTGTGTGGGGTGGGGGCAGAGGG - Intronic
1127470104 15:59282877-59282899 GAGAGGGAGGGGAGGGGGGAGGG + Intronic
1127670228 15:61187941-61187963 GTGTGTTAGGGGAGGGTTGAGGG - Intronic
1128179638 15:65590474-65590496 GTGGGTGTGGGAGGGGCAGATGG - Intronic
1128649306 15:69398824-69398846 CTGAGTCAGAGGAGGGCAGAGGG + Intronic
1129000019 15:72325026-72325048 GAGAGAGAGGAGAGGGGAGATGG - Intronic
1129077828 15:73012622-73012644 GGGAGGGAGGGAAGGGGAGAGGG - Intergenic
1129146706 15:73654518-73654540 GTGGGGGAGGGCAGGGCAGGTGG + Intergenic
1129166851 15:73783376-73783398 GAGATGGAGGAGAGGGCAGAGGG - Intergenic
1129386817 15:75201029-75201051 GTGGGGAAGGGGAGGGCAGGTGG - Intronic
1129442153 15:75589024-75589046 GAGTGGGAGGGGAGGGGAGAGGG + Intergenic
1129508792 15:76104735-76104757 ATGTGTGAGGAGAGGGGAGAAGG + Intronic
1129653250 15:77506343-77506365 GAGAGGGAGGGGAGTGCACAGGG - Intergenic
1129676860 15:77636467-77636489 GTGAGTGGGGGTTGGGCAGCTGG + Intronic
1129759374 15:78120662-78120684 CTGGGTGGGGGCAGGGCAGAGGG + Intronic
1129912871 15:79242589-79242611 AGGAGTGAGGGGAGGGTTGACGG + Intergenic
1130065794 15:80604087-80604109 GTGAGTAAGGAGAGGTGAGAGGG + Intergenic
1130107424 15:80939344-80939366 GTGGATGAGGGGAGGGCCCAGGG + Intronic
1130411284 15:83650659-83650681 GTGACTGAGGGAAGGGGTGAGGG + Intergenic
1130795761 15:87207705-87207727 CTGAGTGAGGCTTGGGCAGATGG - Intergenic
1130843967 15:87726930-87726952 GTGAGTCAGAGGAGGGAAGATGG + Intergenic
1130850543 15:87789409-87789431 GTGAGTGGGGGGAGGGGGGAGGG + Intergenic
1131039550 15:89250545-89250567 TGGAGTGAGGGGAGGGGGGAGGG + Intronic
1131250707 15:90828296-90828318 GTGAGTGTGGGCCGGGCAGCGGG - Intergenic
1131371158 15:91882978-91883000 GTGAGTAAGGGAATGACAGATGG + Intronic
1131406141 15:92166542-92166564 GTGAGTGAGGGGAAGCTGGAGGG - Intronic
1131468147 15:92672412-92672434 GAGCGGGAGGGGAGGGCAGATGG - Intronic
1131732833 15:95300231-95300253 GTGAGTGTGGGGTGAGGAGATGG + Intergenic
1132156133 15:99496361-99496383 GTGTGGGCAGGGAGGGCAGAAGG + Intergenic
1132159925 15:99531231-99531253 GTGGGTGGGGGGAGGGGGGAGGG - Intergenic
1132180589 15:99750011-99750033 GGGAGAGATGGGAGGGTAGAAGG - Intergenic
1132240391 15:100253349-100253371 GTGAGGGAGGGGAAGGTAGAGGG + Intronic
1202949394 15_KI270727v1_random:19292-19314 GAAAGGGAGGGGAGGGGAGAAGG + Intergenic
1132480050 16:162873-162895 GTGACTCAGGGGTGGGCAGAAGG + Intronic
1132629328 16:909235-909257 GTGAGTGAGGGGGAGGGAAAAGG + Intronic
1132673887 16:1113859-1113881 GTGAGTGGGGTGAGGGTAGTGGG - Intergenic
1132923333 16:2411918-2411940 GTGGGGGAGCTGAGGGCAGAGGG - Intergenic
1133027943 16:2996805-2996827 ATGAGTGAGGGGAGGTCTGTAGG + Intergenic
1133029025 16:3000956-3000978 GTGAGTGAGAAGAGGCCAGGAGG + Intergenic
1133063175 16:3188557-3188579 GTGAGTGAGAGGAGGGAGGCGGG + Intergenic
1133076247 16:3283266-3283288 GTGACTGGGGGCAGGGCAGCTGG - Exonic
1133172550 16:3990661-3990683 CTGAGTCAGGGGAGGAGAGAGGG - Intronic
1133333982 16:4994855-4994877 GTGATTCAGGAGAGGGCAGAAGG - Intronic
1133485564 16:6215249-6215271 GGGAGAGAGAGAAGGGCAGAGGG + Intronic
1133495745 16:6315418-6315440 GTGAGGGATGGGTGGGTAGATGG + Intronic
1133722702 16:8509739-8509761 GAGAGAGAGGGGAGAGCAGGAGG - Intergenic
1134006570 16:10822225-10822247 GTGGGTAGGGGGAGGGGAGAGGG - Intergenic
1134044785 16:11093208-11093230 GTGAGAGAGAGAAGGGCAGTAGG + Intronic
1134240021 16:12499081-12499103 GGGAATGAGCGGAGGGCATAAGG - Intronic
1135295691 16:21277712-21277734 GTGTCTAAGGGAAGGGCAGAGGG - Intronic
1135621601 16:23960620-23960642 GTCAGAGTGGGGAGGGAAGAGGG - Intronic
1135892693 16:26371685-26371707 GTGGGGGAGGGGAGGGAGGAAGG + Intergenic
1136014141 16:27384048-27384070 GTGTGGGTGGGGAGGGCAGAGGG - Intergenic
1136145661 16:28315004-28315026 GGGAGTGCAGGGAGGGTAGAGGG + Intronic
1136330842 16:29575417-29575439 GTGTGTATGGGGAGGGCAGGTGG - Intergenic
1136504685 16:30695413-30695435 GTGGGAGAGAGGAGGGAAGATGG - Intergenic
1137353880 16:47739174-47739196 GTGAGAGACAGGAGGGCAGAAGG + Intergenic
1137547680 16:49415719-49415741 CAGAGGGAGGGGAGGCCAGAGGG + Intergenic
1137805626 16:51302673-51302695 GTGATACAGGGGAGGGGAGAGGG + Intergenic
1138189047 16:54999403-54999425 TGGAGTGGGGAGAGGGCAGAAGG - Intergenic
1138438353 16:57019563-57019585 GTCAGTGAGCACAGGGCAGATGG + Intronic
1138504729 16:57472540-57472562 GTCAGTGAGAGGGGGGCAGCAGG + Exonic
1138544438 16:57707297-57707319 TTGGGTGATGGGAGGGGAGATGG + Intronic
1138667747 16:58586357-58586379 GAGGGGGAGGGGAGGGCAGGGGG + Intronic
1138667797 16:58586452-58586474 GAGGGTGAGGGGAGGGGAGGGGG + Intronic
1139545888 16:67649385-67649407 GTCAGTGAGGGCAGGTCACAGGG - Intronic
1140067702 16:71625444-71625466 GTGAGTGGGCGGATGGTAGATGG + Intergenic
1140221441 16:73047512-73047534 AGGAGGGAGGGGAGGACAGAGGG + Intronic
1140339018 16:74139290-74139312 GTGAGACAGGGGAGGGAAAAAGG - Intergenic
1140473150 16:75226075-75226097 GGGGGTGAGGGGTGGGCAAAAGG - Intergenic
1140703560 16:77605061-77605083 GTGATGCAGGGGATGGCAGAGGG - Intergenic
1141141661 16:81500409-81500431 GGGAGGGAGGGGAGGGAGGAGGG - Intronic
1141524775 16:84604245-84604267 GTGAGTGTGGGGTGGGGAGCAGG - Intronic
1141579690 16:84988740-84988762 GTGAGTGTGGGGTAGGCACATGG - Intronic
1141882917 16:86871833-86871855 GGGAGGGAGGGGAGGAGAGAAGG - Intergenic
1141920958 16:87135026-87135048 GTGAGTGAATGGGGGACAGAGGG + Intronic
1141973101 16:87495838-87495860 GTGAGGGAGGGGTGGGGAGATGG - Intergenic
1142096933 16:88245126-88245148 ATGAGGGAGGGGAGGAAAGAAGG + Intergenic
1142257781 16:89023640-89023662 ATCAGTGAGGGGAGGGGAGGTGG + Intergenic
1142313090 16:89325436-89325458 GAGAGAGAGGAGAGGGGAGAGGG - Intronic
1142478546 17:204365-204387 GTGGGTGGGTGGAGGACAGATGG - Intergenic
1142811497 17:2397585-2397607 GTGAGAGAGGGCAGGTGAGAAGG - Intronic
1142930271 17:3278513-3278535 GTAGGTGAGGGGCTGGCAGATGG + Exonic
1142931875 17:3292178-3292200 GTAGGTGAGGGGCCGGCAGATGG + Exonic
1142945235 17:3420968-3420990 GTAGGTGAGGGGCTGGCAGATGG - Exonic
1143028370 17:3953895-3953917 CTGAGTCGGGGGAGGGTAGAGGG - Intronic
1143091279 17:4450343-4450365 GAGAGAGAGAGGAGGGGAGAGGG - Intronic
1143622856 17:8090972-8090994 GGGAGGGAGGAGAGGGGAGAAGG + Intergenic
1144124781 17:12192980-12193002 ATGAGTGAGGAGAAGGCAGATGG + Intergenic
1144726142 17:17503707-17503729 GTGAGTGGGGAGTGGGCAGGAGG + Intergenic
1144726725 17:17506015-17506037 GCGGGAGAGGGGAGGGGAGAGGG + Intronic
1144746726 17:17620905-17620927 GAGAGAGAGGAGAGGGGAGAGGG + Intergenic
1145005549 17:19335797-19335819 GTGGGTGAGGTGAGGACAGTAGG - Exonic
1145043892 17:19597057-19597079 GTGTGAGTTGGGAGGGCAGAAGG + Intergenic
1145243369 17:21252574-21252596 GGGAGTGAGGGGCGGGGGGATGG - Intronic
1145962949 17:28897885-28897907 GTGAGTCAGGGCAGGGCAGCTGG - Exonic
1145994357 17:29096990-29097012 GTGAGTGAGGGGAAGACCCAGGG + Intronic
1146184352 17:30715310-30715332 GGGAGTGAAGGCTGGGCAGAGGG + Intergenic
1146200136 17:30850297-30850319 GTGGGAGAGGGGAGGGGAGAGGG - Intronic
1146262016 17:31428047-31428069 TGGGGTGAGGGAAGGGCAGAGGG - Intronic
1146327721 17:31901513-31901535 GTGAGAGAGGGTTGGGGAGAGGG - Intronic
1146505737 17:33403331-33403353 CTGACTGAGGAGAAGGCAGAAGG - Intronic
1146688329 17:34856616-34856638 GGGGGTTAGGGGAGGGTAGAGGG + Intergenic
1146941362 17:36846341-36846363 GCAAGTGAGGGAAGGGCAGATGG + Intergenic
1147583393 17:41639045-41639067 AAGAGGGAGGGAAGGGCAGAGGG - Intergenic
1147603026 17:41757611-41757633 GTGAGCTGGGGGAGGGCAGGAGG - Intronic
1147793396 17:43026685-43026707 TTGAGTGAGGGGTGGTCAGGAGG + Intronic
1147896337 17:43754203-43754225 GTCCGTGAGTGGTGGGCAGAAGG + Exonic
1148050944 17:44769695-44769717 CTGGGTGGGGGGAGGGCAGAGGG - Intronic
1148210504 17:45805755-45805777 ATGAGTGAGGGGCAGGGAGAGGG - Intronic
1148214698 17:45828083-45828105 GTGAGTGAAGGAAGGAAAGACGG - Intronic
1148259981 17:46173211-46173233 TTGAGAGAGAAGAGGGCAGAAGG - Intronic
1148330201 17:46809625-46809647 GTGAGGGGGGCGAGGGCAAAGGG - Intronic
1148462594 17:47847053-47847075 GTGAGGCAGGGGAGAACAGAGGG + Exonic
1148605628 17:48927144-48927166 TTGAGTGGGGGAAGGGGAGATGG - Exonic
1148686259 17:49502764-49502786 GTGACAGAGGGGAGGGGAGACGG + Intronic
1148731613 17:49840136-49840158 GTTTGTGAAGGGAGAGCAGAGGG - Intronic
1148742469 17:49900675-49900697 TAGAGTGAGGGCAGGACAGATGG - Intergenic
1148873975 17:50675716-50675738 GTGACAGAGGCGAAGGCAGATGG + Exonic
1148985026 17:51613478-51613500 GTGAGGGAGGGGGAGGGAGAGGG - Intergenic
1149023905 17:52002326-52002348 GGGAGAGAGGGGAGGCCAGAGGG + Intronic
1149315128 17:55431853-55431875 GGAAGGGAGGGGAGGGCAGGGGG + Intergenic
1149405758 17:56349227-56349249 GTGAGTGCGGGCTGGGAAGAGGG + Intronic
1149499610 17:57142181-57142203 GTGACTGTGGGGTGGGGAGATGG - Intergenic
1149564416 17:57630939-57630961 GGGGATGAGGAGAGGGCAGAGGG - Intronic
1149938677 17:60838412-60838434 GTGGGTGTGGGGAGTGAAGAGGG + Intronic
1150281835 17:63933442-63933464 GAGAGTGAGAGGTGGACAGAGGG - Intergenic
1150368520 17:64613738-64613760 GTGTGTGGAGGGGGGGCAGAGGG + Intronic
1150449206 17:65251693-65251715 ATGAGTGAGGTGAGTGCAGAGGG + Intergenic
1150605551 17:66687599-66687621 GGGAGTTAGGGGAGGGCATAAGG + Intronic
1150624800 17:66835054-66835076 GAGAGGGAGGGGCGGGCAGGGGG - Intergenic
1150697735 17:67420371-67420393 GGGAGGGAGGGGAGGGAGGAAGG - Intronic
1150929881 17:69573098-69573120 GGGAGGGAGGGGAGGGAAGAGGG - Intergenic
1150947615 17:69765406-69765428 GAGAGGGAGGGGAGGGAAGAAGG - Intergenic
1150984847 17:70184530-70184552 GAGGGGGAGGGGAGGGGAGAGGG - Intergenic
1150984859 17:70184552-70184574 GGGAGGGAGGGGAGGGGAGAGGG - Intergenic
1151426199 17:74032553-74032575 GTGAGTTAGTGGTGGGCAGGGGG - Intergenic
1151701058 17:75742775-75742797 GGGAGAGTGGGGAAGGCAGACGG + Intronic
1151713895 17:75821800-75821822 GCGAGTGAGCAGAGGGCAGCTGG + Intronic
1151740945 17:75981615-75981637 CTGAGGGAGAGGAGGACAGAAGG - Intronic
1151969395 17:77450111-77450133 GTGAGGGTGGGGAGGGCCGTGGG + Intronic
1151990849 17:77572976-77572998 GTGTGTGATGGGAGAGCCGAGGG + Intergenic
1152034514 17:77863944-77863966 GTGAGAGAGGGGAGGGCCCTGGG + Intergenic
1152145599 17:78566907-78566929 GGGTGTGATGGGAGGGCACACGG - Intronic
1152488324 17:80610541-80610563 GTGCTTGAGGAAAGGGCAGAAGG + Intronic
1152511525 17:80792891-80792913 GTGTGTGTGGGGAGGGCGCAGGG - Intronic
1152615271 17:81334924-81334946 GTGAGGGCGTGGATGGCAGAGGG - Intergenic
1152701928 17:81823651-81823673 GTGAGGCTGGGGTGGGCAGAGGG - Intronic
1152750436 17:82060090-82060112 GGGCCTGAGGGGAGGGCAGCGGG + Exonic
1152855360 17:82662519-82662541 GGGAGGGAGGTGAGGGCAGGTGG + Intronic
1153563290 18:6393933-6393955 GTGAGCAAGGGGAGAGCGGAAGG - Intronic
1153643072 18:7172324-7172346 GGGAGTGAGGGGAGAGGACAAGG - Intergenic
1153795481 18:8618118-8618140 ATCAGGGAGGGGAGGACAGAGGG - Intronic
1153975889 18:10268236-10268258 TGGAGTGAGAGGAGGGGAGAGGG - Intergenic
1154009094 18:10560243-10560265 GAGAGTGAGGGAAGGTGAGATGG + Intergenic
1154157984 18:11959003-11959025 GGGAGAGAGGAGAGGGGAGAGGG - Intergenic
1154157991 18:11959024-11959046 GAGAGAGAGGAGAGGGGAGAGGG - Intergenic
1154275166 18:12952745-12952767 GGGTGGGAGGGGAGGGGAGAGGG - Intronic
1154302122 18:13203444-13203466 CTGATTGAGAGCAGGGCAGAAGG + Intergenic
1154432784 18:14321122-14321144 GTGAGAGGGTGGTGGGCAGAAGG + Intergenic
1154494264 18:14944354-14944376 GCGAGCGAGGGAAGAGCAGAGGG - Intergenic
1155241429 18:23867137-23867159 AGGAGGGTGGGGAGGGCAGAGGG - Intronic
1155285296 18:24282059-24282081 GGGAGTGGGGGGTGGGGAGATGG - Intronic
1155352093 18:24917161-24917183 GGGAATGAGAGGAGGGCACAGGG + Intergenic
1155627752 18:27854280-27854302 GAGAGTGGGGGGTGGGAAGAGGG - Intergenic
1156130014 18:33961319-33961341 GTGGGTGAGGGGAGGGCCTAAGG + Intronic
1156343560 18:36235273-36235295 GTGGGTGGGGGGAGGGGGGAGGG - Intronic
1156391280 18:36652736-36652758 GGGGGTGACAGGAGGGCAGATGG - Exonic
1156456679 18:37298793-37298815 GGGAGTGAGGGGAGAGTAGCAGG - Intronic
1156463579 18:37335012-37335034 GGGAGAGAGGGGGGAGCAGAGGG - Intronic
1156464715 18:37341508-37341530 GGCAGTGAGTGGAGGGCATAAGG + Intronic
1156542729 18:37931082-37931104 GGGAGTGAGGGGTGGCAAGAGGG + Intergenic
1156675664 18:39524712-39524734 CTGAGTAAGGGGAGGGGAGAAGG - Intergenic
1156733950 18:40229962-40229984 GTGGGTGGGGGGAGGGAGGAGGG - Intergenic
1157218185 18:45802681-45802703 CAGAGTGAGGGTGGGGCAGAAGG - Intergenic
1157235483 18:45961376-45961398 GTGAGTGAGGGGAGAACAGTAGG - Intronic
1157406100 18:47423893-47423915 ATGAGTGAGGGAAGTGGAGAGGG + Intergenic
1157572920 18:48724719-48724741 GGGACTTAGGGAAGGGCAGAGGG + Intronic
1157575101 18:48738444-48738466 GTGTGAAGGGGGAGGGCAGATGG - Intronic
1157830207 18:50850579-50850601 GGGAGGCCGGGGAGGGCAGATGG + Intergenic
1158219956 18:55140304-55140326 GAGAGAGAGGAGAGGGGAGAGGG + Intergenic
1158284998 18:55870586-55870608 GTGAATGAATGGCGGGCAGAAGG - Intergenic
1158368878 18:56773901-56773923 GTGGGTGAGGGGAGAGAAGAAGG - Intronic
1158416936 18:57256946-57256968 GTGGTTGAGAGGAGGGGAGAGGG + Intergenic
1158532415 18:58275640-58275662 GTGAGTCAGGGCATGGCAGGGGG - Intronic
1158543964 18:58379927-58379949 GGGAGTGAGGAGAGGGCCCAAGG - Intronic
1158932665 18:62336366-62336388 GTGAAGGAAGGGAGGGCAGCAGG + Intronic
1159652235 18:70990572-70990594 GTGGGTGGGGGGAGGGGAGAGGG + Intergenic
1159820846 18:73141620-73141642 AGTAGTGAGGGGAGGGGAGAAGG - Intergenic
1159963521 18:74574570-74574592 GGAAGTGCGGGGAAGGCAGAAGG - Intronic
1160134919 18:76263669-76263691 GTGAGTGGGGTGCGGGCAGGAGG - Intergenic
1160251248 18:77205059-77205081 GAGAGAGAGAGGAGTGCAGAGGG - Intergenic
1160409855 18:78667993-78668015 GGGTGGGATGGGAGGGCAGATGG - Intergenic
1160674141 19:379856-379878 GGGAGGGAGGTGGGGGCAGAAGG + Intergenic
1160674906 19:384870-384892 GGGAGGGAGGTGGGGGCAGAAGG + Intergenic
1160674916 19:384912-384934 GAGAGGGAGGTGGGGGCAGAAGG + Intergenic
1160674929 19:384954-384976 GGGAGGGAGGTGGGGGCAGAAGG + Intergenic
1160674941 19:384996-385018 GGGAGGGAGGTGGGGGCAGAAGG + Intergenic
1160674953 19:385038-385060 GGGAGGGAGGTGGGGGCAGAAGG + Intergenic
1160892413 19:1386220-1386242 GTGGGTGAGGTGAGGCCCGATGG - Intronic
1160939692 19:1614462-1614484 GGGATGGAGGGGAGGGCGGAAGG + Intronic
1160939977 19:1615651-1615673 GTGAGGGTGGGGAGTGCCGAGGG + Intronic
1160950449 19:1664394-1664416 GGGAGGGAGGGGAGGGGAGGGGG - Intergenic
1160975478 19:1790410-1790432 GGAAGGGAGGGGAGGGGAGAGGG - Intronic
1160983468 19:1827149-1827171 CTGAGGCTGGGGAGGGCAGAGGG + Exonic
1161080804 19:2309069-2309091 GTGAGTGAGGACAGGCCAGGGGG - Intronic
1161093834 19:2377465-2377487 GGGAGAGAGGAGAGGGGAGAGGG - Intergenic
1161093878 19:2377564-2377586 GGGAGAGAGGGGAGAGGAGAGGG - Intergenic
1161152167 19:2715337-2715359 GTTAGTGAGGGAAGGTGAGATGG - Exonic
1161610188 19:5238047-5238069 CTGGGTGAAGGGAGGGAAGAGGG + Intronic
1161657652 19:5525793-5525815 GTGAGGGAGGGGAGGATGGATGG - Intergenic
1161913892 19:7214798-7214820 GGGAGGGAGGGGAGGGAGGAGGG - Intronic
1162028204 19:7905961-7905983 GAGAGTGAGGGGAAGGGACATGG - Intronic
1162109525 19:8392482-8392504 GCCAGTGTGGGGAGGGCAGCAGG - Intronic
1162169745 19:8779889-8779911 GGGAGTGAGGGGGGGAAAGAGGG - Intergenic
1162292831 19:9792313-9792335 CTCAGTGAGGGGAGAGAAGAGGG - Intronic
1162582609 19:11540035-11540057 GTGAGTGGGGGGAGGTGGGAGGG - Intronic
1162797981 19:13096371-13096393 GGGAGTGACGGGAGGGGAGGAGG + Intronic
1162974424 19:14200364-14200386 GGGAGTGAAGGCTGGGCAGAGGG - Intronic
1163009730 19:14417485-14417507 GTGGGTGGGGGGAGGGGGGAGGG + Intronic
1163024650 19:14503552-14503574 GGGAGGGAGGGGAAGGAAGAAGG - Intergenic
1163609672 19:18294399-18294421 GAGGGTGTGGGGAGGCCAGAGGG - Intergenic
1163704359 19:18803724-18803746 GTGAGGGAGGAGGGGGGAGATGG + Intergenic
1163829156 19:19539654-19539676 GTGGGTGAGGAGTGGGGAGAAGG - Intronic
1164581623 19:29438684-29438706 GGGAGGGATGGGAGGGGAGAGGG + Intergenic
1164588688 19:29494504-29494526 GGGAGGGAGGGGAGGAAAGAAGG + Intergenic
1164685974 19:30167185-30167207 GTGGGTGGGTGGAGGCCAGAAGG + Intergenic
1164707874 19:30333651-30333673 GTGAGTGAGGTCAGGCCAGGTGG - Intronic
1164740542 19:30572451-30572473 GTTAGGGAGTGGAGGGTAGAGGG - Intronic
1165072407 19:33263254-33263276 GAGAGGGAGGGGAGGGCAGCGGG - Intergenic
1165105894 19:33469557-33469579 GGGAGGGAGGAGAGGACAGATGG - Intronic
1165576177 19:36821039-36821061 GTCAGTGGGGGGAGGGGGGAGGG - Intronic
1165792018 19:38498337-38498359 CAGATTGAGGGGAAGGCAGAAGG + Intronic
1165980056 19:39714087-39714109 ATGGGTGTGGGGAGGGGAGAGGG - Intergenic
1166101989 19:40576536-40576558 GTGGGTGCGGGGTGGGGAGAGGG + Intergenic
1166196231 19:41207567-41207589 GTGAGTAAGGGGTGGGGACAGGG + Intergenic
1166203647 19:41254576-41254598 GAGGGTAAGGGGAGGGTAGAAGG + Intronic
1166683627 19:44782137-44782159 TTGAGGGAGGGGAGGGCTGGGGG + Intronic
1167112353 19:47469797-47469819 GTGGGAGCGGGGAGGGCAGATGG + Intronic
1167120043 19:47511381-47511403 ATGAGTGAGGTTAGGGCAGAGGG - Intronic
1167328711 19:48840937-48840959 GGCAGTGAGGGGAGGACAGTGGG - Intronic
1167429459 19:49446253-49446275 GTGGGTGTTGGGAGGGAAGAGGG - Intergenic
1167455210 19:49594269-49594291 ATGAATGAGGGGAGGGAAGGGGG - Intronic
1167565678 19:50255176-50255198 GTGGGTGGGTGGAGGGGAGATGG - Intronic
1167594376 19:50419413-50419435 GAGAGTGAGGGTGAGGCAGAAGG - Intronic
1167768149 19:51497879-51497901 GTGAGTGCGGGGTGGGGAGAGGG - Intronic
1167785201 19:51630276-51630298 GTGAGTGAGCTGAGGGAGGAGGG - Intronic
1167787300 19:51646700-51646722 GTGAGTGAGCTGAGGGAGGAGGG - Intronic
1168110201 19:54188173-54188195 GAGAGGGAGAGGAGGGGAGAGGG - Intronic
1168249742 19:55134838-55134860 GGAAGGGAGGGGAGGGGAGAGGG + Intronic
1168260240 19:55189469-55189491 GTGAGGAAGGGGAGGGCAGTGGG - Intronic
1168279051 19:55294248-55294270 GTGAGTGAGGGGCGGATAGAGGG + Intronic
1168447390 19:56432213-56432235 GTGAGTGACAGGAGGGCTTAAGG + Intronic
1168474957 19:56668899-56668921 GTGTGTAGGGGGAGGGCAGGTGG + Intronic
925149580 2:1606033-1606055 GTGTGGGAGGGGACGGCCGAGGG + Intergenic
925305960 2:2848646-2848668 GAGAGAGAGGGGATGGGAGAGGG - Intergenic
925425271 2:3744192-3744214 ATGAGAGAGGAGAAGGCAGATGG + Intronic
925546146 2:5018929-5018951 GTGAGTGTGGCGGGGCCAGAAGG - Intergenic
925933695 2:8732851-8732873 GGGAGTGAGGAGAGCGCAGGAGG - Intronic
926005968 2:9373657-9373679 GTGAGAGAGCGGAGGTCAGGAGG + Intronic
926061580 2:9808105-9808127 GTGAGTGAGAGTAGAGGAGAAGG - Intergenic
926099205 2:10103307-10103329 GTGGGTGTGGGGAGGGCACAGGG + Intergenic
926103644 2:10136860-10136882 GGGGGTGAGGGGTGGGTAGAAGG + Intergenic
926226853 2:10972955-10972977 ATGGGAGAGGGGAGTGCAGAGGG + Intergenic
926394860 2:12430452-12430474 GAGAGGGAGGGAAGGACAGAAGG + Intergenic
926646000 2:15290096-15290118 GGGAGAGAGGAGAGGGGAGAGGG + Intronic
926851398 2:17201720-17201742 ATGCTTGAGGGGAGGACAGATGG + Intergenic
927114248 2:19885909-19885931 GAGAGTGAGGGGAGAGAGGAAGG - Intergenic
927168725 2:20350829-20350851 GGGGGGGAGGGGAGGGCAGGCGG - Intronic
927599716 2:24430373-24430395 GGCAATGAGGGGAGGGGAGAGGG - Intergenic
927599725 2:24430397-24430419 GAGAGAGAGGAGAGGGGAGAAGG - Intergenic
927705471 2:25294040-25294062 GTGAGTGTGGGGAGGCCCAAAGG - Intronic
927738402 2:25544167-25544189 GTGAGTCAGGGGTGGGGACACGG + Intronic
927799324 2:26083423-26083445 TTGGGGGAGGGGAGGGAAGAGGG - Intronic
927980676 2:27373105-27373127 GTGAGTGAGGTGAGGCCAGCTGG + Intronic
928028251 2:27756999-27757021 GTGGGAAAGGGAAGGGCAGACGG + Intergenic
928407308 2:31024423-31024445 GGGAGTGAGGGGAGAGCAGTAGG - Intronic
928512447 2:32014040-32014062 GGGAGGGAGGGGAGGGAGGAAGG + Intronic
928737591 2:34310003-34310025 TGGAGTGGGGGGAGGGGAGAGGG + Intergenic
929045462 2:37784786-37784808 ATGAGTGTGGGGAGGAGAGAGGG - Intergenic
929093754 2:38244899-38244921 CTGAGAGAGGAGAGGGCAGAAGG + Intergenic
929278994 2:40057579-40057601 TGGGGTGGGGGGAGGGCAGAGGG + Intergenic
929456384 2:42069055-42069077 CTGAGTGCGGGGAGGGCTGGTGG - Intergenic
929918683 2:46156856-46156878 GTGTGTGGGAGGTGGGCAGATGG - Intronic
929968455 2:46552816-46552838 ATGAGTGGTGGGAGGGCAGTGGG + Intronic
930156407 2:48111719-48111741 GGGAGGGAGGGGAGGGCGCATGG - Intergenic
930199582 2:48540344-48540366 GTAAGTGAAAGGAGGGCAGAAGG - Intronic
930826350 2:55700343-55700365 GGGAGAGAGGGGAGGGGAGGGGG - Intergenic
931979740 2:67681837-67681859 GTGAGGCTGGGGAGGTCAGAAGG - Intergenic
932219223 2:69987147-69987169 CTGAGTGAGGGGAAGGCATTGGG + Intergenic
932284259 2:70519116-70519138 GTGCTAGAGGGCAGGGCAGAAGG + Intronic
932305117 2:70696432-70696454 GCAAGGAAGGGGAGGGCAGATGG - Intronic
932482642 2:72055974-72055996 GGGGGTGGGGGGAGGGGAGAAGG - Intergenic
932563489 2:72891657-72891679 GTGCCTGAGGGCAGGGCAGCAGG - Exonic
932571515 2:72940848-72940870 GTGAGAGAAGGGAGGTCCGATGG + Intergenic
932689066 2:73897070-73897092 GTGAGGGTGGGGAAGGCAGGGGG - Exonic
933081263 2:77989620-77989642 TGGGGTGAGGGGAGGGCGGAGGG - Intergenic
933246734 2:79984646-79984668 GTCAGTGTGCTGAGGGCAGAGGG + Intronic
933716162 2:85362394-85362416 GGGAGTGAGGGGAGGGTGTATGG + Intronic
934300672 2:91774381-91774403 CTGTGTGTGGGGAGGGCACAGGG + Intergenic
934692661 2:96373578-96373600 CTAGGAGAGGGGAGGGCAGAGGG + Exonic
934906973 2:98213542-98213564 GTGAGTGAGAGGTGAGGAGAAGG + Intronic
934998710 2:98989711-98989733 GGGAGAGAGGAGAGGGGAGAGGG + Intergenic
935422747 2:102886965-102886987 GGAAGGGAGGGGAGGGGAGAAGG - Intergenic
935422770 2:102887023-102887045 GGGAGGGAGGGGAGGGGGGAGGG - Intergenic
935422780 2:102887039-102887061 GGGACTGAGGGGAGGGGGGAGGG - Intergenic
935671077 2:105557687-105557709 GGGAGTGAGGGGAGAGGACAAGG - Intergenic
935867905 2:107411183-107411205 AGGAGCGAGGGGAGGGAAGAGGG - Intergenic
935951740 2:108335913-108335935 GTGAGTGAGGCCAGGGGAGTGGG - Intergenic
936038539 2:109130571-109130593 GCTAAGGAGGGGAGGGCAGAAGG + Intronic
936164371 2:110107068-110107090 GTGAGGGAGGGCAGGGTAGGGGG + Intronic
936240459 2:110783987-110784009 GTGAGTGAGGAGAGGGGATTGGG + Intronic
936913592 2:117617032-117617054 GTGAGAGAGAGAAGGGCTGATGG + Intergenic
936920735 2:117686092-117686114 GTGAGAGAGGAGAGGGCCCAGGG - Intergenic
937015723 2:118603498-118603520 GTGTGTGTGTTGAGGGCAGAGGG + Intergenic
937077871 2:119120106-119120128 ATGTGTCAGGGGAGAGCAGAAGG + Intergenic
937217237 2:120320589-120320611 GGGAGAGAGGGGTGGGGAGAGGG - Intergenic
937256781 2:120561296-120561318 GTCAATGAGGGCTGGGCAGAGGG - Intergenic
937312216 2:120909336-120909358 GTGGCTGAGGGAAGGGCAGCAGG - Intronic
937424786 2:121789818-121789840 GGAAGGGAGGGGAGGGGAGAGGG - Intergenic
937802963 2:126102263-126102285 GTGGGTGGGGGGAGGGGGGAGGG - Intergenic
937886254 2:126901703-126901725 GTGGGTCAGGGCAGGGCAGCAGG - Intronic
938004652 2:127778709-127778731 GTGAGGGAGGCAAGGGCAGGGGG + Intronic
938186935 2:129240200-129240222 GCTACTGAGGGGAGGGCAAAAGG + Intergenic
938235049 2:129699161-129699183 TTGTGGGAGGGGAGGGCAAAGGG + Intergenic
939010183 2:136837306-136837328 GTGAATGAGGTAAGTGCAGAAGG - Intronic
939166061 2:138642526-138642548 ATGAGGGAGGGGAGTGCACAGGG - Intergenic
939606603 2:144262633-144262655 GAGGGAGAGGGGAGGGGAGATGG + Intronic
940058070 2:149534475-149534497 GAGAGGGAGGGCAGGGGAGAAGG - Intergenic
940857942 2:158744333-158744355 GTAAGAGAGAGGAAGGCAGAAGG + Intergenic
941777669 2:169410268-169410290 GTGACAGAGGGGTGGGCTGAGGG + Intergenic
942210887 2:173668719-173668741 GGTTGGGAGGGGAGGGCAGAGGG + Intergenic
942376997 2:175347823-175347845 TTGAGACAGGGGAGGGCAGCTGG + Intergenic
942774490 2:179564871-179564893 GGGAGTGAGGTGAGGGGATAGGG - Intronic
943482016 2:188430637-188430659 CTGAGTGACAGAAGGGCAGAAGG - Intronic
944063968 2:195599862-195599884 GTCAGTGGGTGGAGGGCAAAGGG - Intronic
944108408 2:196104244-196104266 GTGAGTAAGAAGAGGGGAGAAGG + Intergenic
944277606 2:197856977-197856999 GAGAATGAGGGGTGGGAAGAGGG + Intronic
944652804 2:201848544-201848566 GGGAGTGTGGGGAGGGAAGATGG - Intronic
945896604 2:215489670-215489692 GTGAGACACTGGAGGGCAGAAGG + Intergenic
946040742 2:216781167-216781189 GAGAGGGAGGGGAGGGGAGGGGG - Intergenic
946160287 2:217831576-217831598 GGGAGTGAGAGGTGGGCAGGAGG + Intronic
946174274 2:217913044-217913066 CTGAGCGAGGGGAGAGCACAGGG - Intronic
946200527 2:218068476-218068498 GGGACGGAGGAGAGGGCAGACGG + Intronic
946229301 2:218281917-218281939 GTGAGTCCTGGAAGGGCAGATGG - Intronic
946279588 2:218657197-218657219 ATGAGTCAGGGGAGGTCAGCAGG - Intronic
946310186 2:218878964-218878986 GGGAGAGTGGGGAGGGCAGGGGG + Intergenic
947234303 2:227923608-227923630 ATGTTTGAGGGGACGGCAGAGGG + Intronic
947763901 2:232623797-232623819 GTGAGTGAAGGGAGGACAAGTGG + Intronic
948143103 2:235688821-235688843 GTGAATGAGGGGCGGGATGAGGG - Intronic
948371787 2:237494264-237494286 GCCAGAGAGTGGAGGGCAGAGGG + Intronic
948459850 2:238123823-238123845 GTGCGTGGGGGCCGGGCAGATGG + Intronic
948903636 2:240967879-240967901 GTGAGGCAGTGGGGGGCAGAAGG - Intronic
949049413 2:241888980-241889002 GTGAGTGGGGGGTGGGCACCTGG + Intergenic
1168960206 20:1863884-1863906 GTGAGACAGGGAAGGGAAGAAGG + Intergenic
1169870803 20:10246312-10246334 GTATGTGAGGTGAGGGGAGAAGG + Intronic
1170284287 20:14689054-14689076 GTGAGTGGGGGAAGCACAGAAGG - Intronic
1170315025 20:15032134-15032156 GGGAGTGAGGAGAGGCCGGAGGG + Intronic
1170465161 20:16616134-16616156 GTGAGTGATGAGGGGGTAGAAGG - Intergenic
1170747229 20:19111071-19111093 GTGTGTGTGGGGAGGGGGGAGGG + Intergenic
1170881043 20:20296515-20296537 TTGAGTGAGGGGAGGAAGGAAGG - Intronic
1170993069 20:21323022-21323044 GTGGGTGAAGGGAGAGGAGAGGG + Intronic
1171283902 20:23922396-23922418 GGGAGAGAGGTGAGGGGAGATGG - Intergenic
1171430836 20:25082298-25082320 GTGACTGAGGGGACTGCAGCTGG - Exonic
1171496651 20:25561026-25561048 GAGAGGGAGAGGAGGGGAGAGGG - Intronic
1172007433 20:31827014-31827036 TGGAGGGATGGGAGGGCAGAGGG - Intronic
1172207801 20:33176768-33176790 GTGAGTAAGGGGAGGGTACAGGG - Intronic
1172241005 20:33412457-33412479 GTGGGGGAAGAGAGGGCAGAGGG + Intronic
1172385993 20:34534609-34534631 ATGCCTGAGGGGAGAGCAGACGG - Exonic
1172639679 20:36433159-36433181 GTGAGCGAGGGAGGGGTAGATGG + Intronic
1172766751 20:37355224-37355246 GTGGGGGTGGGGAGGGCAGGAGG - Intronic
1172870899 20:38134981-38135003 GAGAGGAAGGGGAGGACAGAAGG - Intronic
1173168078 20:40700220-40700242 GTTAGTGAAGGGAGGATAGAGGG - Intergenic
1173305154 20:41841121-41841143 GGGAGGGAGGGAAGGACAGAGGG - Intergenic
1173305186 20:41841205-41841227 GGGAGAGAGGGAAGGGCGGAGGG - Intergenic
1173414603 20:42844679-42844701 GTGAGTCAGGAGAGGGGAGAGGG - Intronic
1173498008 20:43532953-43532975 GGGGGTGAGGGGATGGCAGGGGG + Intronic
1173524385 20:43720874-43720896 GTGAGTGCTGGGAGGGAAGATGG + Intergenic
1173546555 20:43902497-43902519 AAGAGTGAAGGGAAGGCAGAAGG - Intergenic
1173607400 20:44341323-44341345 CTGAGTGAAGGAAGGGCAGAGGG - Intronic
1173672224 20:44806575-44806597 GTGGGTTTGGGGAGGGGAGAAGG - Intronic
1173687408 20:44933186-44933208 GTGAGTGTGGGTAGGGCCAAGGG + Intronic
1173736810 20:45367643-45367665 GTCAGGGAGAGGATGGCAGATGG + Exonic
1173989811 20:47293226-47293248 GGGAGGGAGGGAAGGACAGAGGG + Intronic
1174045355 20:47729229-47729251 GTGACTGAGGGGAGACCAGGAGG + Intronic
1174298963 20:49568345-49568367 GGGAGGGAGGGGAGGGGAGAAGG + Intergenic
1174299011 20:49568468-49568490 GTGATGGAAGGGAGGGGAGAGGG + Intergenic
1174407139 20:50309936-50309958 GGGAGTGAGTGAGGGGCAGAGGG + Intergenic
1174489626 20:50883750-50883772 AGGAGTGAGTGGAGGGCAGCAGG + Intergenic
1175392478 20:58636000-58636022 GAGAGGGAGGGGAGGGAGGAAGG + Intergenic
1175436867 20:58958916-58958938 GTGAATGAGGTCAGGACAGAGGG + Intergenic
1175543344 20:59762055-59762077 GTCAGAGAGGAGAGGGAAGATGG + Intronic
1175616831 20:60407031-60407053 ATGAGTGATGGGAGGGCTCAGGG - Intergenic
1175748077 20:61475522-61475544 GAGAGGGAGGGGCGGGCAGGGGG - Intronic
1175748098 20:61475575-61475597 GAGAGGGAGGGGCGGGCAGGGGG - Intronic
1175926342 20:62473380-62473402 GTGAGTTCGGGCTGGGCAGAGGG - Intronic
1176002639 20:62839853-62839875 GTGTGTGCGTGGAGGGGAGAAGG - Intronic
1176058411 20:63161010-63161032 GTGACTGAGTGGGGGGCAGTGGG - Intergenic
1176125545 20:63473007-63473029 GAGGGGGAGGGGAGGGCAGGGGG + Intergenic
1176180292 20:63746700-63746722 GTGAGTTGGGGGAGGGCACAGGG - Exonic
1176513691 21:7767423-7767445 GGGAGGGAGGAGAGGGGAGAGGG - Intronic
1177207326 21:18024844-18024866 ATGAGTGGTGGGAGTGCAGAAGG - Intronic
1177833566 21:26167248-26167270 GGGAGTAAGGGGAGGGAGGAGGG + Intronic
1178130176 21:29563335-29563357 ATGAGTTAGGGGAGGACAGATGG + Intronic
1178647804 21:34397947-34397969 GGGAGGGAGGAGAGGGGAGAGGG - Intronic
1179452264 21:41474772-41474794 GTGAGTGAGGGGGTGGGTGAGGG + Intronic
1179452327 21:41474942-41474964 GTGAGTGAGGGGGTGGGTGAGGG + Intronic
1179452401 21:41475167-41475189 GTGAGTGAGGGGGTGACTGAGGG + Intronic
1179585418 21:42371159-42371181 GGGAGTGAGTGGTGGCCAGAGGG - Intergenic
1179585516 21:42371612-42371634 GGGAGTGAGTGGTGGCCAGAGGG - Intergenic
1179792658 21:43764478-43764500 GTGGGGGTGGGGACGGCAGATGG + Intergenic
1180092135 21:45538610-45538632 CACAGTGAGGGAAGGGCAGAGGG + Intronic
1180130074 21:45821500-45821522 ATGAGTTAGGGGAAGGCACAGGG - Intronic
1180488007 22:15819165-15819187 GTGAGTGTGTGGGGGGGAGAGGG + Intergenic
1180752007 22:18131011-18131033 GTGGGAGAGGGGATGGAAGAAGG + Exonic
1180799247 22:18624160-18624182 GTGAGTGAGGGCTGGGCCCAGGG + Intergenic
1180868431 22:19132975-19132997 GGGAGTGGGGGTAGGTCAGAGGG - Exonic
1181222471 22:21371106-21371128 GTGAGTGAGGGCTGGGCCCAGGG - Intergenic
1181588276 22:23866493-23866515 GTGAGTGAAGGGAAGCCACATGG - Intronic
1181688882 22:24547226-24547248 TTGAGAGAGGGGTGGGCAGCTGG + Intronic
1181699027 22:24609517-24609539 CTGTGTGTGGGGAGGGCACAGGG + Intronic
1182253165 22:29018071-29018093 GTGTGGGAGGGGAGGGCGGACGG + Intronic
1182579905 22:31300788-31300810 GTGAGTGAGGATAGGCTAGAAGG + Intergenic
1183003873 22:34883980-34884002 GCGATTGAGGGGAGAGCAGAAGG + Intergenic
1183080724 22:35454389-35454411 AAGAGAGAGGGGAGGGGAGAAGG - Intergenic
1183097540 22:35562205-35562227 GTGACTTAGGGAAAGGCAGAGGG + Intergenic
1183246983 22:36701527-36701549 GGGAGGGAGGGGAGGGCATGGGG - Intronic
1183385470 22:37511648-37511670 GGGTGTGAGGGGAGAGGAGAGGG + Intronic
1183404723 22:37624856-37624878 GTGTGTGAGGGGAAGGGAAAGGG - Intronic
1183466940 22:37984614-37984636 AGGAGGGAGGGAAGGGCAGAAGG + Intronic
1183739581 22:39662436-39662458 GTGAGTGGGGGCGGGGCCGAAGG + Intronic
1183774119 22:39951759-39951781 GTATTTGAGGGGAGGGGAGATGG - Intronic
1184056182 22:42051593-42051615 GTGAGTGAAGAGAGGGTATATGG + Intronic
1184286460 22:43474479-43474501 CTGAGAGAGGGGCGGGCAGGAGG - Intronic
1184286484 22:43474646-43474668 CTGAGAGAGGGGCGGGCAGGAGG - Intronic
1184509354 22:44924062-44924084 GGGAGGGAGGGGAGGGAAGAGGG + Intronic
1184509368 22:44924098-44924120 AGGAGGGAGGGGAGGGAAGAGGG + Intronic
1184742997 22:46439920-46439942 GTGAGGGGTGGGAGGGCGGACGG - Intronic
1184852342 22:47128055-47128077 ATGGGTGAGGGGAGGGGGGATGG - Intronic
1185119508 22:48957629-48957651 GGGAGTGGGAGGAGGACAGATGG - Intergenic
1185207896 22:49550654-49550676 GAGTGTGAGGTGAGGACAGAGGG - Intronic
1185233581 22:49698607-49698629 CAGAGTGAGGGGAGTGCTGAGGG + Intergenic
1185264942 22:49896397-49896419 GTGAGGGAGGAGAGGCCACATGG + Intergenic
1185294310 22:50045833-50045855 GTAAGTGAGGAGACGGCAGAGGG - Intronic
1185310613 22:50152249-50152271 GTCAGTGACAGGAGGGCAGAGGG + Intronic
1185398672 22:50605065-50605087 GTGAGTGAGAGGTGGGGAAAAGG + Intronic
949543128 3:5049770-5049792 GTGAGTGTGGGGAGACAAGAGGG + Intergenic
949614620 3:5739627-5739649 GGGAGAGAGGGGAGGGGAGGAGG - Intergenic
949646503 3:6101285-6101307 GTGGGTGGGGGGAGGGGGGAGGG - Intergenic
949690469 3:6631327-6631349 GAGAGTGAGAGAAGGTCAGAGGG - Intergenic
949787151 3:7754385-7754407 GTCAGTGTGGGGATGGCAGGTGG + Intergenic
949981109 3:9502140-9502162 TGGAGTGACGAGAGGGCAGAAGG + Exonic
950007020 3:9697976-9697998 CTGAGAGAGGGGAGGGCAGGAGG - Intronic
950016989 3:9761358-9761380 GGGAAGGAAGGGAGGGCAGAGGG + Intronic
950161434 3:10764038-10764060 GTGAGTGAGGGGAAGGCAACAGG - Intergenic
950454385 3:13083998-13084020 TGGACTGAGGGGAGGGCGGAAGG + Intergenic
950586863 3:13898623-13898645 GTGAGTGAGGGAAGAGCAGTTGG + Intergenic
950762756 3:15248025-15248047 TGGGGTGAGGGGAGGGGAGAGGG + Intronic
950919786 3:16682590-16682612 GTGGGTGGGGGGAGGGGGGAGGG + Intergenic
950922222 3:16705959-16705981 GTGAGTGAGGGGAGGCTGAAGGG - Intergenic
952192967 3:31043197-31043219 GTCAGGGAGGGGAGGGTGGAGGG - Intergenic
953207075 3:40840559-40840581 AGGAGTGAGAGGAGGGGAGAGGG + Intergenic
953636486 3:44669667-44669689 GTGAGTCCGGCGAGGGCAGAAGG - Intergenic
954051689 3:47984590-47984612 GGGAGGGTGGGGAGAGCAGATGG + Intronic
954132373 3:48567216-48567238 CTGAGGGAGGTCAGGGCAGAAGG - Intronic
954245154 3:49325644-49325666 GTGGCTGATGGGAGGGAAGAGGG - Intronic
954295255 3:49670922-49670944 GTGGGTAAGAGGAGAGCAGACGG - Exonic
954381491 3:50221351-50221373 GGGAGCTAGGGGAGGGCAGGGGG - Intergenic
954414346 3:50385681-50385703 GTGTGCCAGGGGTGGGCAGATGG - Intronic
954493187 3:50927225-50927247 GTCAGTGAGGGGAAGGAAGGAGG - Intronic
954628926 3:52037855-52037877 GGGAGTGATGGGAGGAGAGATGG - Intergenic
954659399 3:52218911-52218933 GTGGGTGGGGGGTGGGGAGATGG + Intergenic
954681554 3:52348818-52348840 GTGAATGAGCAGAGGGGAGATGG - Intronic
954812555 3:53256993-53257015 GGGAGGCAGAGGAGGGCAGATGG - Intergenic
954916147 3:54149973-54149995 GAGGGGGAGGGGAGGGAAGAAGG - Intronic
955036240 3:55270621-55270643 GGGGTTGAGGGGAGGGAAGAGGG + Intergenic
955422990 3:58758679-58758701 GTGGGTGAGGGGAAGGGGGAGGG - Intronic
955592371 3:60551536-60551558 GGGGGGGAGGGGAGGGGAGACGG + Intronic
955895039 3:63689890-63689912 TTGGGTGAGGGGAGGGGGGAGGG + Intergenic
956099521 3:65752895-65752917 GGGTGTGAGGGGAGGTCAGTGGG - Intronic
956447330 3:69338306-69338328 GTGAGTGGGGAGAGGGGGGAGGG + Intronic
957583349 3:82105026-82105048 GTGGGTGGGGGGAGGGGAGAGGG - Intergenic
959656200 3:108807871-108807893 GTGAAGGATGGGAGGGCAGCGGG + Intergenic
959993510 3:112655071-112655093 TTGAGAGAGGGTTGGGCAGAGGG - Intergenic
960255846 3:115510683-115510705 GTGGGTGTGGAGAGGGCAGTGGG + Intergenic
960288955 3:115861073-115861095 GAGAGGGAGGGGAGGAAAGAGGG - Intronic
960771297 3:121195430-121195452 GTGAAGCAGGGGAGGGGAGAAGG - Intronic
960844562 3:121994141-121994163 TTGGGATAGGGGAGGGCAGAGGG - Intronic
961083199 3:124043887-124043909 GTAAGTGAGGAGAGGAGAGAGGG + Intergenic
961395222 3:126582388-126582410 GTGAGTGACTCGAGAGCAGATGG + Intronic
961624853 3:128254771-128254793 CTGAGAGTGGGGAGGGGAGAGGG + Intronic
961626313 3:128266319-128266341 CTGAGTGAGGGAAGTGGAGAGGG + Intronic
961635778 3:128331447-128331469 CTGAGGAAGGGGAGGGAAGAGGG - Intronic
961849703 3:129803337-129803359 GAGAGTGAGGGGAGGGTAGAAGG + Intronic
961872229 3:129996832-129996854 GTGAATGAGGGGAGAGTAGGAGG - Intergenic
961909623 3:130301264-130301286 GTGGGGGCTGGGAGGGCAGAGGG + Intergenic
962073527 3:132056610-132056632 TTGGGTGAGGGGAGGGGGGAGGG - Intronic
962233485 3:133687195-133687217 TGGAGTGGGGGGAGGGGAGAGGG + Intergenic
962370897 3:134820043-134820065 GTGGGTGAGGGGAGGGGAAGGGG - Intronic
962403506 3:135081092-135081114 GTGAAGGAGGGGAGGGGAGGTGG + Intronic
962588219 3:136862851-136862873 GTGGGTGGGGGGAGGGGAGAGGG - Intronic
963136444 3:141909655-141909677 GTGAGCCAGGGGAGAGCAGTAGG + Intronic
963178225 3:142324237-142324259 GTGGGTGGGGGGAGGGGGGAGGG - Intronic
963497555 3:146085846-146085868 GTGAGGGAGGGGAGCCCAGAGGG - Intronic
963843623 3:150132777-150132799 GAGAGAGAGGGGAGGGAAGGGGG + Intergenic
963972545 3:151445532-151445554 CTGAGTAAAGGGAGGGGAGATGG + Exonic
964258666 3:154809074-154809096 GGGAGGGAGGGGAGGAGAGAGGG - Intergenic
964587572 3:158324373-158324395 TGGGGTGAGGGGAGGGCAGAGGG - Intronic
964727209 3:159825862-159825884 GTGACTCAGGTGAAGGCAGAGGG + Intronic
964877000 3:161378761-161378783 GTGACAGAGGGAAGGGGAGAGGG - Intergenic
965065185 3:163839317-163839339 GAGAGTGAGTGGAGTTCAGAAGG - Intergenic
965177981 3:165361089-165361111 GTGGGTGGGGGGAGGGGGGAGGG - Intergenic
965239756 3:166180316-166180338 GTGAGTGGGGGGAGAGGAAAAGG + Intergenic
965284225 3:166796576-166796598 TTGAGTGAGGGGAGAGTAGAGGG + Intergenic
966014339 3:175122700-175122722 GTGAGTGCAGTGAGGCCAGAGGG - Intronic
966140569 3:176752089-176752111 GGAAGGGAGGGGAGGGGAGAAGG + Intergenic
966140597 3:176752170-176752192 GGGAGGGAGGGGAGGGGAGGAGG + Intergenic
966837308 3:184059078-184059100 GTGAATGAGGAGTGGGCAAATGG - Intronic
967025626 3:185561454-185561476 GTGACGGAGGGGAGGCCAAAAGG + Intergenic
967072423 3:185973296-185973318 ATGAGGGAGGGGAGGGTAGTAGG + Intergenic
967195538 3:187022366-187022388 GAGGGTTAGGGGAGGGCTGAGGG + Intronic
967337071 3:188356450-188356472 TTGAGTGTGGGGTGGGCAGTGGG + Intronic
967350764 3:188511304-188511326 GGGAGAGAGGGGAGGGAGGAAGG - Intronic
967947897 3:194818587-194818609 GTGGGTGAGGAGAGGGGAGAGGG - Intergenic
968594032 4:1473215-1473237 GTGGGTAGGGGGAGGTCAGAAGG + Intergenic
968738009 4:2308514-2308536 GGGAGGGAGGGGAGGGGAGGGGG + Intronic
968833407 4:2945278-2945300 GTGTTTGCGGGGAGGGCATATGG - Intronic
968887348 4:3341656-3341678 GGGTGTGGGGGGAGGGGAGATGG + Intronic
968937125 4:3617298-3617320 GTGAGAGATGGGAGGGAAGAAGG - Intergenic
968937139 4:3617346-3617368 GGGAGGGAGGGGAGGGAAGGAGG - Intergenic
968937188 4:3617477-3617499 GGGAGGGATGGGAGGGAAGAAGG - Intergenic
968937225 4:3617573-3617595 AGGAGGGAGGGGAGGGAAGAAGG - Intergenic
969162533 4:5273841-5273863 GTGGGTGGGGGGAGGGGGGAGGG + Intronic
969450199 4:7268664-7268686 GTGAGTGAAGGGAGTGCCCAGGG + Intronic
969456696 4:7304346-7304368 AAGAGGGAGGGAAGGGCAGAAGG - Intronic
969510551 4:7615130-7615152 ATGAGTGAATGGATGGCAGATGG - Intronic
969577015 4:8042161-8042183 GTGAGAGACAGGAGGGCAGGAGG - Intronic
969591212 4:8122884-8122906 GTGGATGAGGGGATGGGAGAGGG + Intronic
969591816 4:8126438-8126460 GGGAGTGAGATGAGGGGAGAGGG - Intronic
969677119 4:8620286-8620308 GTGAGAGAGGGGACAGGAGAGGG - Intergenic
969678072 4:8625925-8625947 GTGAGAGAGGGGACAGGAGAGGG - Intergenic
969679027 4:8631562-8631584 GTGAGAGAGGGGACAGGAGAGGG - Intergenic
969729048 4:8942832-8942854 ATTAATGAGGGGAGCGCAGAAGG + Intergenic
969788637 4:9476774-9476796 ATTAGTGAGGGGAGCTCAGAAGG + Intergenic
970041180 4:11798589-11798611 GTGGGTGGGGGGAGGGGGGAGGG + Intergenic
970607247 4:17692209-17692231 GGGAGTGAGGGAAAGGCAGAAGG + Intronic
970637148 4:18021883-18021905 GAGGGGGAGGGCAGGGCAGAGGG - Intergenic
970827067 4:20288865-20288887 GTGAGAGAGAGAAGGGAAGAAGG + Intronic
971043431 4:22779211-22779233 GTGGGTGGGGGGGGGGTAGAGGG - Intergenic
971412093 4:26384913-26384935 AAGAGAGAGGGGAGGGGAGAGGG - Intronic
971412114 4:26384961-26384983 AGGAGAGAGGGGAGGGGAGAGGG - Intronic
972095918 4:35346866-35346888 GTGACTTTGGGGAGGGCAGAGGG - Intergenic
972296371 4:37743251-37743273 GTGAAGGAAGGGAGGGCAAAAGG + Intergenic
972415801 4:38839135-38839157 GGGAGGGAGGGGAGGGAAGGGGG + Intronic
972587263 4:40449353-40449375 ATGAGCGAGGGGTGGGCAGAAGG - Intronic
972621439 4:40751064-40751086 GTGAATGAGGGGAAGGGAGGAGG - Intronic
973210971 4:47615176-47615198 GTGAGTGATGGGAGACTAGAAGG + Intronic
973553214 4:52056138-52056160 AAGAGTGAGGAGAGGGCTGAGGG - Intronic
974144059 4:57924077-57924099 TGGAGTGGGGGGAGGGGAGAGGG + Intergenic
974459359 4:62167229-62167251 GTGGGTGGGGGGAGGGGGGAGGG - Intergenic
975244360 4:72102517-72102539 GTGGGTGGGGGGAGGGGGGAGGG - Intronic
975264397 4:72344686-72344708 GTGATTGAGTGGAGGGCCAAAGG - Intronic
975335844 4:73174076-73174098 GCGAGGGAAGGGAGGGGAGAAGG + Intronic
975529483 4:75385937-75385959 GTGAGTGAGGGAAAGGGAAAGGG + Intergenic
975572057 4:75827902-75827924 CTGAGAGACAGGAGGGCAGAAGG - Intergenic
975590516 4:75995158-75995180 GGGAGTGTGGGGTGAGCAGAGGG - Intergenic
975837627 4:78441328-78441350 TTGAGAGAAGGGAGGGGAGAGGG + Intronic
975933367 4:79553863-79553885 GTGAGGGAGGGAGGGACAGAGGG - Intergenic
976317974 4:83679952-83679974 GGGACTGAGGGGAGGGAAAATGG - Intergenic
976432623 4:84980831-84980853 ATGGGTGGGGGGAGGGGAGAGGG - Intergenic
976478329 4:85510572-85510594 GGGAGAGAGGGGAGGGAAGAAGG - Intronic
976675231 4:87695399-87695421 GGGAGGGAGGGGAGGGGAGATGG + Intergenic
976892550 4:90067781-90067803 GAGGGTGAGGGGTGGGCAAAGGG - Intergenic
977609024 4:99013726-99013748 GTTAGTGATGAGAGGTCAGAGGG + Intronic
977610051 4:99021807-99021829 GTTAGTGATGAGAGGTCAGAGGG + Intronic
977910291 4:102526341-102526363 GTGAGGGATGGGAGGGCAGTGGG + Intronic
978381749 4:108135830-108135852 GTGCGTGGGAGGAGAGCAGAAGG - Intronic
978533447 4:109737122-109737144 GTGAGAGAGGGTATGGAAGATGG - Intergenic
978728638 4:111999357-111999379 GGGAGGGAGGGGAGGGGAGGAGG + Intergenic
978781004 4:112554194-112554216 GTGGGTGGGGGGAGGGGGGAGGG - Intronic
978895760 4:113885460-113885482 GGGAGTGGGGGGAAGGAAGAAGG + Intergenic
979920958 4:126495535-126495557 GTGACAGAAGGCAGGGCAGAGGG - Intergenic
980085453 4:128385967-128385989 GTGGGTGAGGGGAGGAGTGAGGG + Intergenic
980216608 4:129859769-129859791 TGGGGTGAGGGGAGGGGAGAGGG + Intergenic
980344522 4:131596133-131596155 GGGAGGGAGGGAAGGGCGGAGGG - Intergenic
980538901 4:134166830-134166852 GTCAGTGAATGAAGGGCAGAGGG - Intergenic
981055042 4:140351703-140351725 TTGGCTGAGGGGACGGCAGATGG - Intronic
981093754 4:140758157-140758179 GTGGGAGACAGGAGGGCAGAAGG - Intergenic
981094002 4:140760209-140760231 GTGAGGGAGGGAGGGACAGAGGG - Intergenic
981532214 4:145763843-145763865 GAGGGGGAGGGGAGGGCAGAAGG - Intronic
981702499 4:147622180-147622202 GTGAGGCTGAGGAGGGCAGATGG - Intronic
982120690 4:152140302-152140324 GTGAGTTGGGGGAGGGGAGAGGG + Intergenic
982181307 4:152751011-152751033 GTGAGTGGGGGGAGGGAGGAGGG + Intronic
982881238 4:160719888-160719910 GGGAGGGAGGGGAGGGGAGGGGG - Intergenic
982941941 4:161570199-161570221 GTGAGTGAGTGAAGAGCAGGTGG + Intronic
983183942 4:164679685-164679707 GGGAGGGAGGGAAGGGGAGAAGG - Intergenic
983436474 4:167721867-167721889 GTAACTGAGGGCAGGGCAGTGGG - Intergenic
983455511 4:167958271-167958293 GAGAGTGAGGCGAGGGTAGGGGG + Intergenic
983860358 4:172698429-172698451 GAGACTGAGTGGAGGGTAGATGG - Intronic
983928616 4:173429615-173429637 GTTCGTGAGGGGTGAGCAGAAGG + Intergenic
984222459 4:176994712-176994734 GGGAGTGAGGGGAGGGGAGGGGG - Intergenic
984480708 4:180297663-180297685 GTGAGTGAGGTGAGGGATAAGGG + Intergenic
984703167 4:182831874-182831896 GAGAAGGAGGGGAGGGGAGAAGG - Intergenic
984703333 4:182832359-182832381 GAGAAGGAGGGGAGGGGAGAAGG - Intergenic
984902587 4:184598319-184598341 GTGAGGAAGGAGAGGGCTGATGG - Intergenic
984918415 4:184743475-184743497 TTGGGTGAGGGGAGGGCAGAGGG + Intergenic
984955578 4:185042437-185042459 GGTAGTGAGGGGAGAGCTGATGG + Intergenic
985446522 4:190023805-190023827 GGGAGGGAGGGAAGGACAGAGGG - Intergenic
985761518 5:1751546-1751568 GTGAGGGAGGGGAGGGCGAGGGG - Intergenic
985871949 5:2564143-2564165 TTGAGTTAGGCGAGGACAGAGGG + Intergenic
986134010 5:4957741-4957763 GTAAGTGGGGGGAAGGCAGTGGG + Intergenic
986256119 5:6102150-6102172 GTGAGGGAGGGAAGGAAAGAGGG + Intergenic
986350834 5:6878142-6878164 GTGAGTGCCTGGTGGGCAGAGGG + Intergenic
986574682 5:9199411-9199433 GGAAGAGCGGGGAGGGCAGAGGG - Intronic
986752579 5:10802181-10802203 GTGAGAGATGGGAGGGAGGAGGG - Intergenic
986775947 5:11013888-11013910 GTGAGAGAGGGGAGAGGGGAGGG - Intronic
986976746 5:13403390-13403412 GTGAATGAGAAGAGGGCACAGGG + Intergenic
987173318 5:15281471-15281493 GTGAGTGGGGGGTGGGAGGAGGG + Intergenic
987201389 5:15581359-15581381 GGGGGTGAGGGGTGGGGAGATGG - Intronic
987351467 5:17025896-17025918 TTGGGGGAGGGGAGGGGAGAGGG + Intergenic
987435786 5:17892595-17892617 GTGTGTGAGGGGAGAGGAAACGG + Intergenic
987494592 5:18627452-18627474 TTGGGTGTGGGGAGGGGAGAGGG + Intergenic
987520051 5:18970164-18970186 AGCAGTGAGGTGAGGGCAGAGGG + Intergenic
987699404 5:21376531-21376553 GTGGGTGGGGGGAGGGGGGAGGG + Intergenic
987764036 5:22202103-22202125 GAGAGGGAGGGAGGGGCAGAGGG - Intronic
988099988 5:26662839-26662861 GTCAGAGAGGGGATGGCAGTAGG + Intergenic
988121517 5:26968913-26968935 TTCAGTGAGGTGAGGACAGATGG - Intronic
988519950 5:31936957-31936979 TGGAGTGGGGGGAGTGCAGAGGG + Intronic
988963362 5:36391424-36391446 GTGCGTGAGGAGAGGGAAAAAGG + Intergenic
990151271 5:52820372-52820394 GTGGGTGGGGGGAGGGGGGAGGG + Intronic
990159696 5:52924047-52924069 TGGAGTGAGGGGAGAGAAGAGGG + Intronic
991574687 5:68090674-68090696 GTGTGTGGGGGGTGGGCAGAGGG - Intergenic
991898761 5:71435181-71435203 GAGAGGGAGGGAGGGGCAGAGGG - Intergenic
991915040 5:71597266-71597288 GGGAGTGAGGGGAGAGGAGTAGG + Intronic
992024131 5:72654130-72654152 GGGAGAAAGGGGAGGGCAGAAGG - Intergenic
992521129 5:77552668-77552690 GAGAGTGTGGTGTGGGCAGAGGG + Intronic
993701851 5:91128081-91128103 GAGAGGGAGGGGAGGGCATTGGG - Intronic
993887139 5:93427926-93427948 GAGAGAGAGGTGAGGGGAGAGGG + Intergenic
994860616 5:105187692-105187714 TGGGGTGGGGGGAGGGCAGAAGG + Intergenic
994985357 5:106926526-106926548 CTGAGAGACAGGAGGGCAGAAGG - Intergenic
995008016 5:107225103-107225125 TTGAGTGAGTATAGGGCAGATGG - Intergenic
995294419 5:110502672-110502694 GTGAGTGAGGGGAAAGTGGAAGG - Intronic
995365274 5:111352669-111352691 GGGAGGGAGGGAAGGGGAGAGGG + Intronic
995492555 5:112708005-112708027 GGGAGTGCGGGGAGGGGAGAGGG - Intronic
996136390 5:119847572-119847594 TGGGGTGAGGGGAGGGGAGAGGG - Intergenic
996360620 5:122641443-122641465 GTGTGTGTGGGGAGGGGAGGGGG - Intergenic
996457248 5:123698962-123698984 GTCAGGGAGGTGAGGGCAGGGGG - Intergenic
996801303 5:127406575-127406597 ATCAGTGAGGTTAGGGCAGAGGG + Intronic
996924803 5:128811883-128811905 GGGAGGGAGGGGAGGGAGGAAGG - Intronic
997362009 5:133301149-133301171 GTGACTCTGGGGTGGGCAGAGGG - Intronic
997763339 5:136472441-136472463 GGGAGGGAGGGAAGGGAAGAAGG - Intergenic
997983275 5:138483730-138483752 GGGGGTGAGGGTAGGGAAGAGGG - Intergenic
998028018 5:138837507-138837529 GAGAGGGAGGGGAGGGAGGAGGG - Intronic
998169803 5:139865873-139865895 GTAAGTGGGGTGAGGGAAGATGG + Intronic
998368896 5:141648917-141648939 ATGAGTGGGGGCAGGGAAGAGGG - Intronic
998566209 5:143217960-143217982 GAGGGTGAGAGGAGGTCAGAGGG - Intronic
998662110 5:144250389-144250411 GTGAGTATGGGGAGGGAAGTGGG + Intronic
998729923 5:145062923-145062945 CTGTGTGTGGGGAGGGCAGTGGG + Intergenic
999193237 5:149764207-149764229 GTCATTGATAGGAGGGCAGAGGG + Intronic
999230948 5:150061468-150061490 GTGAGTGAGGGGAGGGGATGAGG - Intronic
999326509 5:150647575-150647597 GTGAGAGAGGAGAAGGCAGTGGG + Intronic
999484574 5:151983115-151983137 GTGGGTGGGGGGAGGGGGGAGGG - Intergenic
999569001 5:152897521-152897543 GGGAGTGAGGGTAAAGCAGAAGG + Intergenic
999663374 5:153888657-153888679 GTGAGAGTGGGGAGGCCAGTAGG + Intergenic
1001003777 5:168031698-168031720 GGGAGGGAGGGGAGGGAGGAAGG + Intronic
1001046292 5:168374553-168374575 ATGAGTGAGGAGAGGGGAGAAGG + Intronic
1001058622 5:168469687-168469709 ATGAGTGAGGGGAGGGCTGTGGG + Intronic
1001231672 5:169994086-169994108 GTGGGTGTAGGGAGGGCAGGTGG + Intronic
1001273040 5:170330044-170330066 GTCAGTGAGGGGTGGGTAGGGGG + Intergenic
1001305720 5:170571147-170571169 GTGAGTGAGGACCGGGCAGATGG - Intronic
1001403663 5:171461193-171461215 GTGGGGAAGGGGAGGGCAGTGGG + Intergenic
1001527567 5:172439741-172439763 ATGAGTTAGGGGAGCCCAGAGGG - Intronic
1001667367 5:173444527-173444549 GTGATTGAGAGCAGGGCAGAGGG + Intergenic
1002040840 5:176513017-176513039 GACAGGCAGGGGAGGGCAGAAGG - Intergenic
1002073610 5:176695328-176695350 AGAAGGGAGGGGAGGGCAGAGGG + Intergenic
1002198645 5:177514531-177514553 GTTAGTTGGGGGAGGACAGAGGG - Intronic
1002453518 5:179332682-179332704 TGCAGAGAGGGGAGGGCAGAGGG + Intronic
1002636103 5:180609586-180609608 GTCAGTGAGCGCTGGGCAGAGGG - Intronic
1002807122 6:587963-587985 GTGAGGGAGGGGAGAGAAGCAGG + Intronic
1002893788 6:1362107-1362129 GTGGGTGGGGGGAGGGGGGAGGG + Intergenic
1003064864 6:2895257-2895279 GTGGGTGAGGAGAGGGAGGAGGG + Intronic
1003281500 6:4696115-4696137 GTGGCTGAGGGGAGGGGAGATGG + Intergenic
1003576080 6:7296666-7296688 GTGAGTGAGGGAAGGAAAGGAGG + Intronic
1003576087 6:7296692-7296714 GTGAGTGAGGGAAGGAAAGGAGG + Intronic
1003580765 6:7338849-7338871 GTGACTGAGGGCACGGCAGGAGG + Intronic
1003975165 6:11336078-11336100 CTGAGGGAGGTGAGGGCAGGAGG - Intronic
1003985578 6:11431490-11431512 GTGAGGGAGAGGAGGGCATTGGG - Intergenic
1004030026 6:11859411-11859433 GTGAGAGAGGGGAGAGTGGAGGG + Intergenic
1004250784 6:14021726-14021748 GAGGGGGAGGGGAGGGAAGAAGG - Intergenic
1004254524 6:14050723-14050745 GTGAATGAGGGGAGCTGAGATGG + Intergenic
1004275255 6:14230331-14230353 GGGAGGGAGGGAAGGGAAGAAGG - Intergenic
1004447058 6:15710145-15710167 GTGAGGGAGGGGAGGGAGGGAGG - Intergenic
1005207972 6:23426856-23426878 GTGGGTGAGGGGATAGGAGAGGG - Intergenic
1005331327 6:24753299-24753321 GTGGGAGATGGGAAGGCAGAAGG - Intergenic
1005402652 6:25450763-25450785 GGGAGGGAGGGGAGGGAGGAAGG - Intronic
1006326283 6:33356407-33356429 GTGACGGAGGGGAGGCCAAAAGG + Intergenic
1006384195 6:33720122-33720144 ATGGGTGAGGGGAGGGCGGGTGG - Intergenic
1006403287 6:33830044-33830066 GTGAGGGAGGGGAGGAGACAAGG - Intergenic
1006412154 6:33880269-33880291 GGGAGAGAGGGTAGGGGAGAGGG - Intergenic
1006412164 6:33880295-33880317 GAGAGTGAGGGTAGGGGAGAGGG - Intergenic
1006415559 6:33901767-33901789 GGGAGGGAGGTGAGGGCAGAAGG + Intergenic
1006449681 6:34098918-34098940 GGGAGGGAGGGAAGGGCAGCTGG - Intronic
1006459558 6:34150484-34150506 GTGGCTGGGGGGTGGGCAGAAGG + Intronic
1006510801 6:34520083-34520105 GTGAGTGATGGGAGGGAGGATGG + Intronic
1006630100 6:35424780-35424802 GTGAGTGAGAGTGGGGCAGGTGG + Intronic
1006654892 6:35582471-35582493 GTGAGTGGAGAGAGGGCAGAGGG - Intronic
1006699754 6:35962484-35962506 CTGAGGAAGGGGAGGGCAGAGGG - Intronic
1007018198 6:38490723-38490745 GTCAGTGAGAAGAGGGAAGAAGG + Intronic
1007102876 6:39262053-39262075 GGGAGAGAGGGCTGGGCAGAGGG - Intergenic
1007224418 6:40302863-40302885 CTGTGTGAGGGGAGGGCTGGTGG + Intergenic
1007260544 6:40559974-40559996 GTGAGGCAGGTGTGGGCAGATGG - Intronic
1007352477 6:41283956-41283978 GTGAGTGGGAGGAAGGAAGAGGG + Intronic
1007388041 6:41532433-41532455 GGGAGTGAGGCGGGGGCAGGAGG + Intergenic
1007622335 6:43222732-43222754 GGGAATGAGGAGAGGGCAGGCGG + Intronic
1007830453 6:44634428-44634450 GTGAGTGAGGCAGAGGCAGATGG + Intergenic
1008018474 6:46548288-46548310 GTGAGAGCTGGGAGGGTAGAAGG - Intergenic
1008153581 6:47987250-47987272 GTGGGTGGGGGGAGGGGGGAAGG + Intronic
1008306399 6:49906734-49906756 GTGAGTGAGAGCTGAGCAGATGG + Intergenic
1009826701 6:68875236-68875258 GGAGGGGAGGGGAGGGCAGAGGG - Intronic
1009843396 6:69105719-69105741 GAAATTGAGGGCAGGGCAGATGG + Intronic
1010741550 6:79511457-79511479 GTTAGTGAGGGGAAGGCAGGAGG + Intronic
1010779039 6:79922254-79922276 GAGAGGGAGGTGAGGGGAGAGGG - Intronic
1010813541 6:80327912-80327934 GGGAGGGAGGGGAGGGGAGAAGG - Intronic
1010921302 6:81684341-81684363 GTGGGTGTGGGGAGGGTAGTGGG - Intronic
1011093598 6:83633951-83633973 GTGGGTGGGGGGAGGGCGGAGGG + Intronic
1011265662 6:85515507-85515529 GAGAAAGAGGGGAGGGGAGAGGG + Intronic
1011488627 6:87868760-87868782 CTGGGTGAGAGGAGGGAAGAAGG - Intergenic
1011755468 6:90494338-90494360 GAGAGTGTGAGGTGGGCAGAGGG - Intergenic
1012382803 6:98640473-98640495 GCAAGTGGGGGGCGGGCAGAGGG - Intergenic
1012454847 6:99392527-99392549 GTGTGTAGGTGGAGGGCAGAAGG - Intronic
1013629037 6:111967342-111967364 GTGAAGGATGGGAGAGCAGACGG - Intergenic
1014622688 6:123688582-123688604 GTGGGTGAAGGGTGGGAAGAGGG + Intergenic
1014878707 6:126694651-126694673 GAGAGAGAGTGGAGGGGAGAGGG + Intergenic
1015181618 6:130366605-130366627 GGAGGGGAGGGGAGGGCAGAGGG - Intronic
1015702431 6:136051121-136051143 GTGAGTGAGGGGAGTGGGGGCGG + Intronic
1016089692 6:139961440-139961462 GAGAGTGAGAGGAAGGGAGAAGG + Intergenic
1016350350 6:143160114-143160136 TTGAGGGAGGGAAGGACAGAGGG - Intronic
1016546423 6:145229267-145229289 GTGGGAGAGGGGAGGGGAGGAGG - Intergenic
1016597017 6:145814580-145814602 GTGAGTGACGGGAGGCCCGCAGG - Intronic
1016979915 6:149844439-149844461 GTGAATGTTGGGAGAGCAGAGGG - Intronic
1017063195 6:150505977-150505999 GTGAGGGAGGGGAGGGGAAATGG + Intergenic
1017081490 6:150673651-150673673 GAGAGGGAGGGGAGGGAAGAGGG - Intronic
1017085161 6:150706899-150706921 TTTGGTGAGGGGAGGGAAGAAGG - Intronic
1017286264 6:152680157-152680179 GTGTGTGAGGGGAGGGGAGATGG - Intergenic
1017767166 6:157616286-157616308 GTGAGGGATGAGGGGGCAGAGGG + Intronic
1017865738 6:158441760-158441782 GTGTGTGTGGGAAGGGAAGATGG - Intronic
1018170377 6:161139403-161139425 GTGGGTGAGTGGAGGGCAAGGGG - Exonic
1018890132 6:167977067-167977089 CTGAGTGGGGGGAGGGAGGAGGG + Intergenic
1019223704 6:170494223-170494245 GAGAATGAGGAGAGGGCAGATGG - Intergenic
1019508412 7:1404943-1404965 GAGAGGGAGGAGAGGGAAGAGGG + Intergenic
1019776006 7:2912651-2912673 GTGGGTGAGGGGTCGGTAGATGG - Intronic
1019935008 7:4249091-4249113 GTGAGTGTGGGGAGGGAGGGAGG + Intronic
1020861408 7:13496524-13496546 GTGAGTGATGGAAAGGCAGATGG - Intergenic
1021362561 7:19733915-19733937 GTGAGTGAAGGTGGGGCTGAAGG - Intronic
1021513481 7:21458780-21458802 GTGTGTGGGGGGAGGGGAGCGGG - Intronic
1021866375 7:24962388-24962410 AGGGGGGAGGGGAGGGCAGAAGG + Intronic
1022327658 7:29346538-29346560 CTGGGAGAGGGGATGGCAGAGGG + Intronic
1022410033 7:30132349-30132371 TGGAGAGAGGGGAGGGTAGAGGG + Intergenic
1022417366 7:30189777-30189799 CTGAGAGACAGGAGGGCAGAAGG - Intergenic
1022509463 7:30925938-30925960 GTGAGTGGAGGGAGGGAGGAAGG - Intergenic
1022607209 7:31827266-31827288 GTGAGCTAGGGGTGGGTAGAAGG - Intronic
1022694974 7:32696105-32696127 TGGAGTGAGGGGAGGGGGGAGGG - Intergenic
1023136371 7:37056735-37056757 GTGATGGTGGGGAGGGCAGGGGG + Intronic
1023384755 7:39645306-39645328 GTGTGGGAGGTGGGGGCAGAAGG + Intronic
1023873453 7:44274832-44274854 GTGAGTGAGGATTGGGGAGATGG - Intronic
1023917019 7:44597121-44597143 GAGAGTGAGGGAAGGGAGGAGGG + Intergenic
1023982715 7:45079161-45079183 GAGAGTGAGGGGACATCAGAAGG + Intergenic
1024072563 7:45798749-45798771 ATGAGAGAGGGGAGGGAAGGGGG + Intergenic
1024229910 7:47355870-47355892 ATGAGGGAGGGGAAGGAAGATGG + Intronic
1024512176 7:50212885-50212907 GGGAGGGTGGGTAGGGCAGATGG + Intergenic
1024570908 7:50722206-50722228 ATGAGAGTGGGCAGGGCAGAGGG - Intronic
1024728501 7:52228720-52228742 GTGGGTGTGGGAAGGGGAGAGGG + Intergenic
1025018835 7:55464698-55464720 GTCAGTCAGGGGATGTCAGAGGG + Intronic
1025147042 7:56514175-56514197 GGGAGGGAGGGAAGGACAGAGGG - Intergenic
1026308739 7:69166085-69166107 GTGGGGGAGGGGAGGGGGGAGGG + Intergenic
1026315991 7:69228055-69228077 TGGACTGAGGGGAGGGTAGATGG + Intergenic
1026414432 7:70163343-70163365 GTGGGGGGGGGGGGGGCAGAGGG + Intronic
1026539025 7:71264129-71264151 GAGAGTGAGGGGAGAGCATGTGG + Intronic
1026774680 7:73223957-73223979 GTGAGTGTGGGGACGGAGGAGGG + Intergenic
1026921313 7:74157739-74157761 GGGAGGGAGGGTAGGGGAGAGGG - Intergenic
1027015539 7:74777348-74777370 GTGAGTGTGGGGATGGAGGAGGG + Intronic
1027072493 7:75168609-75168631 GTGAGTGTGGGGACGGAGGAGGG - Intergenic
1027127269 7:75565665-75565687 GTGAGAGTTGGGAGGACAGAGGG - Intronic
1027134990 7:75617706-75617728 GTGGGTGAGAGGAGGGCATATGG - Intronic
1027345826 7:77258343-77258365 TTGAGGGATGGGTGGGCAGACGG + Intronic
1027427465 7:78075776-78075798 GTGACTGATGGGTGGGCAGATGG - Intronic
1027988658 7:85329858-85329880 GTGGGTGGGGGGAGGGTGGAGGG - Intergenic
1028424982 7:90676453-90676475 GTGAGGGAGGAGAGGGTAGTAGG + Intronic
1028454722 7:91026637-91026659 GTGAGGGAGGGGAGAGACGATGG - Intronic
1028740720 7:94271263-94271285 GTGGGTGAGGGGAGAGGGGAGGG + Intergenic
1028806259 7:95029531-95029553 GTGAATGAAGGGAGCCCAGAAGG + Intronic
1028821319 7:95215112-95215134 GTGGGTGGGGGGAGGGGGGAGGG - Intronic
1029425057 7:100489667-100489689 GTGAGTGAGGGGTGGGGAGTGGG + Intronic
1029433079 7:100544754-100544776 ATGAGAGAGGTGAGGGCAGAGGG + Intronic
1029546166 7:101211729-101211751 GGGGGTGAGGGCTGGGCAGACGG + Intronic
1029930533 7:104365843-104365865 GTGTGGGCGGGGAGGGGAGATGG + Intronic
1030088133 7:105834849-105834871 GTGATGGAGTGGAGGGGAGAGGG + Intronic
1030273257 7:107692687-107692709 GTGAGTCAGTGGAAGTCAGATGG - Intronic
1030288116 7:107847510-107847532 GGGAGTGGGGAGAGGGGAGAGGG - Intergenic
1030496889 7:110311695-110311717 GTGAGGGAGAGGAGGACAGTAGG - Intergenic
1030614330 7:111722562-111722584 GAGAGTGAGGGGAGGGAGAATGG + Intergenic
1031481046 7:122279055-122279077 GTGGGTGGGGGGAGGGGGGAGGG - Intergenic
1031542608 7:123013323-123013345 GTGGGTGAAGGGAGGGAAGAAGG - Intergenic
1031966377 7:128031027-128031049 GTGGGGGCGGGGAGGGCAGAGGG + Exonic
1032355970 7:131210748-131210770 GGGAGGGAGGGGAGGGGGGAGGG + Intronic
1032465938 7:132145096-132145118 GTGAGTGAAGGGAGGGCAGGGGG - Intronic
1032530511 7:132615854-132615876 GGGAGAGAGGAGAGGGGAGAGGG - Intronic
1032629333 7:133630396-133630418 GGGAGGGAGGGAAGGGAAGAGGG - Intronic
1032898341 7:136277627-136277649 GGGGGTGAGGGGAGGGCTGGTGG + Intergenic
1032954210 7:136951568-136951590 GGGAGTGAGGGGTTGGCATATGG + Intronic
1033207594 7:139436309-139436331 GACAGTGGGGGAAGGGCAGACGG - Intergenic
1033242308 7:139690282-139690304 CAGAGTCAGGGGAGGGCAGAGGG + Intronic
1033275306 7:139967214-139967236 GGGAGGAAGGAGAGGGCAGAAGG - Intronic
1033320041 7:140331174-140331196 GTCTGTGTGGGGAGGGGAGAAGG + Intronic
1033363140 7:140652054-140652076 GTGAGTGTGGGGTGGGAAGAGGG + Intronic
1034090173 7:148356748-148356770 CTGACTGAGGTGATGGCAGAAGG - Intronic
1034547854 7:151800670-151800692 GGGAGGGAGGGAAGGGCAGGTGG + Intronic
1035058208 7:156050902-156050924 GTGGGTGAGGGGAGGGCTCCAGG - Intergenic
1035174025 7:157037733-157037755 GGGAGAGGGGAGAGGGCAGAGGG + Intergenic
1035196647 7:157227278-157227300 GTGGGTGAGGGGAGCTCCGAGGG + Intronic
1035278130 7:157760132-157760154 GTGGGTGATGTGGGGGCAGAAGG - Intronic
1035599892 8:891180-891202 GTGATTGAGGGCATGGCTGAAGG + Intergenic
1035657363 8:1320119-1320141 GTGAGGAAGAGGAGGGCTGAAGG + Intergenic
1035740455 8:1924242-1924264 CTCAGTGAGGGGTGAGCAGAAGG - Intronic
1035922310 8:3690981-3691003 GTGAGGGTGGGGAGTGCTGACGG + Intronic
1036400058 8:8400114-8400136 GAGAGAGAGAGGAGGGGAGAAGG - Intergenic
1036912018 8:12765601-12765623 GGGCGAGAGAGGAGGGCAGAAGG - Intergenic
1037062542 8:14532706-14532728 GTGTGTGGGGGGAGGGCGGGGGG + Intronic
1037339813 8:17832270-17832292 GGGAGGGAGGGAAGGACAGAAGG + Intergenic
1037556057 8:20023667-20023689 GTGAGTCATGGGGGGCCAGAGGG + Intergenic
1037627723 8:20622625-20622647 ATGAGTGAGAGGATGGGAGATGG + Intergenic
1037767439 8:21780778-21780800 GTGACTGATGGGAGAGGAGAAGG - Intronic
1037886591 8:22599224-22599246 GAGAGGGTGGGGAGGGGAGAGGG - Intronic
1037935306 8:22911476-22911498 GTGGGTGAGGGGTGGAGAGAAGG - Intronic
1037964533 8:23123794-23123816 GTGCGTGAAGGAAGGACAGACGG + Intergenic
1038008773 8:23457515-23457537 GTGGGTGAGGGGAGGGCGGGCGG - Intronic
1038067074 8:23974369-23974391 GTGGGGGAGGGGAGGGAGGAGGG + Intergenic
1038588765 8:28816294-28816316 GTGGGTGGGGGGAGGGGGGAGGG - Intronic
1038786476 8:30622114-30622136 GTGGGTGGGGGGAGGGGGGAGGG - Intronic
1038860913 8:31388029-31388051 GAGAGGGAGGGGAGAGGAGAGGG - Intergenic
1038916619 8:32031435-32031457 GCCCGTGCGGGGAGGGCAGATGG - Intronic
1039332269 8:36551270-36551292 GTGGGTGAGGGAAGGGGAGCAGG - Intergenic
1039923344 8:41908122-41908144 GTGAACAAGGGCAGGGCAGAGGG - Intergenic
1040049516 8:42999044-42999066 GGGAGTGAGGGAAGGGCATGTGG + Intronic
1040479311 8:47809139-47809161 GAGGGGGAGGGGAGGGGAGAAGG + Intronic
1040493126 8:47942902-47942924 GAGAGTGGGTGGAGGGCTGAGGG - Intronic
1040531244 8:48268115-48268137 GGGAATGAGGAGAGGCCAGAAGG - Intergenic
1040891938 8:52326266-52326288 GTGGGGAAGGGGAGGACAGAGGG + Intronic
1041153663 8:54961855-54961877 GTTGGTGAGGGGAGAGGAGAAGG + Intergenic
1041230738 8:55748556-55748578 GGGAGGGAGGGGAGGGAGGAAGG + Intronic
1041274815 8:56146292-56146314 TTGAGTGGGGGGAGGGCGGAGGG - Intergenic
1041293068 8:56325781-56325803 GTGAGTGAGGGCAGGAAGGAGGG - Intergenic
1041540547 8:58980253-58980275 GTGGGAGAGGGGAGAGAAGATGG - Intronic
1042081151 8:65052927-65052949 CTTAGGGAGGGGAGGGAAGATGG - Intergenic
1042130498 8:65582779-65582801 GAGGGGGAGGGGAGGGGAGAGGG + Intergenic
1042253717 8:66781938-66781960 ATGTGTGAGGGGAGGGGAGAAGG + Intronic
1043202068 8:77382846-77382868 GTGGGTGGGGGGAGGGGGGAGGG - Intergenic
1043439084 8:80260983-80261005 GGGAGTGAGAGGAGAGGAGAGGG - Intergenic
1043516170 8:80996792-80996814 TTGAGTGAGGGGAAGGTGGAGGG + Intronic
1043961799 8:86424856-86424878 GAGGGGGAGGGGAGGGGAGAGGG + Intronic
1044945282 8:97383578-97383600 GAGAGTGAGGGGTGCCCAGAAGG + Intergenic
1045165007 8:99593915-99593937 GTGAGGGAGGGGTGGAGAGATGG + Intronic
1045258811 8:100553293-100553315 AAGACTGAGGAGAGGGCAGAGGG + Intronic
1045325293 8:101113134-101113156 GTGAGTGAGGTGTGAGGAGAGGG + Intergenic
1045881521 8:107045958-107045980 GAGAGGGAGGGGAAAGCAGAGGG + Intergenic
1046130103 8:109956117-109956139 CTGAGTGGGGGGAGGGGGGAGGG - Intergenic
1046323226 8:112605617-112605639 GTGAAGGGTGGGAGGGCAGAGGG + Intronic
1046449959 8:114375904-114375926 GTGAGGGAGTGGGGGGGAGAAGG - Intergenic
1046555414 8:115768175-115768197 GTGACGGAGGGAAGGGAAGAAGG - Intronic
1046555509 8:115768536-115768558 GGGAGGGAGGGAAGGGAAGAAGG - Intronic
1046738598 8:117804684-117804706 GTGAGTGAAGCAAGGGAAGAGGG + Intronic
1046829633 8:118730340-118730362 GTGAGGGTGGGGAAGGGAGATGG - Intergenic
1046911164 8:119628776-119628798 GAGAGACAGGGTAGGGCAGAAGG + Intronic
1046974369 8:120257450-120257472 GTGAGTGTGGGGGTGGCAGTAGG + Intronic
1046994083 8:120496254-120496276 GTGAGTGATGGGAAGGAAGAGGG + Intronic
1047060188 8:121216658-121216680 GAGAGAGAGAGGAGGGCAGAGGG + Intergenic
1047300772 8:123612100-123612122 GGGAGAGAGGGGAGGGGAGGGGG - Intergenic
1047442787 8:124893448-124893470 GTGAGTGTGGGGAAGGCTGGTGG + Intergenic
1047676633 8:127209562-127209584 GGGAGGGTGGGGAGGGAAGATGG + Intergenic
1047846697 8:128813960-128813982 GAGTGTGAAGGGAGGACAGAGGG - Intergenic
1047907977 8:129493178-129493200 GTGTGGGAGGGGAGGACAAAGGG + Intergenic
1048314160 8:133349942-133349964 GTGAGATATGGTAGGGCAGAGGG + Intergenic
1049150524 8:141032405-141032427 GTGAGGCAGGGGATGTCAGATGG - Intergenic
1049159373 8:141087506-141087528 GTGAATGTGGGGAGAGCAGTCGG + Intergenic
1049384161 8:142332708-142332730 CTGACTGAGGGGTGGACAGAGGG - Intronic
1049465808 8:142750803-142750825 GGAAGGAAGGGGAGGGCAGAGGG + Intronic
1049522199 8:143098406-143098428 GAGAGTGTGGGGTTGGCAGAGGG + Intergenic
1049578822 8:143401584-143401606 GGAGGGGAGGGGAGGGCAGAGGG + Intergenic
1049737698 8:144218674-144218696 AGGAGAGAGGGGAGGGGAGAGGG - Intronic
1050511206 9:6397519-6397541 GGGAGGGAGGGAAGGGAAGAAGG + Intergenic
1050513052 9:6413983-6414005 CAGAGGGCGGGGAGGGCAGAGGG + Intronic
1050612153 9:7364174-7364196 GTGTTGGAGGGGAAGGCAGAGGG - Intergenic
1051459321 9:17294773-17294795 GGGAGTGAGGGGAGGGAGGGGGG + Intronic
1051459387 9:17294894-17294916 GGGAGTGGGGGGAGGGCGGGGGG + Intronic
1051705068 9:19869475-19869497 GTTAGTGAAGGGAAAGCAGAAGG - Intergenic
1051718076 9:20006331-20006353 GTGGGTGAGGGGAGGGGGGATGG + Intergenic
1052119775 9:24698289-24698311 GAGAGTGAAGGGTGGGAAGAGGG + Intergenic
1052315633 9:27113819-27113841 ATAAGTGAGGGGAGGGTAGATGG - Intronic
1052458620 9:28733543-28733565 GTGAGACAGGGTAGAGCAGATGG - Intergenic
1052564427 9:30129311-30129333 GAGATTAAGGGGAGGGGAGATGG + Intergenic
1052813699 9:33083550-33083572 TGGGGTGAGGGGAGGGGAGAGGG + Intergenic
1053233779 9:36434242-36434264 GGAAGGGAGGGGAGGGGAGAGGG + Intronic
1053303426 9:36967720-36967742 GTGAGTGAGTGGAGGTGAGGGGG + Intronic
1053858358 9:42359988-42360010 GTGAGAGAGGGGAGGGTTAAGGG + Intergenic
1054453920 9:65420099-65420121 AGGAGGGAGGGGAGGGAAGAAGG + Intergenic
1054453958 9:65420199-65420221 GGGAGGGATGGGAGGGAAGAAGG + Intergenic
1054454005 9:65420326-65420348 GGGAGGGAGGGGAGGGAAGGAGG + Intergenic
1054454017 9:65420374-65420396 GTGAGAGATGGGAGAGAAGAAGG + Intergenic
1054454100 9:65420619-65420641 GGGAGGGACGGGAGGGAAGAAGG + Intergenic
1054758363 9:68981476-68981498 GTGGGGGTGGGGAGGGCAGGAGG + Intronic
1055224342 9:73975700-73975722 GAGAGTGAGGGGTGGTGAGAGGG + Intergenic
1055408997 9:76007557-76007579 GGGTGTGAGAGGAGGGTAGATGG + Intronic
1055535989 9:77245021-77245043 ATGAGTGAGGGGAGAGTGGAGGG + Intronic
1055782527 9:79834737-79834759 GTGAGAGAGGGGAGGGAGGGAGG + Intergenic
1055945772 9:81689656-81689678 GGGGGTGGGGGGGGGGCAGAAGG + Intergenic
1056544249 9:87600830-87600852 GGGTGTGAGGAGGGGGCAGAAGG + Intronic
1056551985 9:87659860-87659882 GTGAGAGCGGGGAGTCCAGAGGG + Intronic
1057413093 9:94835764-94835786 GTGAGTGGAGGGAGTGCAGTAGG + Intronic
1057759416 9:97860568-97860590 GGGAGTGTGGGGCTGGCAGAGGG - Intergenic
1057912794 9:99033389-99033411 GGGTGGGAGGGGAGGGGAGATGG + Intronic
1058091380 9:100809624-100809646 GTCTGTCAGGGGAGGGCAGGGGG - Intergenic
1058923592 9:109640733-109640755 GTGCGGGTGGGGAGGGGAGACGG + Intergenic
1059035334 9:110748196-110748218 GGGAGGGAGGGAAGGGAAGAGGG - Intronic
1059646655 9:116274835-116274857 GTGTCTGACTGGAGGGCAGAGGG - Intronic
1060046400 9:120344769-120344791 GTGGGGGCGGGGAGGTCAGATGG - Intergenic
1060046964 9:120349100-120349122 GAGAATGGGGGGAGGGGAGAGGG - Intergenic
1060123991 9:121024223-121024245 GGGAGGGAGGGGAGGGGAGGGGG + Intronic
1060549136 9:124476971-124476993 CAGAGAGAGGGGAGGACAGAGGG - Intronic
1060756189 9:126215638-126215660 GTGAGTGAGGGGAAGGCCGGTGG - Intergenic
1060920543 9:127417655-127417677 GCGAGTGAGGGTGGGGCAGGGGG + Intergenic
1061012832 9:127965567-127965589 GTGGCTGAGGGAGGGGCAGACGG - Intronic
1061108733 9:128552345-128552367 GTGAGCGAGGGGCGGGCCGCGGG - Intergenic
1061276613 9:129572418-129572440 GGGAGAGAGGGCAGGGGAGAAGG + Intergenic
1061278825 9:129585391-129585413 GGGAGGGAGGGGAGGGAAGAAGG + Intergenic
1061289195 9:129641303-129641325 GGAAGGGAGGGGAGAGCAGAAGG - Intronic
1061507783 9:131041392-131041414 GTGAGTGCGTGGATGACAGATGG + Intronic
1061541292 9:131278910-131278932 GTGTGTGAGGGCAGGGCTGGAGG + Intergenic
1061664108 9:132150322-132150344 GTGAGGGAAGGAAGGGCAGGTGG + Intergenic
1061764781 9:132874941-132874963 GTGTCTGAAGGGAGGTCAGAAGG - Intronic
1061900158 9:133668641-133668663 GAGAGGGAGGGTAGGGGAGAGGG - Intronic
1061900206 9:133668761-133668783 GAGAGGGAGGGTAGGGGAGAGGG - Intronic
1061933127 9:133843589-133843611 GTGAGTGAGCTGAGGCCAGGGGG - Intronic
1062063836 9:134515258-134515280 GTGAGTGGGCGGTGGGGAGATGG - Intergenic
1062151419 9:135021144-135021166 GTGAATGAGGGGTGAGCAGTTGG + Intergenic
1062185010 9:135213449-135213471 GGGATGGAGGGGAGGGCAGCTGG + Intergenic
1062185651 9:135216873-135216895 GTGAGTGAGGAGGGGGAAGGGGG + Intergenic
1062213696 9:135377961-135377983 GTGAGTGAGGGGTGGTCTGTGGG - Intergenic
1062298374 9:135847881-135847903 GGGAGTGGGGGGAGGGGAGTGGG + Intronic
1062321089 9:135990835-135990857 GGGCGGGAGGGGAGGGGAGAGGG - Intergenic
1062323810 9:136003266-136003288 GGGAGTGAGGGGTGGGCACCGGG + Intergenic
1062344584 9:136109046-136109068 GGCAGGGCGGGGAGGGCAGAGGG - Intergenic
1062533251 9:137010845-137010867 GTGAGGCAGGGGACAGCAGAGGG - Intronic
1062641901 9:137523082-137523104 GTGGGTGAGGGGAGGCCCGCAGG + Intronic
1062681402 9:137783756-137783778 GTGAGTGTGGGCACAGCAGACGG - Intronic
1062719096 9:138025678-138025700 GTGAGCAAGGGGAGGAAAGAAGG - Intronic
1185537298 X:872774-872796 GAGAGGGAGGGGAGGGGAGAGGG - Intergenic
1185581311 X:1213123-1213145 GGGATGGAGGGGAGGGGAGAGGG - Intergenic
1185598694 X:1324487-1324509 GGGAGGGAGGGGAGGGAAGGAGG + Intergenic
1185779133 X:2829840-2829862 GTGACTGTGGGGAGGACAGGGGG + Intronic
1186406929 X:9312856-9312878 GTGATGGATGGGAGGGAAGAAGG + Intergenic
1186486058 X:9935238-9935260 GGGGGTGAAGGGAGTGCAGAGGG + Intronic
1186500196 X:10044859-10044881 GGGAGGGAGGGATGGGCAGATGG - Intronic
1186598052 X:11006147-11006169 GTGGATGAGAGGAGGGAAGAAGG - Intergenic
1186656713 X:11619915-11619937 GTGAGGGAGAGGAGGGCAGCAGG - Intronic
1186905174 X:14102876-14102898 GTGGGGGATGGGAGGGCAGGTGG - Intergenic
1187146129 X:16638990-16639012 GTCAGTGAGGGCAGGGGAGATGG + Intronic
1189095695 X:38136747-38136769 TTTATTGAGGGGAGGGCAAAGGG - Intronic
1189750647 X:44217707-44217729 GGGGGAGAGGGGAGGGCAGCAGG + Intronic
1190177971 X:48167173-48167195 GTGGGGAAGGGAAGGGCAGAGGG + Intergenic
1190180179 X:48185250-48185272 GTGGGGAAGGGAAGGGCAGAGGG - Intergenic
1190189869 X:48268271-48268293 GTGGGGAAGGGAAGGGCAGAGGG + Intronic
1190193194 X:48294473-48294495 GTGGGGAAGGGAAGGGCAGAGGG - Intergenic
1190199163 X:48345453-48345475 GTGGGGAAGGGAAGGGCAGAGGG - Intergenic
1190298023 X:49039963-49039985 CTGAGAGAGGGGAGGGGAGGGGG - Intronic
1190369802 X:49729903-49729925 GGAAGGGAGGGAAGGGCAGAAGG - Intergenic
1190606168 X:52145469-52145491 GTGGGTGGGGGGAGGGGACAGGG - Intergenic
1190658613 X:52634771-52634793 GTGGGGAAGGGAAGGGCAGAGGG + Intergenic
1190665931 X:52695921-52695943 GTGGGGAAGGGAAGGGCAGAGGG - Intronic
1190673487 X:52762489-52762511 GTGGGGAAGGGAAGGGCAGAGGG + Intronic
1190677032 X:52791260-52791282 GTGGGGAAGGGAAGGGCAGAGGG + Intergenic
1191745894 X:64486053-64486075 TGGGGTGAGGGGAGGGAAGAGGG + Intergenic
1192047297 X:67689327-67689349 TTCAGAGAGTGGAGGGCAGAAGG + Intronic
1192053275 X:67746576-67746598 ATGATTGAGGTGAAGGCAGAAGG - Intergenic
1192201451 X:69069041-69069063 GAGAGTAAGGACAGGGCAGAGGG - Intergenic
1192432538 X:71122044-71122066 GTGAGTGAAGGGAGGGGATCGGG + Intronic
1193005662 X:76616314-76616336 GTGAGTGAGGTGAGAACATATGG - Intergenic
1193416911 X:81236861-81236883 GTGTGTGAGGGAAGGACGGAGGG + Intronic
1193579539 X:83247183-83247205 GTGAGTGGGGGGAGGGGGGAGGG + Intergenic
1195156369 X:102127113-102127135 GAGAGAGGGGGAAGGGCAGAGGG + Exonic
1195162530 X:102184564-102184586 GTGAGTTGGGGGAGGGAGGAGGG + Intergenic
1195402420 X:104475673-104475695 GTGGGTGGGGGGATGACAGAGGG - Intergenic
1195543206 X:106086694-106086716 TGGGGTGGGGGGAGGGCAGAGGG + Intergenic
1195803561 X:108737052-108737074 GTGAGAGGGGAGAGGGGAGAGGG + Intergenic
1195969554 X:110458410-110458432 GTGGGTGAGAGGATGGTAGAAGG - Intergenic
1196237479 X:113299851-113299873 GAGGGAGAGGGGAGGGGAGAGGG - Intergenic
1196544003 X:116941421-116941443 GTGAGTGGGGGGAGGGAGGAGGG - Intergenic
1196752460 X:119130235-119130257 GTGAGTCAGGGGTGGGCTGCTGG - Intronic
1197640655 X:128964262-128964284 AGGAGTGAGGGGAGGGAAGAGGG + Intergenic
1197825808 X:130589137-130589159 GTGGGGGTGGGGAGAGCAGAAGG - Intergenic
1198041772 X:132859812-132859834 GTGAGGGAGGGAGGGACAGAGGG + Intronic
1198756654 X:139989145-139989167 TTGGGTGAGGGGAGGGGGGAGGG - Intergenic
1198918788 X:141701964-141701986 GTGAGTGAGATAAGGTCAGATGG + Intergenic
1199435099 X:147804248-147804270 GTGAGTGAGGGGTGGGTGGAAGG + Intergenic
1199654460 X:149980926-149980948 GTGACTGAGGGGTGGCCACAGGG - Intergenic
1199882431 X:151985160-151985182 TTGACTGAGGTCAGGGCAGAGGG + Intergenic
1200094387 X:153650373-153650395 GCAAGGGAGGGGAGGGCAGGAGG + Exonic
1200120184 X:153786469-153786491 GAGAGTGGGTGGAGGGCAGAAGG + Intronic
1200154986 X:153970501-153970523 GAGAGAGAGGGAAGGGTAGAGGG + Intronic
1200250106 X:154548230-154548252 GTGAGGGAGGGGAGCACAGTTGG + Intronic
1200354873 X:155538119-155538141 GTGATTGAGGGGAGGGAAGATGG - Intronic
1200712239 Y:6497051-6497073 TGGAGTGGGGGGAGGGGAGAGGG - Intergenic
1200806205 Y:7436167-7436189 GTGAGTGGGGTGAGGGATGAAGG - Intergenic
1200965039 Y:9027947-9027969 GTGTGTGTGGGAAGGGCAGGGGG - Intergenic
1201172827 Y:11285756-11285778 GTGGGGGGGGGGAGGGGAGAGGG + Intergenic
1201290913 Y:12420653-12420675 GTGACTGTGGGGAGGACAGGGGG - Intergenic
1201512219 Y:14777619-14777641 GTGAGTGTGAGGGGGGAAGAGGG + Intronic
1201741092 Y:17325423-17325445 GGAAGAGAGGGGAGGGAAGAAGG + Intergenic
1202148072 Y:21820832-21820854 GTGTGTGTGGGAAGGGCAGGGGG + Intergenic
1202584726 Y:26410141-26410163 GTGAGTTGGGGGATGGCAGTGGG + Intergenic