ID: 1085620335

View in Genome Browser
Species Human (GRCh38)
Location 11:78033036-78033058
Sequence CCTCATCTGCAAAATGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1591
Summary {0: 1, 1: 12, 2: 95, 3: 374, 4: 1109}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085620330_1085620335 -7 Left 1085620330 11:78033020-78033042 CCTGGGGCCTCAGTGTCCTCATC 0: 1
1: 11
2: 166
3: 701
4: 2181
Right 1085620335 11:78033036-78033058 CCTCATCTGCAAAATGAGGAGGG 0: 1
1: 12
2: 95
3: 374
4: 1109
1085620326_1085620335 12 Left 1085620326 11:78033001-78033023 CCACTAGGCTGCTGTCAGACCTG 0: 1
1: 0
2: 0
3: 18
4: 176
Right 1085620335 11:78033036-78033058 CCTCATCTGCAAAATGAGGAGGG 0: 1
1: 12
2: 95
3: 374
4: 1109

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085620335 Original CRISPR CCTCATCTGCAAAATGAGGA GGG Intronic
900457157 1:2782759-2782781 CCTCCTCTGTAAAAGGAGGAGGG - Intronic
900628478 1:3620922-3620944 CCTCAGCTGCCAAACGGGGAAGG - Intergenic
901041699 1:6368160-6368182 CCTCACCTTCAAACTGGGGAGGG - Intronic
901272599 1:7964284-7964306 CTTCAACTGTAAAATGAGGATGG - Intronic
901679429 1:10904579-10904601 TCTCATCTGTAAAATGGGCATGG + Intergenic
901809571 1:11759834-11759856 CCTCATATGTAAAAGGGGGATGG - Intergenic
901869046 1:12126775-12126797 CCTCATCCGGAAAATGCAGATGG + Intronic
902244032 1:15107545-15107567 CCTCATTTGTAAAATGAGTATGG + Intronic
902407454 1:16192454-16192476 CCCCATCTGCAAAATGGGGACGG - Intergenic
902623468 1:17663748-17663770 CCCCATCTGTAAAATGGGGTGGG - Intronic
902657397 1:17878798-17878820 CCTCATCTGTAAAATAGGAAGGG - Intergenic
902689452 1:18101123-18101145 CCTCATCTGTAAAATGGGACTGG - Intergenic
902708355 1:18221965-18221987 CCTCATCTGTAAAATGAGAAGGG - Intronic
902863626 1:19262971-19262993 CCTCACCTGCTCAGTGAGGAAGG + Intergenic
903060590 1:20666071-20666093 CCTTAGCTACAAAATGAGGGGGG - Intronic
903073421 1:20741653-20741675 CTTAACCTACAAAATGAGGAAGG - Intergenic
903137848 1:21321075-21321097 CCTCCTCTGTAAAGTGGGGATGG - Intronic
903189016 1:21646054-21646076 CCTCATCTGTAAAATGGGGATGG + Intronic
903330633 1:22595306-22595328 GCTCATCTGCAAGAAGAGGTGGG + Exonic
903411315 1:23145771-23145793 ACTCATCTTAAAAATGAGGTTGG - Intronic
903497990 1:23784014-23784036 CCTCATCTGTAAAATGGGAATGG - Intronic
903504576 1:23824441-23824463 GCTCATGTGTAAAATGAAGATGG - Intronic
903624240 1:24719912-24719934 CCTCATCTGTAAAATAACGATGG - Intergenic
903659669 1:24969458-24969480 CCTCCTCTGAAAAGTGAGGAGGG - Intergenic
903740355 1:25555089-25555111 CCTCATCTGTAAAATGGGGGTGG + Intronic
903809120 1:26024760-26024782 CCTCATCAGAAAAGTGAGGGAGG - Intronic
903812413 1:26042091-26042113 CCCCATCTGTCAAATGGGGACGG - Intronic
903817792 1:26077664-26077686 TCTCATCTGTAAAATGGGGATGG - Intergenic
903898083 1:26621627-26621649 CCCCATCTCTAAAATGGGGAAGG - Intergenic
903972770 1:27129878-27129900 CCTCAGCTGTAGAATGAGGAGGG - Intronic
904035194 1:27555296-27555318 CCTCATCTGTAAAATGGGAGGGG - Intronic
904203616 1:28838001-28838023 CCTCCTCTGTACACTGAGGATGG + Intronic
904254954 1:29248980-29249002 CCTCACCTGTAAAATGAGAGTGG - Intronic
904273188 1:29363678-29363700 CTGCATCTGTAAAATGGGGATGG - Intergenic
904318934 1:29684035-29684057 CCCCATCTATAAAATGGGGATGG + Intergenic
904382675 1:30121944-30121966 GCTCATTTGCAAAGTGGGGAAGG - Intergenic
904457596 1:30656990-30657012 CCTCATCTGTAAACTGGGGGTGG - Intergenic
904642863 1:31943804-31943826 CCTCATCTGTAATATGGGCATGG + Intronic
904763723 1:32824928-32824950 CCTCATTTACAAAATGGGAAAGG - Intronic
904840268 1:33368011-33368033 CCTCATCTACGGAATGGGGAGGG - Intronic
904882927 1:33714390-33714412 CCTTATCTGCAAAATAGGGATGG - Intronic
904894946 1:33809738-33809760 CATCATCTGCAAAAAAATGATGG - Intronic
904917725 1:33982455-33982477 CCTCATTAGCAAACTGTGGAAGG + Intronic
904944346 1:34188482-34188504 CTTCATCTGCAAAGTGGGGATGG - Intronic
905206620 1:36346333-36346355 TCTCATCTGTAAAATAGGGATGG - Intronic
905270914 1:36786896-36786918 CCTCATCTGGAAAATGGGGTTGG - Intergenic
905370625 1:37480828-37480850 CCTCATCTGAAACATGGGGTCGG + Intronic
905405195 1:37727697-37727719 CCTCAGCTGTAAGATGAAGATGG - Intronic
905444057 1:38013378-38013400 CCTCATCTGTATAATGGGAATGG - Intronic
905531035 1:38678842-38678864 CCTCATCTGCACTATGGGGATGG + Intergenic
905562080 1:38935489-38935511 CATCATCTGTAAAAGGAGGGTGG + Intronic
905827090 1:41034074-41034096 CCTCATGTGCAAACTGGAGATGG - Intronic
905827701 1:41038741-41038763 CCTCATCTGCAGAAGGAGGTGGG - Intronic
905861767 1:41356882-41356904 CCTCATCTGGGAAATGGGAATGG - Intergenic
905905972 1:41618739-41618761 CCTCATCTGGAAAATGGGCCAGG - Intronic
905907248 1:41627275-41627297 TCTCACTTGCAAAATGAGGCTGG - Intronic
906066458 1:42984630-42984652 TCTCACCTGCAGAATGGGGAGGG - Intergenic
906591361 1:47027261-47027283 CCTGATCTGATAAATGGGGAGGG - Intronic
906624028 1:47310077-47310099 CTTCATCTGTAAAATGAGGATGG - Intronic
906635423 1:47406524-47406546 TCTCATCTGTAAATTGGGGATGG + Intergenic
906688701 1:47778782-47778804 CCTCATCTGCAAAGTGAGAATGG + Intronic
906730811 1:48079571-48079593 CCTCATCTGTAAAACGATGGTGG - Intergenic
906778206 1:48548796-48548818 TTTCATCTGCAAAATGGAGATGG - Intronic
906899749 1:49821358-49821380 CTTCATCTGTAAAATTAAGATGG + Intronic
906960335 1:50416089-50416111 CCTCCTCTGTAAAATGGGGCCGG + Intergenic
907315877 1:53572268-53572290 CTCCATCTGTAAAATGAGAATGG + Intronic
907331464 1:53674490-53674512 CCACATGTGTAAAATGGGGACGG + Intronic
907383704 1:54111699-54111721 TTTCATTTGCCAAATGAGGATGG - Intronic
907395129 1:54184419-54184441 CCTCATCTGAAAATTGGGAATGG - Intronic
907506928 1:54925938-54925960 CTTCTGCTGCAAAATGAGGGGGG - Intergenic
907715857 1:56925405-56925427 CCTCATCTGTGAGATGGGGATGG - Intergenic
907738554 1:57140327-57140349 CCTCATCTGTAGAATGAGGGAGG - Intronic
907747986 1:57233809-57233831 CTTCCTCTGCAAACTGAGAAAGG + Intronic
907778131 1:57538762-57538784 ACTCATCTATAATATGAGGAGGG + Intronic
908321591 1:62983869-62983891 TCTCATCTGTAGAATGGGGATGG + Intergenic
908423570 1:63983209-63983231 CCATATCTGTAAAATGCGGAGGG - Intronic
908570794 1:65408019-65408041 CCTCATCCATAAAATGGGGATGG - Intronic
908645600 1:66274647-66274669 CCTCGTCTCCAAAATTAGGATGG + Intronic
908648921 1:66310835-66310857 TCTTATCTGTAAAATGGGGAAGG + Intronic
908846807 1:68333023-68333045 CTTCATCTGTAAAATGACGGGGG + Intergenic
908897261 1:68914251-68914273 CCTCACTTGCAAAATGAGACTGG - Intergenic
908983030 1:69981902-69981924 CCTCATCTATAAAATGGGGATGG - Intronic
909225904 1:73022523-73022545 TCTCATCTGTAAACTGAAGATGG - Intergenic
909391852 1:75129136-75129158 TCTCATTTGTAAAATGAAGATGG - Intronic
909623134 1:77687627-77687649 CCCCGTCTGCGAAGTGAGGAGGG + Intergenic
909661011 1:78082133-78082155 CCACATCTGTAAAATAAGGTTGG - Intronic
910123911 1:83819610-83819632 CCACAGCTGCAAACTGAGGGAGG - Intergenic
910286235 1:85557415-85557437 TCTCATCTCTCAAATGAGGATGG - Intronic
910487856 1:87735704-87735726 CCTCAACTATAAAATGAGGGGGG - Intergenic
910725862 1:90338100-90338122 CTTCATCTACAAAATGATGATGG + Intergenic
910743504 1:90547880-90547902 CCTCATCTGTAAAATGGGGCTGG + Intergenic
910928398 1:92419150-92419172 TCTCATCTGTAAACTGGGGATGG + Intergenic
911136423 1:94445600-94445622 CCTTTTCTTCAAAATAAGGAGGG - Intronic
911498266 1:98656783-98656805 CCTCATCTGTAAAATGGGGATGG + Intergenic
911654452 1:100427497-100427519 CCTCTCCAGAAAAATGAGGAAGG - Intronic
912363963 1:109117594-109117616 CCTGATCTGTGAAATGGGGATGG + Intronic
912725244 1:112053485-112053507 CCTCATCTATAAAATGTGGTAGG + Intergenic
912966807 1:114242971-114242993 CCCCATCTGGGAACTGAGGAGGG + Intergenic
913355565 1:117917560-117917582 CCTCATCTCTAAAATGGGGATGG - Intronic
913441522 1:118903273-118903295 CCTCTTTTGCAAATTGATGATGG + Intronic
913611212 1:120511514-120511536 ACACAACTGGAAAATGAGGATGG + Intergenic
914579979 1:149010725-149010747 ACACAACTGGAAAATGAGGATGG - Intronic
914887493 1:151597372-151597394 CCTCATCTGCAAACTTCGGAGGG + Intergenic
915208324 1:154287417-154287439 CCTAGTCTGGAAAGTGAGGAGGG + Intergenic
915364690 1:155308425-155308447 CCTCATCTGTTGAATGAGGGTGG - Intergenic
915456342 1:156043360-156043382 CTTCATCTCCAGGATGAGGAAGG - Intronic
915718001 1:157962643-157962665 CCGCATCTGTCAAATGAGGTGGG + Intergenic
916404929 1:164488940-164488962 CTTCATCTGTAAAATGGAGAAGG - Intergenic
916578443 1:166087365-166087387 CCTCCTTTGCAAAATGGAGATGG - Intronic
916673844 1:167049672-167049694 CCTCATCTGTAAAATGGAGAGGG + Intergenic
916744405 1:167673563-167673585 CAACATCTGTAAAATGAGGTGGG - Intronic
917514707 1:175697860-175697882 TTATATCTGCAAAATGAGGATGG - Intronic
917623858 1:176826025-176826047 CCTCATCAGTAAAACAAGGATGG - Intronic
917839579 1:178966744-178966766 CCTCATCTGTGAAATGAGGATGG + Intergenic
917904304 1:179574350-179574372 CCTCATCTGTGATAAGAGGATGG + Intronic
918220489 1:182432207-182432229 CCTCCACTATAAAATGAGGACGG - Intergenic
918304154 1:183230610-183230632 CCTCATCTGCAAAATAGAGGGGG + Intronic
918324110 1:183393322-183393344 CCTCATCTGTAAAATGGGATTGG - Intronic
918458935 1:184755544-184755566 TCTCGTCTGCAAAAGGGGGATGG - Intergenic
918655140 1:187016097-187016119 CCTCATCTCTAAAATGAGAATGG + Intergenic
918763275 1:188443678-188443700 CCTCCTCATCAAAATGAGTATGG - Intergenic
919753934 1:201054825-201054847 CTGCATCTCCAAAATGAGAAGGG - Intronic
920033849 1:203053067-203053089 CTTCATCTGTAAAATAGGGATGG - Intronic
920092893 1:203466683-203466705 CCTCATCTGTAAAGTGGGGATGG + Intergenic
920095584 1:203484348-203484370 CCTCATCTGTAAAGTGAGAATGG + Intronic
920177403 1:204111270-204111292 CCTCATCTGTAAAATGAGCATGG - Intronic
920436032 1:205947791-205947813 CCTCATATGTAAAATGAGGGAGG - Intergenic
920501702 1:206489746-206489768 TCTCATCTATAAAATGGGGAGGG - Intronic
920950457 1:210567385-210567407 CCTCATCTGGAAATTAAGGGAGG + Intronic
920971397 1:210746334-210746356 CCTCATCTGTAAAATGAAAGGGG - Intronic
920987562 1:210904844-210904866 CCTCATCTGTAAAATGGAGGAGG - Intronic
921075306 1:211695841-211695863 CCTCATCTGTAAAATAGAGATGG - Intergenic
921292291 1:213670067-213670089 TGTCATCTGCAAAATGAAGCAGG + Intergenic
921307407 1:213810817-213810839 TCTTATCTGTAAAATGAGGATGG - Intergenic
921342958 1:214152971-214152993 CCTCATCCCTAAAATAAGGATGG - Intergenic
921355155 1:214279146-214279168 CCTCATTGCCAAAATTAGGAAGG - Intergenic
921445438 1:215241793-215241815 CCTAATATGTAAAATGACGATGG + Intergenic
921549391 1:216515108-216515130 TCTCATCTGTAAAATAAGGCAGG - Intronic
921555431 1:216592942-216592964 TCTCATTTTAAAAATGAGGAAGG + Intronic
921639111 1:217530321-217530343 CTTCATCTACAAAATGGGGGTGG + Intronic
922656506 1:227389116-227389138 CCTCATCCACAAAAGCAGGATGG + Intergenic
922765872 1:228156591-228156613 CCTCAGCTGCATAAAGAGGCCGG + Intronic
923262419 1:232279830-232279852 CTTCCTCTGTAAAATGAGGATGG + Intergenic
923339420 1:232994998-232995020 CTTTATCTGCAAGATGAGGAGGG + Intronic
923401996 1:233624603-233624625 CCTTTTCTGAAAAATGAAGAAGG + Intronic
923614037 1:235521752-235521774 CCTCATCTGTAAAATAAGGAAGG - Intergenic
923966761 1:239150114-239150136 CCTTATCTGCAAAAAGTGGATGG - Intergenic
924014848 1:239709994-239710016 CCACCTATGCCAAATGAGGAAGG + Intronic
924157887 1:241199941-241199963 CTTCATCTGCAAAATGTGGGTGG + Intronic
924219883 1:241863221-241863243 CCTCATCTGTAAAATGAGAATGG - Intronic
924290280 1:242529456-242529478 CCTCATCTGTAACATAGGGATGG - Intergenic
924442194 1:244095818-244095840 CCTCAACTGTAAAATGGGGGTGG - Intergenic
924588905 1:245384585-245384607 CCTTATCTTTAAAATGAGAATGG - Intronic
924614940 1:245605122-245605144 CCTCACCTGACAGATGAGGAAGG - Intronic
924673554 1:246152809-246152831 CCACATCTGCAAAATGGGGATGG + Intronic
924740205 1:246790429-246790451 CCTCACCTGGAAAACAAGGAGGG - Intergenic
1062902984 10:1159627-1159649 CCTCATCTGCATAAAGCGTAGGG - Intergenic
1062922548 10:1291190-1291212 CCTCTTCTGCAAAATCACCAGGG + Intronic
1062995127 10:1858465-1858487 TCTCACCTGCAAAATGAGTAGGG - Intergenic
1063371796 10:5527019-5527041 CCTCGTTTGTAAGATGAGGAAGG - Intergenic
1063438039 10:6050331-6050353 CCTCATCCGTAAAATGGGAATGG + Intronic
1063946397 10:11180399-11180421 CCTCATCTGCAGGATGAACAGGG + Intronic
1064120510 10:12614175-12614197 CCTTATCTCCAAAATGGGCATGG + Intronic
1064893349 10:20205789-20205811 CCTCATCTGTAAGATGAGGTGGG - Intronic
1065041976 10:21706398-21706420 CCTCATCTATAAAGTGAGGGTGG - Intronic
1065825184 10:29564226-29564248 CCGGATCTGTAAACTGAGGATGG - Intronic
1065865214 10:29909124-29909146 CCTCCTGTGCAAAATGAGCAAGG + Intergenic
1065952222 10:30662684-30662706 CCAGATCTGTAAACTGAGGATGG + Intergenic
1065963057 10:30749977-30749999 CCTCACCTGTAAAAAGAAGAAGG - Intergenic
1066239566 10:33520238-33520260 CCTCATTTTAAAGATGAGGATGG + Intergenic
1067209993 10:44252108-44252130 CCAGATCTGAAGAATGAGGATGG + Intergenic
1067295357 10:44972450-44972472 CCTCTTCTGAAAAATCAGAAAGG - Intronic
1067471070 10:46538290-46538312 CTTCATCTATAGAATGAGGATGG - Intergenic
1067688231 10:48480750-48480772 TCTCATCTGTAAAATGTGGTTGG - Intronic
1067897316 10:50197629-50197651 TCTCATTTGCAAAATGGGAATGG - Intronic
1067951656 10:50744391-50744413 TCTCATTTGCAAAATGGGAATGG + Intronic
1068528770 10:58161777-58161799 CCTCATTTGTAAAATGAAGGGGG - Intergenic
1068831838 10:61505069-61505091 CCACACCTGGAAAATGATGAAGG - Intergenic
1068870379 10:61937065-61937087 CCTCATCAGTAAAATGAGAAAGG + Intronic
1069132925 10:64728617-64728639 TCTGATCTGTAAAATGGGGATGG + Intergenic
1069740729 10:70685534-70685556 CCTCTACTGGAAAATGAAGAGGG - Intronic
1069865807 10:71502065-71502087 CCCTCTCTGCAAAATGAGAAGGG + Intronic
1069888399 10:71638146-71638168 CCTCATCTGTGAAGTGGGGAGGG - Intronic
1069971564 10:72174816-72174838 CCTCCTCTGTAAAATAAGGGAGG + Intronic
1070370986 10:75781798-75781820 TCTCATCTGCAAAATGGGAGTGG - Intronic
1070394764 10:76002497-76002519 CTACATCTGTAAAATGGGGATGG + Intronic
1070626466 10:78054514-78054536 CCTCATCTGCAAAAGCGGGAAGG - Exonic
1070766431 10:79059235-79059257 CCTTATCTGTAAAGTGGGGATGG - Intergenic
1070967477 10:80538409-80538431 CCTCTTCTACAAAATGCGGGAGG + Exonic
1071003196 10:80854603-80854625 CCTCATCTGCAAAGTGACCTTGG + Intergenic
1071304935 10:84291102-84291124 CTTCATCTGTAAAATGAGGATGG + Intergenic
1071305072 10:84292499-84292521 CTTCATCTATAAAATGAGGATGG - Intergenic
1071400282 10:85261955-85261977 CCTCATTTGCAAAATAAGGTAGG + Intergenic
1071792201 10:88966699-88966721 CCTCATCTGCAAAATGACAATGG + Intronic
1072620059 10:97073798-97073820 TCTCATCTGCAACATGGGGATGG + Intronic
1072626033 10:97112575-97112597 CCTCATCTGTGAAATGGGGATGG - Intronic
1072627575 10:97123092-97123114 CTTCATCTGTAAAGTGGGGATGG - Intronic
1072733378 10:97863224-97863246 CCTCACCTGTAAAATGGGGATGG + Intronic
1073044893 10:100631146-100631168 CCTCATCTGTAAAACAGGGATGG + Intergenic
1073069765 10:100785923-100785945 TCTCCTCTGTAAAATGAAGATGG + Intronic
1073118039 10:101103442-101103464 CCTCATCTGTGACATGGGGATGG + Intronic
1073178076 10:101568731-101568753 CTTCATCTGCAAAATGGGGATGG + Intergenic
1073189131 10:101637754-101637776 CCTTATCTCTAAAAGGAGGAGGG - Intronic
1073423970 10:103445173-103445195 GCTCATCTGGAAGATGAGGGTGG + Intronic
1073584658 10:104698204-104698226 CCACATCTGTAAAATGGGGCTGG - Intronic
1074059086 10:109948693-109948715 CCTCCTCTGTGAAATGAGGATGG - Intronic
1074102666 10:110365728-110365750 CCTCATCTGTAAAATGGGAATGG + Intergenic
1074198307 10:111208432-111208454 CCTCATCATCAAAATGTGGAGGG - Intergenic
1074221768 10:111444959-111444981 CCCCATCTTCGTAATGAGGAGGG - Intergenic
1074226002 10:111484814-111484836 TCTCATCTGTAAAATGGGGGTGG + Intergenic
1074309334 10:112308673-112308695 TGTCATCTGCAAAATGGGGGTGG - Intergenic
1074526194 10:114265478-114265500 CCTCCTCTGTAAAATAAGGGAGG - Intronic
1074596945 10:114876453-114876475 CCTTATCTGTAAAATGGGGATGG + Intronic
1074760543 10:116664420-116664442 TCTCTTCTGCGAAATGAGGAGGG - Intronic
1074889927 10:117727155-117727177 CCTCATCTATAAAATGGGGCAGG + Intergenic
1074892209 10:117745025-117745047 CCTTATTGGCAAAATGAGGATGG + Intergenic
1074913886 10:117937647-117937669 TCTCATCTGTAAAATGTTGATGG - Intergenic
1074921323 10:118016820-118016842 CCTCATCTGTAAAATGGAGATGG + Intronic
1074944284 10:118266149-118266171 CCTCATCTGTAAAATGGCAAAGG + Intergenic
1075025884 10:118982725-118982747 CCTCATCTGCAAAATGGGAGAGG - Intergenic
1075406348 10:122198322-122198344 CCTTATCTGTGAAATGAAGAGGG + Intronic
1075444735 10:122505530-122505552 CCTCATCTGTTAAATGGGCATGG + Intronic
1075462715 10:122629255-122629277 CCTCATCAGAAAAATGAGAGTGG - Intronic
1075536959 10:123279280-123279302 CCTCATCTGTGAACTGTGGAAGG + Intergenic
1075545779 10:123353378-123353400 TCCCATCTGTAAAATGAGGGTGG + Intergenic
1075739087 10:124682511-124682533 TCTCATCTGTAAAATGAGGTTGG - Intronic
1075813618 10:125247111-125247133 CCTCATCTGTAAAATGATCCAGG + Intergenic
1075925441 10:126248128-126248150 CCTCATCTGCAGATTGAGTGTGG + Intronic
1076111261 10:127861446-127861468 CCTCATCTGTAAAATGGAGTGGG - Intergenic
1077156407 11:1093938-1093960 TTTCAGTTGCAAAATGAGGATGG + Intergenic
1077747448 11:4923180-4923202 CCTCAACTGCAGAATGAGCAAGG - Intronic
1078107476 11:8367700-8367722 CCTCATCTGTAAAATAGGAATGG - Intergenic
1078402983 11:11044499-11044521 CCTCAACTGTAAAATGAGGATGG + Intergenic
1078455662 11:11472781-11472803 CCTTGTATACAAAATGAGGATGG - Intronic
1078527608 11:12112058-12112080 CCCCATCTCTAAAATGGGGAGGG - Intronic
1078557573 11:12342729-12342751 CCTCCTGTGGAAAATGGGGATGG - Intronic
1078700346 11:13674446-13674468 CCTCATCTGTAAAATGGAGGGGG + Intronic
1078727600 11:13945572-13945594 CCTCATCTATGAAATGGGGATGG + Intergenic
1078779126 11:14420577-14420599 CCTCATCTGTAGAACAAGGATGG + Intergenic
1078945823 11:16067588-16067610 CCTCATTAGCAGCATGAGGATGG + Intronic
1079032357 11:16995123-16995145 CCTCATCTGAAAAATGGGGATGG - Intronic
1079051673 11:17166163-17166185 CCTCAACTGTAAAATAGGGATGG + Intronic
1079122881 11:17697644-17697666 CCTCATCAGAAAGATGAGGATGG - Intergenic
1079129158 11:17737523-17737545 CCTTATCTGTAAAATGGGGGAGG + Intronic
1079148673 11:17877483-17877505 GCTCATCTTTAAAATGGGGAGGG - Intronic
1079318132 11:19427220-19427242 CCTCCCCTGCAGAAAGAGGATGG + Intronic
1079327776 11:19509158-19509180 CCTCTTCTGTAAAATGGGGTTGG + Intronic
1079400301 11:20101613-20101635 CCTTCTCTGTAAAATGGGGATGG - Intronic
1079576589 11:22011108-22011130 CCTCATTTATAAAATGAGAATGG + Intergenic
1079806991 11:24944290-24944312 CCTCATCTGAATACTGAGGTTGG - Intronic
1079963779 11:26955483-26955505 CATCATTTGCAAAATGTTGATGG - Intergenic
1080181634 11:29432806-29432828 TCTCATCTGTAAAATGAGCTAGG + Intergenic
1080197944 11:29633511-29633533 ACTTTTCTGCAAAATGTGGAAGG + Intergenic
1080394106 11:31874199-31874221 CCTCACCTGGAAAATGGGGCTGG - Intronic
1080846153 11:36028895-36028917 CCTCATCTGCAAAATGGAAATGG + Intronic
1080849006 11:36051442-36051464 CCACATCTGTAAAATGAGATAGG + Intronic
1081354583 11:42096501-42096523 CCTCCTCTGTAAAATGAGGTGGG + Intergenic
1081612732 11:44572756-44572778 CCTCATCTGTGAAATAGGGATGG + Intronic
1081658600 11:44874169-44874191 CCTCATCTGTAAAAAGGAGATGG + Intronic
1081679022 11:44988918-44988940 CCTCACCTGCAAAATGGAGATGG + Intergenic
1081800381 11:45854833-45854855 CCTCATCTATAAAATAAGGATGG + Intronic
1081941185 11:46943713-46943735 CCACATCTCCAAAATGTGGGTGG + Intronic
1082013207 11:47464889-47464911 GCTCATCTGTAAAACGAGGATGG + Intergenic
1082226682 11:49715940-49715962 CCTCCTCTATATAATGAGGATGG - Intergenic
1082641186 11:55663551-55663573 TCTCATCTGCAGTATAAGGATGG - Intergenic
1083116648 11:60466316-60466338 CTTCAACTGTAAAATGGGGATGG + Intronic
1083186794 11:61022328-61022350 CCTCACCTGTAAAATGAGAGTGG - Intergenic
1083237937 11:61363847-61363869 TCTCATCTGTAAAATGGGGAAGG + Intronic
1083276166 11:61598219-61598241 CCTCATCTGTCAAATGGGGTGGG - Intergenic
1083319172 11:61834852-61834874 CCGCCTATGCAAAATGAGCAAGG - Intronic
1083502998 11:63128685-63128707 CCTCAGCTGCCAAATTGGGAAGG + Intronic
1083641725 11:64149309-64149331 CCTCCTCTGCAAAATGAGGGTGG - Intronic
1083700507 11:64474447-64474469 CCTTTTCTACAAAATGAGGATGG + Intergenic
1083739096 11:64698478-64698500 CCTCTTCTGCAAAATGAGAGGGG + Intronic
1083889262 11:65587843-65587865 CCTCATCTGTAAAGTGGGGAGGG + Intronic
1083924993 11:65800694-65800716 CCTCATCTATAAAATGAGGTGGG + Intergenic
1084146584 11:67268131-67268153 TCTCATCTGTGAAATGTGGATGG + Intronic
1084551278 11:69843633-69843655 CCCCATTTTAAAAATGAGGAGGG + Intergenic
1084966642 11:72748078-72748100 CCTCATGTGGAAAATGGGAATGG + Intronic
1085067479 11:73510555-73510577 CTTCCTCTGTAAAATGAGCAGGG + Intronic
1085260793 11:75203593-75203615 CCTCATCTATAAAAGGAGGGGGG - Intronic
1085267220 11:75244011-75244033 CCTCATCTTCAGGATGGGGATGG + Intergenic
1085426990 11:76413493-76413515 CCTCATCTATAAGATGGGGATGG + Intronic
1085477883 11:76799196-76799218 CCTCCTCTGCAAAACGGGGCAGG + Intergenic
1085483839 11:76845154-76845176 TCTTATCTATAAAATGAGGATGG + Intergenic
1085620335 11:78033036-78033058 CCTCATCTGCAAAATGAGGAGGG + Intronic
1085798818 11:79568283-79568305 CCTAATCTGAAAAATGGAGATGG + Intergenic
1085947367 11:81287525-81287547 CCTCATTTGGAAAATGAGATTGG + Intergenic
1086095433 11:83045674-83045696 CCTCAGCTGTAAAATGGGTATGG + Intronic
1086165721 11:83775449-83775471 CCTCATCTGTAAAATGAGTAAGG + Intronic
1086266044 11:84999321-84999343 CCTCATCTAAAAAATCAAGATGG + Intronic
1086333068 11:85773146-85773168 CCACATCTGCAAAAACAAGAGGG + Intronic
1086400136 11:86454601-86454623 CCCAATCTGTAAAATGAGGATGG - Intronic
1086622743 11:88907141-88907163 CCTCATCTATATAATGAGGATGG + Intronic
1086948880 11:92870937-92870959 CTTTATCTGTAAAATGAGGGTGG - Intronic
1087101428 11:94369048-94369070 CTTCAGCTGAAATATGAGGAAGG - Intergenic
1087789901 11:102394780-102394802 TGTCATCTGTAAAATGGGGATGG - Intergenic
1087920237 11:103858587-103858609 TGTAATCTGTAAAATGAGGAAGG + Intergenic
1088090729 11:106036239-106036261 CCTGATCCACAAAATGGGGAGGG + Intergenic
1088551397 11:111016634-111016656 ACTCAATTGAAAAATGAGGAAGG + Intergenic
1088663955 11:112075239-112075261 CTTCATCTACAAAATAGGGATGG + Intronic
1088916497 11:114231894-114231916 CCTCAACAGTAAAATGAAGAGGG - Intronic
1089015038 11:115158633-115158655 CATCATCTGTAAAATGAGGCTGG - Intergenic
1089064037 11:115648842-115648864 CCTCGTCTGTGAACTGAGGAGGG - Intergenic
1089342505 11:117768016-117768038 CCTCACCTGTAAAATGGGCAAGG + Intronic
1089573741 11:119426540-119426562 CCTCATCAGCAAAGTAGGGAGGG + Intergenic
1089637437 11:119824410-119824432 CCTCATCTGTAAAATGAGAATGG - Intergenic
1089775986 11:120836294-120836316 CCTCAGCTGTAAAATGGGGTTGG + Intronic
1090203890 11:124874554-124874576 CCTCATCTCTAAGATGAAGATGG - Intronic
1090429734 11:126635716-126635738 CCTTATCTGTAAAATGTGGCTGG + Intronic
1090498397 11:127237201-127237223 CCTCATCTGGAAAATTATTATGG - Intergenic
1091157710 11:133388955-133388977 CCTCATCTGCAACATGGGGATGG - Intronic
1091320167 11:134643721-134643743 CCTCCTCTGTAAAATGAGAATGG + Intergenic
1091341910 11:134822701-134822723 CCTCATCTATAAAGTGAGGATGG - Intergenic
1091446534 12:546876-546898 CCCCATCTGTGAAACGAGGACGG - Intronic
1091645152 12:2267558-2267580 TCTCATCTGTAAAATGGGCATGG - Intronic
1091901477 12:4147507-4147529 CCTCATTTGCAAAACAAGGATGG + Intergenic
1091997188 12:5002861-5002883 CCTGCTCCGCAAAATGAGGAAGG - Intergenic
1092035353 12:5329724-5329746 ATTCACCTGAAAAATGAGGAGGG + Intergenic
1092039776 12:5374026-5374048 CCTCATCTGTAAGATGGGGATGG - Intergenic
1092295377 12:7193119-7193141 CCTCATCTATAAAATGGGGGTGG - Intronic
1092364962 12:7870252-7870274 CCCCATCTGCAAAATGAGCAAGG + Intronic
1092383160 12:8014861-8014883 CCCGATCTGCGAAATGAGCAGGG + Intergenic
1092411611 12:8257451-8257473 CCTCATCTGTAACTTGGGGATGG + Intergenic
1093484406 12:19637932-19637954 CTTTTTCTGCAAAATGGGGATGG + Intronic
1093660599 12:21752270-21752292 CCTAATCTGATAAATGAAGAGGG + Intronic
1093673540 12:21905815-21905837 CTTCATCAGTAAAATGAAGATGG - Intronic
1094069816 12:26400874-26400896 CCTCATCTGTAAAATGGGGAGGG + Intronic
1094179829 12:27580425-27580447 CCACATCTGTAAAATGGGGATGG + Intronic
1094567902 12:31616617-31616639 CCTCACCTGCAAAATGAGAATGG + Intergenic
1095395131 12:41754190-41754212 CCCCTTCTGCCAAATGAGGATGG + Intergenic
1095481358 12:42639278-42639300 CCCTATTTGTAAAATGAGGAGGG - Intergenic
1095552912 12:43465358-43465380 CCTCATCTGTAAATTGAGAGTGG + Intronic
1096290262 12:50336282-50336304 CCTCTTCTGTAGAATGAGGATGG - Intronic
1096670375 12:53195013-53195035 CCTCATCTGTAAAATAGGGATGG + Exonic
1096802492 12:54120386-54120408 CCTCACCTGTAAAAAGAGGGAGG + Intergenic
1096815410 12:54198821-54198843 CCTCATCTATAAAACGGGGATGG - Intergenic
1097614543 12:61868232-61868254 CCTCATCTACAAAATGGGGATGG - Intronic
1097915598 12:65017629-65017651 TCTCATCTGTAAAATGATGCTGG + Intergenic
1098018649 12:66132666-66132688 CCTGATCTGCACAATCAGTAAGG + Intronic
1098068928 12:66650928-66650950 CTTCATCTCCAAAATGAGCATGG + Intronic
1098139337 12:67435730-67435752 CCTCCTCTACAAAACGATGATGG + Intergenic
1098196813 12:68010868-68010890 ACTCCTATGCAAAAGGAGGATGG + Intergenic
1098580702 12:72095484-72095506 CCTCATCTCTAAGGTGAGGAGGG - Intronic
1098609925 12:72444025-72444047 CTTTATATGCAAAAAGAGGAAGG - Intronic
1098613048 12:72485580-72485602 CCTCACCTGTAGAATGGGGAGGG - Intronic
1098615921 12:72522092-72522114 CCTCATCTGTAAAATGGAGATGG - Intronic
1098842969 12:75499229-75499251 CTAAATCTGCAAAATGAGCAAGG + Exonic
1099518928 12:83634767-83634789 CCTCATCTTCAAAATGATAGTGG - Intergenic
1100289953 12:93204240-93204262 CCTCATCTGTAAAACTAAGATGG + Intergenic
1100430667 12:94529332-94529354 CCTCATCTCAAAAAAAAGGAAGG + Intergenic
1100585257 12:95973417-95973439 CCTTATCTGTGAAATGAGGAAGG + Exonic
1100744349 12:97629108-97629130 CCTCATTTGCAAAAGGAGACTGG - Intergenic
1101173211 12:102120787-102120809 CTTCACCTGCAAAACCAGGAAGG - Intronic
1101330766 12:103755922-103755944 CCTCATCTATAAAATGGAGATGG + Intronic
1101347783 12:103902402-103902424 TCTCATCTGTAAAATGAGAATGG - Intergenic
1101398915 12:104371692-104371714 CCTCAGCTGGAAAATGGGGGTGG + Intergenic
1101722571 12:107362891-107362913 CCTCATCTACAAAATGGAAATGG - Intronic
1101827447 12:108231507-108231529 CCTCATCTGTAAAATGGGTTGGG - Intronic
1101849570 12:108391354-108391376 CCTCAACTATAAAATGAGAATGG + Intergenic
1101876631 12:108600336-108600358 CCTCCTCTGTAAAATGGAGATGG + Intergenic
1102016652 12:109652435-109652457 CCTCATCTGTAAAATGGGGCGGG + Intergenic
1102131978 12:110538750-110538772 CCTCATCTGCAAAACGGGGATGG + Intronic
1102171412 12:110845464-110845486 CCCCATCTGTAAAATGAGGATGG + Intergenic
1102469247 12:113150294-113150316 CAGCATCTGTAAAATGGGGAGGG + Intronic
1102514717 12:113438659-113438681 CTGCATCTGTAAAATGGGGATGG - Intergenic
1102738025 12:115180415-115180437 CCTCACTTGTAAACTGAGGATGG + Intergenic
1102854170 12:116278180-116278202 TCTCCTCTGCAAAAGGCGGACGG - Intergenic
1102946648 12:116995294-116995316 TCTCTTCTGTAAAATGAGGAGGG + Intronic
1102958079 12:117072422-117072444 CCTCATCTGGAAAGTGAGCATGG - Intronic
1103236075 12:119373686-119373708 CCTTATCTGTAAAATGAGATGGG + Intronic
1103335269 12:120184630-120184652 CCTTGTCTGCAGAATGGGGATGG - Intronic
1103446847 12:121000339-121000361 TCTCATCTGTAAAATGGGGGTGG - Intronic
1103475694 12:121216961-121216983 CCACTTCTGCCAAATGGGGATGG - Exonic
1103956078 12:124577615-124577637 CCTCATCTGTAAAATGGGGCTGG + Intergenic
1104098947 12:125588228-125588250 CCTTATCTATAAAATGGGGATGG + Intronic
1104152118 12:126093905-126093927 TCTCATCTGCTAAATGGGGATGG - Intergenic
1104157515 12:126148165-126148187 CTCCATCTGGAAAATGAGGATGG - Intergenic
1104199012 12:126568956-126568978 CCTGATGTGGAAAATGGGGAAGG + Intergenic
1104379586 12:128295434-128295456 TCTCATCTGTAAAATGGGGATGG - Intronic
1104481115 12:129109344-129109366 TCTCCTCTGCAAAATGGGGATGG + Intronic
1105618954 13:22048423-22048445 CCTCATCTGCCAAATGGACATGG - Intergenic
1105636757 13:22223085-22223107 CCTCATCTGTAAAATGAAGATGG - Intergenic
1105826020 13:24124296-24124318 TCTCATCTATAAGATGAGGAAGG + Intronic
1107303347 13:38991124-38991146 TCTCATCTGAAACATAAGGATGG - Intergenic
1107303531 13:38993144-38993166 TCTCATCTGTAAAATGGGGATGG + Intergenic
1107583337 13:41816228-41816250 TCTCATCTGTAAAATGGGAACGG - Intronic
1107631654 13:42349212-42349234 CCTCATCAGCAAAATGGGGATGG - Intergenic
1107863312 13:44681663-44681685 CCACATCTGCAAAATGACCCTGG - Intergenic
1107998820 13:45888157-45888179 CCTCATCTGCAAAAGAGGGATGG - Intergenic
1108186490 13:47893106-47893128 CCTCATCTGTAAAGTGAGTGAGG + Intergenic
1108687399 13:52832597-52832619 CCACATCAGCAAAATGGGAATGG + Intergenic
1108705287 13:52979941-52979963 CCTTATTTGCAAAATGTAGATGG + Intergenic
1109376099 13:61495266-61495288 CCTTATCTGTAAAATAAAGATGG - Intergenic
1109386658 13:61637759-61637781 CCTCTGCTGCTAAATAAGGAAGG + Intergenic
1109476338 13:62884496-62884518 TCTCATTTGCAAAATGATAATGG - Intergenic
1109862170 13:68214238-68214260 CTTCATCTGTAAAATGAAGTGGG + Intergenic
1110356681 13:74575454-74575476 CCTCACCTGCAAAACAAGGGTGG + Intergenic
1110466963 13:75813397-75813419 TCTCACCTGCTAAGTGAGGAAGG - Intronic
1111771046 13:92596100-92596122 CTTCATCTGAAAAATTAAGAGGG - Intronic
1111831458 13:93335416-93335438 CCTCCTCTTCAAACTAAGGATGG - Intronic
1111861733 13:93715730-93715752 TCTCATGTGCAAAATGGGAATGG + Intronic
1112030364 13:95451002-95451024 CCTCACCTGCAAAACGGGCATGG - Intronic
1112373758 13:98819548-98819570 CCACATTTGCAAAATGAAGTAGG + Intronic
1112818540 13:103302654-103302676 TTTCATCTGTAAAATGGGGATGG + Intergenic
1113333200 13:109352173-109352195 ACTCATCTGTAAAATGGAGATGG - Intergenic
1113482960 13:110635047-110635069 CCTCATCTGTAATGTGATGATGG + Intronic
1113673666 13:112194031-112194053 GTTTATCTACAAAATGAGGAAGG - Intergenic
1113699262 13:112372061-112372083 CCTGATCTGAAATACGAGGACGG - Intergenic
1113907675 13:113827521-113827543 CCTTATCTGTGAAACGAGGAGGG + Intronic
1114262668 14:21049606-21049628 GCTCATTTGCAACATGAGGAAGG - Intronic
1114267215 14:21079942-21079964 CCTCATCTATAGAATGCGGATGG + Intronic
1114411354 14:22503532-22503554 TCTCATCTGTAAAATGGGGATGG + Intergenic
1114539897 14:23447195-23447217 TCTTATCTGTAAAATGTGGATGG + Intergenic
1115157836 14:30360541-30360563 ACTCATTTGCTAAATGAGGTAGG + Intergenic
1115378977 14:32711878-32711900 CTTCATCTGTAAAGTGAGGGGGG + Intronic
1115509636 14:34126974-34126996 TCTCATCTGTAAAATAAGAATGG - Intronic
1115513502 14:34161492-34161514 ACTCATCTATAAAATGGGGATGG + Intronic
1115658678 14:35468484-35468506 GCTGATCTGCAGAATGATGAAGG + Intergenic
1116001968 14:39253416-39253438 CCTAATTTGAAAAATGGGGAGGG - Exonic
1116135063 14:40912515-40912537 CCTAATCTATAAAATGAGAATGG + Intergenic
1116815367 14:49578988-49579010 CCTCATTTGTAAAATGGGGACGG + Intronic
1116853935 14:49935508-49935530 CTCCATCTGTAAAATGAAGATGG + Intergenic
1117196007 14:53340777-53340799 CCTCATCTGTAAAACGGGGGTGG + Intergenic
1117653546 14:57931080-57931102 CTTCCTCTGTAAAATGAGGGAGG - Intronic
1117838326 14:59830736-59830758 TCTGATCTGCAAAATGAGGATGG + Intronic
1117852257 14:59986819-59986841 CCTTATCTGTAAAATGACTAAGG - Intronic
1118055887 14:62079432-62079454 CCTCAACTGTAAAATGGAGATGG - Intronic
1118160731 14:63287332-63287354 CCTGAGCTGTGAAATGAGGATGG + Intronic
1118316113 14:64727136-64727158 CCTCACCTGTAAAATGAGGATGG - Intronic
1118348701 14:64958366-64958388 CCTCTTCTGCCATGTGAGGATGG + Intronic
1118377723 14:65191579-65191601 CCTCAAGGGCAAAAGGAGGAAGG + Intergenic
1118584188 14:67336695-67336717 CCTCATCTGCAAAGTGGAGATGG + Intronic
1118595180 14:67429903-67429925 CTTCATTTGTAAAATGAGGAAGG - Intergenic
1118599371 14:67460968-67460990 TCTCATCTGTAAAATGGAGATGG - Intronic
1118608173 14:67518343-67518365 TCTCATCTGCAAAATGGAAATGG + Intronic
1118666912 14:68080176-68080198 TCCCATTTGCAAAATAAGGATGG + Intronic
1118769377 14:68931649-68931671 CCACATCTGTAAAATGGGGATGG + Intronic
1118771152 14:68943565-68943587 CCCCATCTTGAAACTGAGGATGG - Intronic
1119060536 14:71469693-71469715 TCTCATGTGAAAAATGAGGAAGG + Intronic
1119092694 14:71799448-71799470 CCTTATCTGGAAAATGAGACTGG + Intergenic
1119548365 14:75489966-75489988 CTTCATCTGTAAAATGTGGGGGG + Intergenic
1119643736 14:76333978-76334000 CCCCATCTGTAAAATGGGGCAGG + Intronic
1119812935 14:77538978-77539000 CTTCATCTGCAAAATGGGAATGG + Intronic
1119902496 14:78273292-78273314 CCTTATCTGTAAAATGAGTGTGG + Intronic
1119996950 14:79263587-79263609 TCTCCTCTGTAAAATGAGGGAGG + Intronic
1120011406 14:79419740-79419762 CCTCATTGACAAAATGAGGATGG + Intronic
1120514331 14:85452400-85452422 CCTTATCTGCAGAATGGGGGTGG + Intergenic
1120674614 14:87406452-87406474 CCTCACCTGTAAAGTGAGCACGG + Intergenic
1120845668 14:89122811-89122833 CCTCCTCTGAAAAATGGGGGAGG - Intergenic
1120885012 14:89445243-89445265 CCCCATCTGTAAAATGGGGATGG + Intronic
1120983301 14:90310382-90310404 CCTCATTTGTAAAATGAAGAGGG + Intronic
1121075918 14:91068223-91068245 CCTCATCTGCAATGCTAGGAAGG - Intronic
1121095546 14:91215826-91215848 CTTCATCTGTAAAATGGGGGTGG + Intronic
1121096920 14:91223853-91223875 GCTTATCTGTAAAATGGGGAGGG - Intronic
1121248468 14:92482164-92482186 CCTCATCTGTTAAATGAGAAAGG - Intronic
1121265146 14:92597046-92597068 CCTCATCTAGAAAATGCGGATGG + Intronic
1121314036 14:92950563-92950585 CCTCATCTGTAAAACGGGAAGGG - Intronic
1121495632 14:94389898-94389920 CCCTATCTGTAAAATGGGGATGG + Intronic
1121545922 14:94763630-94763652 CCTCACCTGCAAAATGGGCTTGG - Intergenic
1121601083 14:95203329-95203351 CCTCTTCCTCATAATGAGGACGG + Exonic
1121642833 14:95497289-95497311 TCTCATCTGTAATATGGGGATGG + Intergenic
1121702257 14:95963489-95963511 ACTCATCCGCAAAATGGGGATGG - Intergenic
1121969318 14:98342038-98342060 CCTCAAATGAAAAATGGGGATGG - Intergenic
1122006195 14:98705868-98705890 CCTCACCTGTGAAATGGGGAGGG + Intergenic
1122059531 14:99127406-99127428 CCTCATCTGCAAAGCAGGGATGG - Intergenic
1122074870 14:99229530-99229552 CTCCATCTGCAAAATGGGGATGG + Intronic
1122107283 14:99468019-99468041 TGTCATCTGAAAGATGAGGATGG - Intronic
1122118242 14:99538160-99538182 CTGCACCTGGAAAATGAGGATGG - Intronic
1122267987 14:100555546-100555568 CCTCATCTGGAAAACGGGGTGGG - Intronic
1122623464 14:103072642-103072664 CCTTATCTGCACAGTGAGGAGGG - Intergenic
1122886320 14:104712014-104712036 CCTCATCTATACAATGAGGGAGG - Intronic
1123762713 15:23445099-23445121 TCACATCTGTAAAATGGGGATGG - Intronic
1123800503 15:23814853-23814875 CCTCATTTGCTAAATGGAGATGG + Intergenic
1124026646 15:25972985-25973007 TCTCTTCTTCAAAATGGGGAGGG + Intergenic
1124334494 15:28846852-28846874 TCACATCTGTAAAATGGGGATGG - Intergenic
1124455108 15:29835021-29835043 CCTCATCTGCAGAATGGAGGAGG + Intronic
1124486070 15:30117759-30117781 CCTCATCTGTAAAATTGGGATGG + Intergenic
1124517508 15:30379510-30379532 CCTCATCTGTAAAATTGCGATGG - Intronic
1124541142 15:30586745-30586767 CCTCATCTGTAAAATTGCGATGG + Intergenic
1124547851 15:30648528-30648550 CCTCATCTGTAAAATTTCGATGG + Intronic
1124641205 15:31397633-31397655 CCCCATCTATAAAATGAAGATGG + Intronic
1124757514 15:32420842-32420864 CCTCATCTGTAAAATTGGGATGG - Intergenic
1124783308 15:32656273-32656295 CGTCATCTGGAAAAAGAGGGAGG + Intronic
1124841094 15:33242923-33242945 CCTCATTTGTAAAATGGAGAGGG - Intergenic
1125421051 15:39504420-39504442 CTTCCTCTGTAAAATGAGGCTGG - Intergenic
1125591320 15:40856259-40856281 CCTTCTCTGCAGAATGATGAGGG - Exonic
1125702219 15:41696973-41696995 CCTGATCTGGAAGATGTGGATGG + Exonic
1125732385 15:41900509-41900531 CCCCATCTGTAGAATGGGGAGGG - Exonic
1126928176 15:53614764-53614786 CCTCATTTACAAAATGAGGTGGG - Intronic
1127060403 15:55177037-55177059 TCTCATCTGCACAATAAGAAGGG + Intergenic
1127295197 15:57602776-57602798 CCTCATCTGAAAAATGGGGCAGG + Intronic
1127310097 15:57744853-57744875 CCACATCTGCAGAATGGGGCTGG - Intronic
1127709105 15:61577990-61578012 CCTCATCTGTAAAATGGAGGTGG + Intergenic
1128522501 15:68385115-68385137 CTTCATCTGTAAAATGGGTATGG - Intronic
1128547340 15:68577358-68577380 ACTCATCAGCAAAATGGGGACGG + Intergenic
1128610480 15:69069161-69069183 CTTCATCTCTAAAATGGGGATGG - Intergenic
1128650169 15:69405954-69405976 CTTCCTATGCAAAATGAGAAGGG + Exonic
1128670744 15:69573032-69573054 CATCATCTGCTAAAGTAGGAAGG + Intergenic
1128704213 15:69826969-69826991 CCTTCTCTGCAAAATTAGGAAGG - Intergenic
1128725703 15:69987023-69987045 CCCCATCTGTGAAATGAGGAGGG - Intergenic
1128749515 15:70139073-70139095 CTTCATCTGTGAAATGGGGATGG + Intergenic
1128749649 15:70139932-70139954 CTTCATCTGTGAAATGGGGATGG + Intergenic
1128765339 15:70247920-70247942 CCTCACCTGTAAACAGAGGAGGG - Intergenic
1128790519 15:70430079-70430101 CATCTCCTTCAAAATGAGGATGG - Intergenic
1128793005 15:70446893-70446915 CCTCATCTGTAAAACAAGGATGG + Intergenic
1128869121 15:71138976-71138998 CTTCATCTGTAAAATGGGGGGGG - Intronic
1128890646 15:71328920-71328942 CCTGATCTGTAGAATGAGGCTGG + Intronic
1128910427 15:71508615-71508637 CCTCATCTGCAAAGTAAAGGGGG + Intronic
1129052765 15:72796742-72796764 CCCCATCTGCAGAATGGGGATGG + Intergenic
1129356170 15:74993594-74993616 CCACATATGTAAAATAAGGATGG - Intronic
1129600446 15:76995340-76995362 AATCAGCAGCAAAATGAGGAAGG - Exonic
1129937701 15:79464441-79464463 CCTCATTTGTAAACTGAAGATGG - Intronic
1130123903 15:81076131-81076153 CTTCAATTGCAAAATTAGGAAGG - Intronic
1130423020 15:83767158-83767180 GTTCACCTGCAAAATGGGGATGG + Intronic
1130519018 15:84648089-84648111 CCTTATCTGTGAAATGAGGGTGG - Intronic
1130911750 15:88275694-88275716 GCTCCTCTGAAAAATAAGGATGG + Intergenic
1130926177 15:88387592-88387614 CCTTATCTGTAAAATGGGGATGG + Intergenic
1130927039 15:88393300-88393322 CTTTATCTGTAATATGAGGATGG + Intergenic
1130977575 15:88789172-88789194 CCTCCTTTGCCAAATGAAGAAGG + Intergenic
1131469672 15:92685002-92685024 CCTCCCCTGTAAAATAAGGATGG + Intronic
1131515918 15:93076710-93076732 CTTCATCTGCAAAATGAGGATGG - Intronic
1131645003 15:94331958-94331980 CCTTATCTGCAAAAGAAAGATGG + Intronic
1131737574 15:95350144-95350166 CCTCATCTGGAAAATGAGGAGGG + Intergenic
1131941576 15:97572455-97572477 CATCATCTGCTAAAAGAGAATGG - Intergenic
1131966665 15:97851509-97851531 CATGATCTGAAAAATTAGGAAGG + Intergenic
1132175662 15:99711931-99711953 CCTCATCTGGAAAATGGGGATGG + Intronic
1132895431 16:2226959-2226981 CCTCATCTGTAAAATGGGCTGGG - Intronic
1133378577 16:5310515-5310537 CCTCATCTGTATATGGAGGAGGG + Intergenic
1133411093 16:5569571-5569593 CCTCATCTGTGAAATGGGGATGG - Intergenic
1133463981 16:6012202-6012224 CCTCATCTGTAGAATGAGGATGG + Intergenic
1133602087 16:7349593-7349615 CCTCAGAATCAAAATGAGGATGG + Intronic
1133777186 16:8905980-8906002 CCTCATCTGCCAAATGAGTATGG + Intronic
1133862598 16:9610199-9610221 CCTCATCTGTTAAATGGAGATGG + Intergenic
1133872795 16:9705227-9705249 CCTCATCTGTAAAAGGCGGATGG - Intergenic
1133921751 16:10159622-10159644 CCTCATCTGTAAAATGGGATTGG - Intronic
1134080201 16:11319699-11319721 CCTGCTCTGCAAAGGGAGGATGG - Intronic
1134095600 16:11416446-11416468 CCTCATCTGCAGAATGGGAATGG + Intronic
1134213596 16:12298500-12298522 TCTCATCTGTAAAATGGGAATGG + Intronic
1134237982 16:12482717-12482739 ACTCATCTGACAAATGAGAAAGG - Intronic
1134260200 16:12644990-12645012 CTTCATCTGTAAAATGGGGAAGG - Intergenic
1134435122 16:14249625-14249647 CCTCATCTTTAAAATGAAGTTGG + Intronic
1134448570 16:14349008-14349030 CCTCACCTGCAAAATGGGGCAGG - Intergenic
1134483393 16:14637460-14637482 TCTCATCTGTAAAATGAACATGG + Intronic
1134785035 16:16934525-16934547 CCTCAAGTGTAAAATGGGGATGG + Intergenic
1135160156 16:20087199-20087221 CCTCATCTGTAACATGGAGAAGG - Intergenic
1135169100 16:20167219-20167241 CCCCATCTGTAAAATGGGGTAGG + Intergenic
1135458732 16:22622625-22622647 CCTCATCTGTAAAATGGCAAAGG - Intergenic
1136065425 16:27755195-27755217 CCTCATCTCCAAAATGAAGCTGG + Intronic
1136067209 16:27767267-27767289 CCTCATCTATAAAATGAGGAGGG + Intronic
1136067612 16:27769453-27769475 CCTCATCTGTTAAATGGGCACGG - Intronic
1136098649 16:27977131-27977153 TCTCATCTGTAAAATGGGAATGG - Intronic
1136112043 16:28069737-28069759 CCTCGTCTGTGAAATGAGGGCGG + Intergenic
1136158159 16:28399523-28399545 TCTCATCTGTAAAATAAGGCAGG - Intronic
1136204928 16:28715760-28715782 TCTCATCTGTAAAATAAGGCAGG + Intronic
1136224133 16:28847138-28847160 CCTCATCTGCAAAATTAGATGGG - Intronic
1136369355 16:29826251-29826273 CCTCATCTACAAAATGAGAATGG - Intronic
1136372317 16:29844140-29844162 CCTCATCTGTAAAATGGGGGTGG + Intronic
1136500524 16:30667779-30667801 CCTCATCTGTAAAATGAGTAGGG + Intronic
1136517085 16:30774741-30774763 CAGCACCTGCAAGATGAGGAAGG - Exonic
1136556103 16:31008698-31008720 CCTGCTCTGCAAACTGAGGAGGG + Intronic
1136688161 16:32008289-32008311 CCCCATCTGTAAAATGGGGATGG - Intergenic
1136788765 16:32951844-32951866 CCCCATCTGTAAAATGGGGATGG - Intergenic
1136881048 16:33902090-33902112 CCCCATCTGTAAAATGGGGATGG + Intergenic
1137571666 16:49570332-49570354 TCTTATCTGTAAAATGGGGATGG - Intronic
1137586854 16:49668884-49668906 CCTCAACTATAAAATGAAGATGG + Intronic
1137598691 16:49741866-49741888 CCTCACCTAGAAAATGAGGATGG + Intronic
1137605935 16:49786775-49786797 CCTCATCTGTCAAATGAGGATGG + Intronic
1137614213 16:49837331-49837353 CCTCAACTGGCAAATGAAGAGGG + Intronic
1137768795 16:50998020-50998042 CCCCAACTGCAAAATGGGGGCGG - Intergenic
1137943763 16:52714450-52714472 TCTGACCTGGAAAATGAGGAGGG - Intergenic
1138121679 16:54405364-54405386 CCTCATCTGTAGAATGGGAAGGG + Intergenic
1138139833 16:54558644-54558666 CCTCATCTGTAAAATGGGGATGG + Intergenic
1138139987 16:54559801-54559823 CCTCATCTGTAAAATGGGGATGG - Intergenic
1138339008 16:56276296-56276318 CCTCATCTGCAAAATAAATCCGG - Intronic
1138537537 16:57667901-57667923 CCTCCTCTGTAAAGTGAAGATGG - Intergenic
1138555264 16:57767152-57767174 CATCATCTGTAAAATGGGGATGG - Intronic
1138576379 16:57909897-57909919 CCTCAGCTGTAAAATGGGAATGG + Intronic
1138598220 16:58040772-58040794 CCTCATCTACAAAATGGGGATGG - Intronic
1138741821 16:59319756-59319778 CCTCATCTGTACAATGGGAATGG + Intergenic
1138835629 16:60431105-60431127 TCCTATCTGTAAAATGAGGAAGG - Intergenic
1138855143 16:60681697-60681719 CCTCCTCTGTAAAATGAAGCAGG + Intergenic
1138898482 16:61239810-61239832 CCTCATTTCCAAAAGGAGTAGGG - Intergenic
1139365245 16:66428618-66428640 CCCCATCTGGAACATGGGGAAGG + Intronic
1139375563 16:66494380-66494402 CCTCATCTGTAAAGTGACTATGG + Intronic
1139824348 16:69745336-69745358 CCCCATCTGTAAAATGGAGACGG - Intronic
1140071134 16:71650834-71650856 CTTCATCTGTAAAATGAAAATGG + Intronic
1140238050 16:73176238-73176260 CCTCATCTGCCAAGTCAGAAGGG + Intergenic
1140739801 16:77931007-77931029 CTAAATCTGTAAAATGAGGAGGG - Intronic
1140838805 16:78819978-78820000 CAACATCTGTAAAATGGGGATGG + Intronic
1140989953 16:80201144-80201166 CCTCAACTGCAAAATGGGAATGG - Intergenic
1141096655 16:81167821-81167843 CCTCATCTGCAAGATGGGGGGGG + Intergenic
1141143386 16:81512471-81512493 TCCCATCTGACAAATGAGGAAGG - Intronic
1141271635 16:82546266-82546288 CCTGATCTGTAAAATCAAGATGG - Intergenic
1141309290 16:82897543-82897565 CCTCATCTATAAAATGGGGATGG - Intronic
1141310761 16:82911542-82911564 CTCCATCTGTAAAATGGGGATGG + Intronic
1141479630 16:84297808-84297830 CCTCACCTGGGAAATGAAGATGG + Intronic
1141544664 16:84757032-84757054 TCTCATCTGTAAAATGGGGTTGG + Intronic
1141586127 16:85034775-85034797 TCTCATCTGTGAAATGGGGACGG - Intronic
1141915077 16:87090259-87090281 CCTCCTCTTCAAAATGTGGATGG - Intronic
1141983763 16:87566208-87566230 CCTCCTCTGTAAAATGAGGGTGG + Intergenic
1141989163 16:87600701-87600723 TCTCATCTGTAAAATGGAGATGG - Intergenic
1141996453 16:87639208-87639230 CCTCATCTGCAACGAGGGGAGGG - Intronic
1142233712 16:88911597-88911619 TCTCATCTGTAAAATGGGAATGG + Intronic
1203090962 16_KI270728v1_random:1213333-1213355 CCCCATCTGTAAAATGGGGATGG - Intergenic
1142895187 17:2971664-2971686 CCTCATCTGTGAAATGATGATGG + Intronic
1143087565 17:4427549-4427571 TCTCACCTACAAAATGGGGATGG - Intergenic
1143258598 17:5582452-5582474 CCCCATCTGCCACATGGGGAGGG + Intronic
1143372578 17:6449544-6449566 CCTCATCTCAAACATGAGAAAGG + Intronic
1143392374 17:6567297-6567319 CCTTATCTGTAAAATGGGAATGG - Intergenic
1143439304 17:6956110-6956132 CTTCATCCATAAAATGAGGATGG + Intronic
1144036302 17:11369004-11369026 CTTCATCTGTAAAATGGGAATGG - Intronic
1144366562 17:14550194-14550216 GCTCAGCTGAGAAATGAGGAAGG - Intergenic
1144378531 17:14669708-14669730 CCTCATCTGTAAAATGTAGATGG - Intergenic
1144409677 17:14988508-14988530 CCTCATCTGTAAAATGGAGATGG - Intergenic
1144454959 17:15411370-15411392 CCTCCTCCTTAAAATGAGGAAGG + Intergenic
1144754534 17:17671173-17671195 CCTCATCTGTAAAATGGGGCTGG + Intergenic
1144765869 17:17732134-17732156 CTTCATCTGTAAAATGGGGATGG - Intronic
1144952073 17:18999845-18999867 CCTCAACTGTGAAATAAGGAAGG + Intronic
1145000659 17:19302290-19302312 TCTCATCTGCAGAATGGGGACGG - Intronic
1145142403 17:20456157-20456179 CGTCATCTGTAGAATGAGCATGG - Intronic
1145249315 17:21288681-21288703 CCTCATCTGCAGACTGAGAATGG + Intronic
1145255641 17:21320824-21320846 CCTCATCTGCAAATTGGGGCAGG + Intergenic
1145320973 17:21767124-21767146 CCTCATCTGCAAATTGGGGCAGG - Intergenic
1145771004 17:27493071-27493093 CATCATCAGCAGAATGATGAAGG - Intronic
1145853822 17:28132937-28132959 TTTCATCTGCAAAATGGGGATGG - Intronic
1145868745 17:28256802-28256824 CCTAATCTGTAAAATGGGGATGG - Intergenic
1145907844 17:28526025-28526047 CCTCATCTGCAACACGGGTATGG - Intronic
1146091893 17:29887557-29887579 CCTCATCTGTAAAATGAGGATGG + Intronic
1146134528 17:30307282-30307304 CCTCATCTATAAAATGGGAATGG - Intergenic
1146176903 17:30670943-30670965 CCTCATTTATAAAATGAGGATGG + Intergenic
1146350363 17:32087043-32087065 CCTCATTTATAAAATGAAGATGG + Intergenic
1146563189 17:33889232-33889254 CTTCATCTGAAAAACGAGGGGGG - Intronic
1146821694 17:35987984-35988006 CCTCATCTGAATCATCAGGATGG + Intronic
1146935827 17:36812168-36812190 CCTCATCTGTGAAATGGTGATGG - Intergenic
1146973777 17:37093855-37093877 CCTCATCTGTAAAATGGGGGTGG - Intronic
1147039796 17:37709800-37709822 CCTCATCTATAAAATGGGGGCGG - Intronic
1147149151 17:38503993-38504015 CCACATCTGTAAAATGGGGATGG - Intronic
1147246835 17:39127249-39127271 CCTCATCTGGGACCTGAGGAGGG + Intronic
1147442238 17:40454221-40454243 CCTCATCTCCAAAATGAGTGAGG - Intronic
1147493550 17:40894336-40894358 TTTCATTTGTAAAATGAGGATGG - Intergenic
1147551746 17:41448023-41448045 TCTCATCTGCAATGAGAGGAGGG + Intergenic
1148340783 17:46872365-46872387 CCTAATCTGTAAAATGGGGACGG + Intronic
1148588060 17:48794942-48794964 CCTCATCTGTAAGATGGAGATGG + Intronic
1148867083 17:50634439-50634461 CCTCATCTGTAAAATGGGAAGGG - Intergenic
1148908404 17:50926416-50926438 CCTCATCTGCAAAGTGATTGAGG + Intergenic
1148934585 17:51154691-51154713 CCTCATTTGTAAAATGAAGGGGG + Intronic
1148954974 17:51346032-51346054 TCTCATCTGTGAAATGAGCATGG + Intergenic
1148986659 17:51628434-51628456 CCTCCTCTGCGAAATGGGGGAGG - Intergenic
1148992809 17:51681191-51681213 TCTGATCTGCAAAATGGGTATGG + Intronic
1149346475 17:55741568-55741590 CCTCATCTGTAAAATGAAAGTGG + Intergenic
1149440064 17:56666370-56666392 CCTCTGCTGCAAAGTGGGGAGGG + Intergenic
1150143775 17:62751291-62751313 CCTCACCTGCAAAACGAGACGGG + Intronic
1150233319 17:63571626-63571648 CCTTTTCTGAAAAATGAGGATGG + Intronic
1150390382 17:64786712-64786734 CCTCATCTGCGATCTGCGGAGGG + Intergenic
1150802551 17:68292908-68292930 CCAGATCTGTAAAATGGGGATGG + Intronic
1151175288 17:72283389-72283411 CCTCTTCTGCAAGAAGAAGATGG - Intergenic
1151340417 17:73467393-73467415 CCTCATCTGTAACATGGAGATGG + Intronic
1151676576 17:75601858-75601880 CCTCACCTGTAAAATGGGTATGG + Intergenic
1151796881 17:76352792-76352814 CCTCATCTGTGAAATGGGCATGG - Intronic
1151806425 17:76408375-76408397 GCGTATCTGCAAAATGAGCATGG - Intronic
1151929818 17:77225291-77225313 CCTTATTAGCAGAATGAGGATGG - Intergenic
1152156833 17:78639532-78639554 CCTCAACCACCAAATGAGGAAGG + Intergenic
1152227315 17:79098464-79098486 CTTCATCTGCAAAATGGGGAGGG - Intronic
1152409714 17:80117289-80117311 GCTCATCTGGGAAATGGGGATGG - Intergenic
1152498629 17:80693478-80693500 CCTCTTCTGCAAATTAAGGAAGG + Intronic
1152625464 17:81386258-81386280 GCTCATCTGTAAAATGGGCATGG + Intergenic
1152690236 17:81714664-81714686 CCTCATCTGCAGAAGGAGAATGG + Intronic
1153415527 18:4841746-4841768 CCTTACCAGTAAAATGAGGATGG + Intergenic
1153466088 18:5389374-5389396 GCTGATCTGTAAAATCAGGAAGG + Intergenic
1153487810 18:5618153-5618175 ACTCAGCTGTAAAATGGGGAAGG + Intronic
1153519889 18:5941664-5941686 CCGCATCTGTAAAGTGAGGGTGG + Intergenic
1153680126 18:7492541-7492563 CCTCATTTGTAAAATGGGGATGG + Intergenic
1153750663 18:8226907-8226929 CCTCATCTCCAAAGGCAGGAAGG + Intronic
1154318557 18:13325717-13325739 CCTCATCTGTAATGTGGGGATGG + Intronic
1154999832 18:21675240-21675262 CCTCATCTGTGGAATGAGGTGGG + Intronic
1155137014 18:23005858-23005880 TTGCATCTGCATAATGAGGAGGG - Intronic
1155210648 18:23597821-23597843 CCTCAACTGTAAGATGGGGATGG + Intergenic
1155346278 18:24860264-24860286 CAGCATCTGTAAAATGGGGATGG + Intergenic
1155579489 18:27287013-27287035 CCTCATTTATAAAATGAGAATGG - Intergenic
1155616010 18:27722446-27722468 CCCCACCTACAAAATGAGAATGG + Intergenic
1155967454 18:32049346-32049368 CATCATTTGTAAAATGGGGATGG + Intronic
1156190923 18:34719425-34719447 CTTCATCTGTAAAATAAAGATGG - Intronic
1156232884 18:35172123-35172145 CCCCATTTGCCATATGAGGAAGG + Intergenic
1156384703 18:36594584-36594606 CCTCATCTGCACAATGGGGATGG + Intronic
1157185312 18:45535495-45535517 CCTCATCTGTAAGATGAGGATGG - Intronic
1157198834 18:45642003-45642025 CCTCATCTGTAAAATGGGCCAGG - Intronic
1157462699 18:47914785-47914807 ACACATCTGAAAAATAAGGAAGG - Intronic
1157491526 18:48127121-48127143 CCCCATTTGCAAAATGGGGATGG - Intronic
1157514371 18:48300460-48300482 CCTCAGCTGCAAAATGAGGGTGG - Intronic
1157514905 18:48304005-48304027 CTTCATCTGCAAGATGGGGGTGG - Intronic
1157528255 18:48401571-48401593 CCCCATCTGCAGTATGGGGATGG + Intronic
1157562213 18:48656365-48656387 CCCCATCAGTAAAATGGGGATGG + Intronic
1157597664 18:48873684-48873706 CCCCATCTGTAAAAGAAGGATGG + Intergenic
1157932847 18:51842209-51842231 ACTCAACAGTAAAATGAGGATGG - Intergenic
1158451384 18:57568970-57568992 CCTCAGCTAGAAAATGGGGATGG - Intronic
1158479088 18:57804459-57804481 CCTCATTTGTAAAATGAGATTGG + Intergenic
1158667876 18:59449210-59449232 CCTCATCTATAAAATGGGGATGG + Intronic
1158911401 18:62066357-62066379 CCTCATCTGTAAAATGGAGATGG + Intronic
1159095155 18:63893861-63893883 CCTCATCTGTAAAATGAGTACGG - Intronic
1159442758 18:68502848-68502870 CCTTGTCTGCAAAATGGGGATGG - Intergenic
1159503544 18:69305221-69305243 CCTTGACTGCAAACTGAGGAGGG - Intergenic
1159863715 18:73680542-73680564 TTTCATCTGTAAAATGAGCATGG - Intergenic
1160117968 18:76099810-76099832 CCTCATCTGTACAGTGAAGAGGG + Intergenic
1160159462 18:76460259-76460281 CCTCGTCTGTGAAATGAGGGTGG - Intronic
1160557995 18:79738437-79738459 CCTCACCTGTGAAATGAGGTAGG + Intronic
1161067087 19:2243983-2244005 CCTCATCTGGAAGACGGGGACGG - Intronic
1161418474 19:4161608-4161630 TCTCATCTGCAAAATGGGTTTGG - Intronic
1161420385 19:4173325-4173347 CCTCGCCCGCAAAATGAGCAGGG - Intergenic
1161475515 19:4482771-4482793 CCTCATCTGCAGAATCAGGCTGG + Intronic
1161616907 19:5276019-5276041 CCTCACATGTAAAATGGGGATGG - Intronic
1161631843 19:5360925-5360947 CCCCATCTGTAAAATGGGGCTGG - Intergenic
1161692568 19:5745320-5745342 CTACATCTTCAAAATGAGGCCGG + Intronic
1162048096 19:8014783-8014805 CCTCATCTCTAAAATGGGGGTGG + Intronic
1162144721 19:8606652-8606674 CCTCATCTATAAAAAGATGAGGG - Intronic
1162416774 19:10543462-10543484 CCTCATGTGCAAAATAGGGCTGG - Intergenic
1162552064 19:11363627-11363649 CCTTATCTGAAAAATGGGGATGG + Intronic
1162918963 19:13889289-13889311 CCTGGTCTGCAGAATGAGGCAGG + Exonic
1162981916 19:14245967-14245989 CCTCATTTATAAAATGAGGATGG - Intergenic
1163273386 19:16267547-16267569 TCTCATCTGTGAAATGGGGATGG + Intergenic
1163481415 19:17558830-17558852 CCTCATCTGTAACATGGGGGTGG - Intronic
1163595852 19:18220703-18220725 CCTCATCTGTAATATGAGTGTGG + Intronic
1163655279 19:18542274-18542296 CCTGTTCTGCAAAATGTTGAGGG - Intronic
1163791037 19:19306209-19306231 CCCCATCTGTAAAATCAGGGTGG - Intronic
1164052113 19:21592563-21592585 CTTCATCTGCAAAATGGAGATGG - Intergenic
1164298491 19:23937330-23937352 CCCCATCTGGGAAGTGAGGAGGG - Intronic
1164587301 19:29484055-29484077 CATCATCTGCAAAATGGGGCTGG - Intergenic
1164647260 19:29868317-29868339 CCTCATTTGCAAAATGGGAATGG - Intergenic
1164703336 19:30301926-30301948 CCACCTCTGCACACTGAGGAGGG + Intronic
1165123986 19:33581149-33581171 TCTCATCTGCAAAGTGAGGTGGG + Intergenic
1165394542 19:35557263-35557285 CCTCATCTGTAAGATGAGAATGG - Intronic
1166063906 19:40345391-40345413 CCTCAACTGCACAATAAGAATGG + Intronic
1166064547 19:40349545-40349567 CTTCATCTGCAAAATGCACACGG + Intronic
1166066471 19:40362260-40362282 CTCCATCTGCAAAATGGGCATGG - Intronic
1166097921 19:40553055-40553077 TCTCATCTGTAAAATGGAGATGG + Intronic
1166164659 19:40978867-40978889 TCTCATCTGTAAAATGAGAATGG - Intergenic
1166276004 19:41754495-41754517 CCTGATTTGTAAAAGGAGGATGG - Intronic
1166281255 19:41795539-41795561 CCTGATTTGTAAAAGGAGGATGG - Intergenic
1166412214 19:42563141-42563163 CCTGATTTGTAAAAGGAGGATGG + Intergenic
1166730055 19:45054087-45054109 CCTCATTTGGAAAATGACAATGG - Intronic
1166816672 19:45550512-45550534 CCCCAGCTGCAGAGTGAGGAGGG - Intronic
1167006891 19:46782159-46782181 CCTCATCTATAAAATGGGAACGG - Intronic
1167093582 19:47361142-47361164 GCTCATCTGAAAAATGACAATGG + Intronic
1167145181 19:47677080-47677102 CCTCGTCTGTGAAATGAGGAAGG + Intronic
1167457609 19:49605673-49605695 CCCCATCTGTAAAATGGGGATGG - Intronic
1167649313 19:50720727-50720749 CCCCCTCTGGAAAATGGGGATGG - Intergenic
1167740941 19:51324622-51324644 ACTCCTTTGCAAAATGGGGATGG + Intronic
1168297145 19:55383018-55383040 CCTCCACTGCAGAATGGGGATGG + Intronic
1168318020 19:55492563-55492585 CCTCATCTGCAGACAGGGGAGGG - Intronic
1168467795 19:56618283-56618305 CCTCATCAGCAAAATGAGGATGG + Intronic
1168490498 19:56804840-56804862 CCTCATCTGTAAAATGGGGCTGG - Intronic
1168492289 19:56821160-56821182 CCTCATCTGTAAAATGAATATGG - Intronic
924977051 2:187317-187339 CCTCATCTAAAGACTGAGGAAGG - Intergenic
925195002 2:1915595-1915617 CCTCATCTGCAAAGTGAGGCAGG - Intronic
925295677 2:2775009-2775031 CCTCAGCTGTAAAATGAGGATGG - Intergenic
925659427 2:6186663-6186685 TCTCATCTGGAACAAGAGGAAGG - Intergenic
925695252 2:6570008-6570030 CCTCATCTGCACAGTAAGGTAGG - Intergenic
925699408 2:6618684-6618706 TCCCATCTGCAAAACAAGGATGG + Intergenic
925852736 2:8098731-8098753 GCTCATCTGCAAAGAGTGGATGG + Intergenic
926049943 2:9738238-9738260 CCTCATCTGTGAAATGGGGATGG - Intergenic
926088500 2:10035142-10035164 TCTCATCTGTAAAATGGGGATGG - Intergenic
926347250 2:11958742-11958764 ACTTATATGAAAAATGAGGAGGG + Intergenic
926418800 2:12677223-12677245 CCTCAAGTACAAAATGATGATGG + Intergenic
926725992 2:15998412-15998434 CCTCAACTGTAAAATGGAGATGG - Intergenic
926737730 2:16086621-16086643 CCACATCTGTCAAATGAAGAGGG - Intergenic
926809012 2:16740075-16740097 CTTCATCTATAAAATGAGGAAGG - Intergenic
926882311 2:17559579-17559601 CATCATATGTAAAATGAGTAGGG + Intronic
926920650 2:17936837-17936859 CCTCATCTATAAAATGGGAATGG - Intronic
926928406 2:18011770-18011792 CCTCTTCTGTGAAATGGGGATGG + Intronic
927088664 2:19694095-19694117 CCTCATCTATAAAATGGGCAGGG + Intergenic
927150093 2:20190527-20190549 CCTCATTTGCGAAAAGAGGGTGG + Intergenic
927154723 2:20214946-20214968 TCTCATCTGTAAAATGTGCATGG - Intronic
927344256 2:22018924-22018946 CTTCATCTGCAAAATAAGGATGG + Intergenic
927600062 2:24432899-24432921 CCTCATTTGCAAAATGCTGGGGG - Intergenic
927973955 2:27323708-27323730 CTGCATCTGTAAAATGAGGGAGG + Intronic
928200399 2:29244279-29244301 CCTCATTTGTGAAATCAGGATGG + Intronic
928201498 2:29250295-29250317 CCTCATTTGTAAAACGAGGATGG + Intronic
928216691 2:29367411-29367433 GCTAATCTGTAAAATGAGGGAGG + Intronic
928253972 2:29706118-29706140 CCTCATCTGTAAAATGGAGTGGG + Intronic
928498824 2:31865361-31865383 TCTCATTTGTAAAATGTGGAGGG - Exonic
928540188 2:32277515-32277537 CCTCACCTGTAAGATGAAGAGGG - Intergenic
929024821 2:37589961-37589983 CCTCATTTTTAAAATGAGAACGG - Intergenic
929284194 2:40116988-40117010 CCTAATCTGTTAAATGGGGATGG + Intronic
929420250 2:41783044-41783066 CCTTTTCTATAAAATGAGGAGGG - Intergenic
929455294 2:42060868-42060890 CCTCATCTGCAAATTTCAGATGG + Intergenic
929670524 2:43873674-43873696 TCTCCTATGCAAAATGGGGATGG - Intronic
929697018 2:44126366-44126388 CCTCATTCATAAAATGAGGATGG - Intergenic
929969843 2:46564627-46564649 CCTCATCTGGACATAGAGGAAGG + Intronic
930247434 2:48999300-48999322 CCTCAACTCTAATATGAGGATGG - Intronic
930698708 2:54438183-54438205 GCTCATCTGTAAAATGATAAGGG - Intergenic
930884907 2:56314391-56314413 CCTCATCTGTGGAATGAGAAGGG + Intronic
931188096 2:59973284-59973306 CCTCATCTGTAAAATGGGGATGG - Intergenic
931434740 2:62236474-62236496 GCTCATCTGTTACATGAGGAAGG - Intergenic
931486150 2:62694708-62694730 CCTCATCTGTAAAATGGGAATGG - Intronic
931523498 2:63126419-63126441 CTTCATCTGTAAAATGAGAATGG - Intronic
931647758 2:64440628-64440650 CATCCTCTGGAAAATGAGCATGG - Intergenic
931753470 2:65350947-65350969 CCTCCTTTGCAAAATGAATAGGG + Intronic
931859326 2:66337665-66337687 CCTTATCTGTAATATGAGGAGGG + Intergenic
931914585 2:66939737-66939759 ACTTATGTGCAAAATGTGGAAGG + Intergenic
931989099 2:67771639-67771661 CCTCATCTGTCAAATGGAGATGG - Intergenic
932043351 2:68322308-68322330 CTTCATTTGTAAAATGATGATGG + Intergenic
932084356 2:68745168-68745190 TCTCATCTGAAAAATGGGGCCGG + Intronic
932266385 2:70370753-70370775 CCTCATCTGTAGAGTGAGGATGG + Intergenic
932414558 2:71565759-71565781 TATCATCTGTAAAATGAGGGTGG + Intronic
932516687 2:72358332-72358354 CCTCATTTATAAAATGAGAAAGG - Intronic
932834747 2:75025876-75025898 TCTCATCTGTAATATGGGGATGG + Intergenic
932910110 2:75797393-75797415 CCTCATCTGAAAAACGGAGATGG + Intergenic
933287177 2:80397348-80397370 CCTCATCTGTAAAATGAGCATGG - Intronic
933782254 2:85810912-85810934 CCTCATCTGTAAAACCAGGGCGG - Intergenic
934717663 2:96552863-96552885 CCCCATCTCCACAATGAGGAAGG - Intergenic
934771482 2:96910341-96910363 CCTCCTCTGCACAGTGAGGTTGG + Intronic
934934439 2:98454449-98454471 TCTCATCTGTAAAATGGGGAAGG + Intronic
935129404 2:100250071-100250093 CCCCATCTGCAAAATGAGGAGGG + Intergenic
935306026 2:101737286-101737308 CCTCATCACCAAAATAAGGGTGG - Intronic
935359272 2:102233674-102233696 TCTCATCTGTAAAATGGGGATGG + Intronic
935555661 2:104507215-104507237 CCTCGTCTGTAAAATGGAGATGG - Intergenic
935657173 2:105433476-105433498 CCTCATCTTAAAAATGAAGCCGG - Intronic
936410484 2:112254016-112254038 TCCCATCTGTAAAACGAGGACGG + Intronic
936434011 2:112487641-112487663 TCTCATCTGTAAAATGGGGATGG + Intronic
937156627 2:119724566-119724588 GATCCTCTGAAAAATGAGGATGG + Intergenic
937215501 2:120310262-120310284 CCTCATCTGTAAAATGAGGGGGG + Intergenic
937239335 2:120450256-120450278 ACTCATCTGCCAAATGAGGCTGG + Intergenic
937278820 2:120703591-120703613 ACTCAGCTGCAGAGTGAGGAAGG - Intergenic
937342201 2:121098482-121098504 CCCCATCTGTAAAATGGAGATGG + Intergenic
937343285 2:121105518-121105540 TCTCATCTGGGAAATGGGGATGG - Intergenic
937491837 2:122377592-122377614 CCTTATTTGCAAAATGAGGAGGG + Intergenic
937850111 2:126624370-126624392 CCTCATCTGGAAAATAAGGATGG - Intergenic
938509273 2:131923558-131923580 AATCAACCGCAAAATGAGGAAGG + Intergenic
938615362 2:132992120-132992142 CCTTATCTGTAAAATGGGAAAGG - Intronic
938833893 2:135079827-135079849 TCTCATCTATAAAATGAGGTTGG + Intronic
938917972 2:135963260-135963282 CTTCATCTGGAAAATGGAGACGG + Intronic
939620493 2:144413025-144413047 CCTCATCTGTAAAATGAGCCAGG + Intronic
939621127 2:144420482-144420504 CTTCAGCTGAAAAATGAGGGTGG - Intronic
940888361 2:159011101-159011123 TCTCATCTGTAAAATGGGGATGG - Intronic
940969467 2:159879762-159879784 CCTCACGTGTAAAATGATGATGG + Intronic
941034322 2:160551128-160551150 CCTCACCAGCAACATGGGGATGG + Intergenic
941203510 2:162543743-162543765 CCTCATCTATAAAATAAGGAAGG + Intronic
941907818 2:170734077-170734099 CCTTATCTGAAAACTGAGGAAGG + Intergenic
942268388 2:174249666-174249688 CCTCACTTGTAAAATGGGGATGG - Intergenic
942800598 2:179870955-179870977 CCTCATCTGATAAATAAAGATGG - Intergenic
943235949 2:185319764-185319786 CCTTATCTGCAAATTGAAGATGG + Intergenic
943272515 2:185825312-185825334 CCTCATCTATAAAATGAGTATGG - Intronic
943418473 2:187637261-187637283 CCCCATCTGGGAAGTGAGGAGGG - Intergenic
943418497 2:187637335-187637357 CCCCATCTGGGAAGTGAGGAGGG - Intergenic
944611132 2:201409150-201409172 CCTCATCTGTAAAATGGAGAAGG + Intronic
944617039 2:201471532-201471554 CCTCATCTGCGAAATGGGAGTGG - Intronic
944633062 2:201647194-201647216 TCTCATCTGTAAAATGATGATGG - Intronic
944635945 2:201676255-201676277 CCTCATTTCTAAAGTGAGGAAGG - Intronic
944977128 2:205066591-205066613 CTTCATCTGTAAAATGAGAAAGG + Intronic
944988996 2:205212947-205212969 CCCCATCTGTAAAATGGCGATGG - Intronic
944991588 2:205243481-205243503 TCTCATCTGTAGAATGAGAATGG + Intronic
945112062 2:206369340-206369362 CCTCATTTGTGAAATGAGGAAGG + Intergenic
945182323 2:207104609-207104631 CCTCATCTAGAAAATGGGGAGGG - Intronic
945665847 2:212741311-212741333 TCTTATCTGCAACATGAGGAAGG - Intergenic
945840529 2:214882319-214882341 CCTCTGCTGTCAAATGAGGAAGG - Intergenic
946046099 2:216822372-216822394 CCTAATCTGGAAAATGGGGATGG - Intergenic
946121849 2:217523214-217523236 TCTCATCTGCAAAATTAAGGTGG - Intronic
946465860 2:219911518-219911540 CCTCATTTGCAAAATAAAGATGG + Intergenic
946807884 2:223490017-223490039 CCTCATCTGAGAAATAGGGATGG + Intergenic
946853766 2:223933124-223933146 TCTCCTCTACAAAATGAGGCTGG - Intronic
947754438 2:232551158-232551180 TCTCATCTGCAGAGTGGGGACGG + Intronic
948021776 2:234739074-234739096 CCTGAACTGCAAAGGGAGGAGGG - Intergenic
948033325 2:234837482-234837504 CCTCATCTGTAAAATGCAGAGGG - Intergenic
948243251 2:236456269-236456291 CCTCATCTTAAAAATGAGGTAGG - Intronic
948447064 2:238041001-238041023 CCCCATCTGGAAAATGAGAAGGG + Intronic
948537838 2:238659199-238659221 CCTCTTCTGAACAATGAAGACGG + Intergenic
1168797274 20:620039-620061 CCTCATCTGTAAAATGAACTTGG - Intergenic
1168819100 20:761539-761561 CCTCCACTCCCAAATGAGGAAGG + Intronic
1168826588 20:818447-818469 CCTCATCTGTAGAATGAGTGAGG + Intergenic
1168845681 20:942961-942983 CCTCATCCATGAAATGAGGATGG + Intergenic
1168910787 20:1445123-1445145 CCCCATCTTTAAAATGAAGAAGG + Intronic
1168978548 20:1986176-1986198 CCTCATCTGTAAAGTGGGCATGG - Intronic
1169268079 20:4179746-4179768 CCTCTTCTGTAAAATGGGCATGG + Intronic
1169642317 20:7767735-7767757 GCACAACTGCAAAATAAGGATGG + Intergenic
1170057726 20:12225222-12225244 CTTCATCTGTGAAATGAGTACGG + Intergenic
1170357660 20:15509775-15509797 CTTCATCTGTAAAATAGGGAGGG + Intronic
1170401481 20:15989027-15989049 CTTCATCTGTAAGATGATGATGG + Intronic
1170415011 20:16130263-16130285 CTTCATCTGCAAAATGAAGGTGG - Intergenic
1170477597 20:16731006-16731028 CCTCATCAGTAAAATAAGAATGG - Intronic
1170509242 20:17059819-17059841 CCTCATCTTTCAAATGTGGATGG - Intergenic
1170542706 20:17405147-17405169 CCTCATCTTCAAAATGTAGGTGG - Intronic
1171213337 20:23333983-23334005 CATCACCTGCAAAATGATCAAGG + Intergenic
1171424168 20:25039172-25039194 CCTCATCAGGAAAGTGAAGAAGG - Intronic
1171490986 20:25516975-25516997 CCTCATCTGAATAATGGGTATGG + Intronic
1171564480 20:26167854-26167876 CCTCAGCAGCCACATGAGGAGGG + Intergenic
1171854221 20:30330191-30330213 CCTCACCTGTAAAAAGAGGGAGG + Intergenic
1171902356 20:30869341-30869363 CCTCCTCTACAAAATAAGGATGG + Intergenic
1172116802 20:32577879-32577901 CCTCATCTGGAAAATGGGAATGG - Intronic
1172131563 20:32659495-32659517 GCTCATCTGTACAATGAAGATGG - Intergenic
1172311468 20:33921571-33921593 TCTCGTCTGTAAAATGAGGACGG - Intergenic
1172330885 20:34075391-34075413 CCCCATATGCCAAATGAGGATGG - Intronic
1172505522 20:35459213-35459235 CCTTATCTGCAAGATGAGGGGGG + Intronic
1172557129 20:35852074-35852096 CCTCATCTGCAAAATAAGAATGG - Intronic
1172645686 20:36467886-36467908 CCTTATCTGCAAAACAGGGATGG - Intronic
1172807644 20:37624116-37624138 TCTCATCTGCAAAATGGGATTGG - Intergenic
1172890633 20:38261136-38261158 CTTCATCTGTAAAATGGGGTGGG + Intronic
1172933366 20:38601475-38601497 CCTCCTCTGTGAAATGGGGATGG - Intergenic
1173058231 20:39636659-39636681 TGTCATCTGCAGAATGAGAATGG - Intergenic
1173140166 20:40474973-40474995 GCTCATCTCAAAAATGTGGAAGG + Intergenic
1173153176 20:40585094-40585116 CCCCATCTGTAAAATAGGGATGG + Intergenic
1173153770 20:40590212-40590234 CCTTATTTGAAAAATGGGGAGGG - Intergenic
1173348770 20:42225395-42225417 TCTCATCTGTAAAATGGGAATGG - Intronic
1173556858 20:43972607-43972629 CCTCATCTGTTAAATGGGGATGG - Intronic
1173618702 20:44420001-44420023 CCTCATCTGTTAAATGAAAACGG - Intronic
1173644009 20:44622427-44622449 CCTCATTTGTAAGATGAGGACGG + Intronic
1173852985 20:46230487-46230509 CCTCAGCTGTGAAATGGGGATGG - Intronic
1173885254 20:46451794-46451816 CCTCATCTTTAAGATGAGCATGG + Intergenic
1173912404 20:46680022-46680044 CCCCATCTGTAAAATGGGTATGG + Intronic
1173958621 20:47053979-47054001 CCCCATTTGTAAAATGGGGATGG + Intronic
1174067261 20:47874629-47874651 TTTCATCTGCAAAATGGGGACGG + Intergenic
1174157036 20:48522242-48522264 TTTCATCTGCAAAATGGGGACGG - Intergenic
1174292842 20:49521204-49521226 ACTCATCTGTAAAATGGAGATGG - Intronic
1174365464 20:50053726-50053748 TCTCATCTGTAAAATGGGGATGG + Intergenic
1174546708 20:51331233-51331255 CCTCATCCGGCAAGTGAGGAGGG - Intergenic
1174684531 20:52441023-52441045 CCTAATCTGTAAAGTGGGGACGG - Intergenic
1174706811 20:52664751-52664773 TCTCATCTGCAAGATGAGGTGGG - Intergenic
1174993896 20:55544104-55544126 CCTCAACTGCAAGGTGGGGAAGG + Intergenic
1175019405 20:55828337-55828359 CCTAATCTGCAACATGGGGATGG + Intergenic
1175177934 20:57124690-57124712 CGTTATCTATAAAATGAGGAAGG + Intergenic
1175259423 20:57665213-57665235 CTTCATCTGCAAAATGGGCATGG - Intronic
1175300362 20:57938575-57938597 CTTTATCTGTAAAATGGGGATGG + Intergenic
1175465749 20:59190506-59190528 CCAGATCTGCAAAATGGGCAAGG - Intergenic
1175470007 20:59220933-59220955 CCTCATCTGTAGAATGGGGCTGG + Intronic
1175679248 20:60973499-60973521 CCCCATCTGTGAAATGAGTATGG + Intergenic
1175693779 20:61085830-61085852 TCTCATCTATAAAATGGGGAGGG - Intergenic
1175709557 20:61208307-61208329 CCTCATCTACAAAATGGGGGTGG + Intergenic
1175838847 20:62014187-62014209 CCTCATCTGCAAAGTAGAGATGG - Intronic
1176071458 20:63228869-63228891 CCTGAACTCCAAAAGGAGGAGGG + Intergenic
1176096618 20:63347278-63347300 GCCCATCTGCAAAACGGGGAGGG - Intronic
1176297300 21:5080909-5080931 CCTCATCTGGAGCATAAGGATGG - Intergenic
1176784212 21:13234986-13235008 AATCAACCGCAAAATGAGGAAGG - Intergenic
1177244538 21:18505864-18505886 CCTCAACTGAAAAATGAATAAGG - Intergenic
1177535182 21:22417329-22417351 CCTAATTTTAAAAATGAGGAAGG - Intergenic
1177650106 21:23949362-23949384 TCTCATCTGCAGAATGGGCATGG + Intergenic
1177918100 21:27116047-27116069 CCTCTTCTATAAAATGAGGAAGG + Intergenic
1178089091 21:29142796-29142818 CCTCCTCTGCAAAATGGGAAGGG - Intronic
1178235597 21:30837505-30837527 CCTCATGTATAAAATGAAGAGGG - Intergenic
1178248696 21:30979789-30979811 CCTTATCTGTAAAATGGGCATGG + Intergenic
1178294792 21:31400613-31400635 CCTTATCTGTAAAATGGGGTAGG - Intronic
1178303891 21:31474427-31474449 CCTCATCTGTAAGATGAGGATGG + Intronic
1178471482 21:32897433-32897455 CCTCATCTAGAAAACGAGGATGG - Intergenic
1178473524 21:32916826-32916848 TCTCATCTACAAACTGAGGGTGG + Intergenic
1178482282 21:32989942-32989964 GGTCATTTGCAAAATGGGGATGG + Intergenic
1178704522 21:34862215-34862237 CCTCATCAGCAAAATGAGGGGGG + Intronic
1179237696 21:39562127-39562149 CTTCATCTATAAAATGATGATGG + Intronic
1179426231 21:41280644-41280666 CCACATCTGCGGAATGTGGAAGG + Intronic
1179511608 21:41877475-41877497 CCTCATTTGCAAAGTGTGGATGG - Intronic
1179859729 21:44181039-44181061 CCTCATCTGGAGCATAAGGATGG + Intergenic
1179967600 21:44816499-44816521 CCTCATCTGTAAAGGGAGGGTGG + Intronic
1180335740 22:11575310-11575332 CCTCCTATACAAAATAAGGATGG + Intergenic
1180845516 22:18979106-18979128 CCTCACCTGGACTATGAGGATGG + Intergenic
1181200960 22:21216747-21216769 CCCCATCTGTAAAATGAGTCAGG - Intronic
1181316277 22:21972795-21972817 CCTCATCCCACAAATGAGGAGGG + Intronic
1181690757 22:24558525-24558547 TCTCATCTGTAAAATGGGGGTGG + Intronic
1181700781 22:24620226-24620248 CCCCATCTGTAAAATGAGTCAGG + Intronic
1181727723 22:24823128-24823150 CCTCATCTGTAAAGTAAAGAGGG + Intronic
1181862304 22:25828597-25828619 CCCCAACTGTTAAATGAGGATGG - Intronic
1181907041 22:26206474-26206496 CCTTATTTTCAAAATGGGGATGG - Intronic
1181912282 22:26248243-26248265 CTTCATCTGTAAAATGTGAATGG + Intronic
1181949392 22:26543075-26543097 CTTCAGCTGCAAAATCAGGGTGG + Intronic
1181997180 22:26892215-26892237 CCTCATCTGTAAAGTGGAGATGG - Intergenic
1182047309 22:27285413-27285435 CCTCATCTATAAAATGGGAAGGG - Intergenic
1182052093 22:27321140-27321162 CCTCATCTGTAAAATGGAAATGG + Intergenic
1182068488 22:27446693-27446715 TCTCATCTGTAAGATGGGGATGG + Intergenic
1182068722 22:27448266-27448288 CCTCATCTGCAGACTGAGCAGGG + Intergenic
1182086381 22:27563917-27563939 CCCCATCTGTAAAATGAAGAGGG + Intergenic
1182088823 22:27580265-27580287 CCTCATCTGCAAGCTGAGCAGGG - Intergenic
1182096055 22:27626808-27626830 CCTCATCTGCAAAATGGAGTTGG - Intergenic
1182096282 22:27628110-27628132 TTTCATCTGTAAAATGGGGATGG - Intergenic
1182115727 22:27755220-27755242 CCTCATCTGCAACTTGGGGGTGG + Intronic
1182117013 22:27762321-27762343 CCTCATCTATGAAATGGGGATGG + Intronic
1182126672 22:27821065-27821087 CCACGTCTGGAAATTGAGGACGG + Intergenic
1182131039 22:27850864-27850886 TCTCATCTATACAATGAGGATGG + Intergenic
1182151281 22:28028872-28028894 CGTCATCTGTGAAATGGGGATGG - Intronic
1182159011 22:28103284-28103306 CTTCATTTGCAAGAAGAGGAAGG + Intronic
1182168164 22:28197523-28197545 CTTCATCTCTAAAATGGGGAAGG + Intronic
1182243021 22:28932267-28932289 CCTCACCTGTAAAATAAGGCCGG + Intronic
1182247554 22:28971615-28971637 CCTCATCTGTAAAATAAGAATGG - Intronic
1182334603 22:29575371-29575393 CCCCATCTGTCAAATGAGCAGGG + Intronic
1182412058 22:30195654-30195676 CCTCATCTACAAAATGAGATTGG - Intergenic
1182413481 22:30206121-30206143 CCTCATCTGTAAATGGAGGCGGG - Intergenic
1182427987 22:30284931-30284953 CCTCGTCTGGAAAATGGTGATGG + Intergenic
1182823786 22:33244373-33244395 CCTCATCTGCACAATGGGGATGG - Intronic
1182882262 22:33743725-33743747 CATCATCTGTAAAATGGGGGTGG - Intronic
1182996244 22:34815478-34815500 CCTCATCTACAACATAAGGATGG - Intergenic
1183087038 22:35492713-35492735 CCTCATCTAGAAGATGAGGCTGG + Intergenic
1183255156 22:36757211-36757233 CCTCATTTGTAAAAGGGGGATGG + Intergenic
1183293403 22:37016520-37016542 CCTCATCTGTAAAATGGGTGAGG + Intronic
1183346497 22:37311187-37311209 CCCCATCTGTAAAATGGGCATGG - Intronic
1183368809 22:37420863-37420885 CCTCCTCTGGAAAATGAGGATGG + Intronic
1183414761 22:37675854-37675876 CCACATCTGTAAAATGGGGGTGG + Intronic
1183424664 22:37733115-37733137 CCCCTTCTGAAAAATGGGGATGG - Intronic
1183501920 22:38185400-38185422 CTTCATCTACAAAGTGGGGATGG - Intronic
1183630291 22:39028431-39028453 CCTCCTCTGTAAAATAGGGATGG + Intronic
1183641955 22:39098122-39098144 CCTCCTCTGTAAGATGAGAATGG + Intronic
1183687829 22:39371890-39371912 TCTTATCTGCAAAATGCTGATGG + Intronic
1183740492 22:39666138-39666160 CCTCTTCTGCAAAATGGGTAAGG + Intronic
1184032391 22:41902736-41902758 TCTCACCTGCAGAATGGGGAGGG + Intronic
1184330339 22:43823255-43823277 CTCCATCTGCAAAGTGAGGTGGG - Intergenic
1184340626 22:43884019-43884041 TCTCCTCTGCAAAATGAGACTGG - Intronic
1184340722 22:43884438-43884460 CTTCATCTGCAGAAGGTGGAGGG - Intronic
1184424744 22:44402886-44402908 TCTCATCTGCACAGTGGGGATGG + Intergenic
1184469040 22:44685114-44685136 CCTCTTCTGAAAAATGTGGGTGG + Intronic
1184581754 22:45422677-45422699 CTTCTTCTGTAACATGAGGATGG + Intronic
1184606255 22:45576414-45576436 CCTCACCTGTAAGGTGAGGAAGG - Intronic
1184628957 22:45760698-45760720 CCTCATCTGCAACATGGGAGAGG - Intronic
1184658587 22:45954876-45954898 GCACACCTGCAAAATGAGGATGG - Intronic
1184697079 22:46145776-46145798 CCTCATCTCTAAAATGGGGCAGG - Intergenic
1184813653 22:46854266-46854288 CCTCATTTGTAAAATGGGGATGG + Intronic
1185190691 22:49434064-49434086 CCTCATCTGCCCCGTGAGGATGG - Intronic
949409385 3:3747386-3747408 TCTCATCTGTCAAATAAGGAGGG + Intronic
949510041 3:4759540-4759562 CCTCATCTGTGAAATGTGGAAGG + Intronic
949807279 3:7969623-7969645 CCTCCTCTGTAAAATGAAGGTGG - Intergenic
950114102 3:10439281-10439303 CCCCATCTGGAAAATAAAGAAGG - Intronic
950152549 3:10698825-10698847 GCTCCTCTGTAAAATGGGGATGG + Intronic
950154651 3:10712528-10712550 CCTCAACTGCAAAATGGGGATGG - Intergenic
950189606 3:10967416-10967438 CCTCATCTGTGAAATGCAGACGG - Intergenic
950374560 3:12560060-12560082 CCTCATCTGTGAAATGAGGATGG + Intronic
950481940 3:13249690-13249712 CCTCTTCTGAAAAACGAGGTGGG + Intergenic
950521382 3:13499949-13499971 CCTCATCTGTAAAATGGGGATGG + Intronic
950648636 3:14393437-14393459 GTCCATCTGTAAAATGAGGATGG - Intergenic
950654971 3:14430919-14430941 CCTCATCTGTAAAATGGGCTTGG + Intronic
950669030 3:14514153-14514175 CCTCATCTGTAAAATGGGGCTGG + Intronic
951463610 3:22977700-22977722 CTTTATCTGTACAATGAGGACGG + Intergenic
951589442 3:24247434-24247456 CCCCAACTGTAAAATGTGGATGG - Intronic
951793122 3:26508484-26508506 CCTCCTGTGTAAAATGAGGTCGG - Intergenic
951977246 3:28526073-28526095 CCTCATATGTAAAATGGGGATGG + Intronic
952654865 3:35773328-35773350 CATCATCTGTAAAATAGGGAAGG - Intronic
952684163 3:36130513-36130535 CCTCAAATTCAAAATGAGAAAGG + Intergenic
952844837 3:37679556-37679578 CTTCATCTGTAAAATGTGAAGGG + Intronic
952986575 3:38790767-38790789 CATTATCTGTAAAATGGGGATGG + Intronic
953227260 3:41032205-41032227 CCTCATCTGTAAAACGGGGTTGG - Intergenic
953312655 3:41894677-41894699 CCTCATCTGTAAAATTGGGATGG - Intronic
953591709 3:44262923-44262945 CCTCACATGCAAAATGAGGGTGG - Intronic
953746677 3:45579631-45579653 CCATTTCTGCCAAATGAGGATGG + Intronic
953861749 3:46550216-46550238 CCTCATCTGCAAATTAGGGATGG + Intronic
953943603 3:47125554-47125576 CCTCATCTGTAAAACAAGTAAGG - Intronic
954446302 3:50548721-50548743 CTTCATCTGTAAAATGGGGCAGG - Intergenic
954619272 3:51986398-51986420 CCTCATCTGTAAAAGCAGCAGGG - Exonic
954619839 3:51989243-51989265 CCTCATCTGTGAAATGGAGATGG - Intergenic
954685163 3:52366324-52366346 CCTCATCTATAAAATGAGGATGG - Intronic
954845177 3:53549495-53549517 CCTCAGCTGTAAAATGAGGTAGG + Intronic
954914671 3:54138718-54138740 CCCCAAATGCAGAATGAGGATGG - Intronic
955071129 3:55573261-55573283 CCTCATCAGTAAAATGGGTATGG + Intronic
955259809 3:57376085-57376107 GCTTATCTGTAAAATGAGGTTGG + Intronic
955727383 3:61947860-61947882 CCTCCTCTGAAAAAGGAGGCAGG - Intronic
955730363 3:61978979-61979001 CATTATCTGTAAAATGGGGAAGG + Intronic
955842573 3:63128012-63128034 CCTCATCTGTGAAATGAGCATGG - Intergenic
955867801 3:63403545-63403567 TCTCATCTGTTAAATGAGGATGG - Intronic
956093481 3:65692562-65692584 CCTTATCTACAAAATGGGGATGG - Intronic
956170893 3:66432568-66432590 CCCCATCTGTAAAATGGGGACGG - Intronic
956206612 3:66761554-66761576 CCTCATATGTAAAATGAGAAGGG + Intergenic
956498697 3:69857483-69857505 CCTTATGTGAAAAAAGAGGAAGG - Intronic
956499590 3:69868266-69868288 TCTCAGCTGCAAAATGGGGGTGG - Intronic
956733761 3:72219957-72219979 CCTCATCTGTAAAATGGGGCAGG + Intergenic
956740984 3:72275878-72275900 CCTCTTCTGTAAAATGGGGATGG - Intergenic
956741720 3:72280732-72280754 CTTCATCTGTAAAATGGGGATGG - Intergenic
956974009 3:74559213-74559235 TCTCAACAGCAAAATGAGGAAGG + Intergenic
956986406 3:74706424-74706446 TCTCATCTGCAAAATGGGAAGGG + Intergenic
957340203 3:78885837-78885859 CTTCATCTGTAAAATGGGCAGGG - Intronic
957385049 3:79485661-79485683 CTGTATCTGCAAAATGGGGATGG - Intronic
957764432 3:84603675-84603697 TCACCTCTGCAAAATGAGAAGGG + Intergenic
958455433 3:94325344-94325366 TCTCACCTGCAAAATGGAGATGG + Intergenic
958902132 3:99899819-99899841 TCTCATCTGTAAAATGGGAATGG + Intronic
959361596 3:105400873-105400895 TCCCATCTGTAAAATGGGGAAGG + Intronic
959810171 3:110608807-110608829 CCACATTAACAAAATGAGGAAGG + Intergenic
960100450 3:113736988-113737010 CATCATCTGTAAAATGAAGGGGG - Intronic
960376744 3:116911760-116911782 CTTCAACTGGAAAATGAGAAAGG + Intronic
960574498 3:119216861-119216883 CCTCATCTGTAAAATGGCAATGG + Intronic
960997238 3:123348281-123348303 GCTCGTCTGTAAAATGAGGATGG + Intronic
961200156 3:125039014-125039036 TCTAATCTCCAATATGAGGAGGG - Intronic
961219975 3:125192064-125192086 CCTCATCTCGAAATTCAGGATGG + Intronic
961380723 3:126494961-126494983 CCTCATCTGCAAAGCGGAGACGG - Intronic
961535496 3:127568137-127568159 CCTCATCTGTAAAATGGGATAGG + Intergenic
961818226 3:129562047-129562069 TCCCATCTGTAAAATGGGGAGGG + Intronic
962233790 3:133691181-133691203 CCTCTTCTCCACAATGAGGTTGG - Intergenic
962348950 3:134642891-134642913 ACTCATCTGTAATTTGAGGATGG + Intronic
962391990 3:134980102-134980124 CCTCAGCTGCAAAATTTGAATGG + Intronic
962617692 3:137143646-137143668 CCTCATGGGCAAAGTGAAGATGG + Intergenic
962869666 3:139477014-139477036 TCTCATCTGTAAAATAAGGATGG - Intronic
962929593 3:140024093-140024115 CTTCTTCTGCAAAATGGGGGTGG + Intronic
963233031 3:142928005-142928027 CCTTATCTGTAAACTGGGGATGG + Intergenic
963348368 3:144123571-144123593 CCTCGTCTATAAAATCAGGAGGG - Intergenic
963643768 3:147888805-147888827 CCTCACCTGTTAAATGAAGATGG - Intergenic
963747227 3:149136615-149136637 CCTGATGTATAAAATGAGGAGGG + Intronic
963750224 3:149170214-149170236 CCTCTTCTCCCAAATAAGGAGGG - Intronic
964649230 3:158992221-158992243 CCTCATTTGGCAAATGAGGCTGG + Intronic
964775778 3:160275062-160275084 CCTCATTTGTAAAATGGGGCTGG + Intronic
965507714 3:169534755-169534777 CCTCCTCTGTAAAATAGGGATGG - Intronic
965543656 3:169894135-169894157 CATCATCCACAAAATGAGAATGG + Intergenic
965603108 3:170473858-170473880 TCTCATCTGCAAAACGGGGTTGG + Intronic
965613858 3:170573010-170573032 ACTCATCTACAAAATGCTGAAGG - Intronic
965696003 3:171408811-171408833 CCTCAACTGCAAACTGACAAAGG + Intronic
965730404 3:171765663-171765685 CTTGATCTGTAAAATGAGGAAGG + Intronic
965847009 3:172974808-172974830 CTTCAACTGGAAAGTGAGGATGG - Intronic
965910629 3:173770729-173770751 CCTCATCTGTGAAATGAAAATGG + Intronic
966053416 3:175650969-175650991 CCTCATCTTTGAAATGTGGATGG + Intronic
966440336 3:179937887-179937909 CCTCATCTGGAAAGTGGGGTGGG + Intronic
966500126 3:180630039-180630061 CCTCACTTGGAAAATGAAGAGGG - Intronic
966744211 3:183260186-183260208 TATCTTCTGCAAAATGTGGAGGG + Intronic
966754048 3:183351855-183351877 CTTCATCTGCAAAATGGTGGGGG + Intronic
966890763 3:184406012-184406034 CCTCATCTGCAACATAGGGATGG - Intronic
967278109 3:187796081-187796103 CCTCATCTGTTGAATGATGAGGG - Intergenic
967316953 3:188158693-188158715 TCTCATCTGCAAAATGAGACTGG - Intronic
967991550 3:195135310-195135332 CCTCCTGTGTAAAATGAGAAAGG - Intronic
968846120 4:3042439-3042461 CCTCAGCTGCAGAATGAAGATGG + Intergenic
968954414 4:3710930-3710952 CCACACCTGCAAAATCAGGGTGG - Intergenic
969063345 4:4456954-4456976 CCTCATTTGTAAAATGAGGGAGG + Intronic
969319342 4:6402422-6402444 TCTCACCTGCAAAATGGGCATGG + Intronic
969350160 4:6593656-6593678 CCTCCGCTGTAAAATGGGGATGG + Intronic
969520618 4:7675825-7675847 CCCCATCTCTAAAATGGGGATGG - Intronic
969524327 4:7696494-7696516 CCTCATCTGTAACATGAGGTTGG + Intronic
969583666 4:8079972-8079994 CCTCACCTGCACCATGCGGAAGG + Intronic
969639248 4:8387253-8387275 CCTCATCTGCAGCACGGGGACGG - Intronic
970200345 4:13598531-13598553 CCTCGTTTGTAAAATGAGGGTGG + Intronic
970206317 4:13659039-13659061 CATCAGCTGTAAAATGAGGAGGG - Intergenic
970322494 4:14888579-14888601 CCTCCTCTAGAGAATGAGGATGG - Intergenic
970376018 4:15457861-15457883 CCTCTTCTGGAATATGAGGTGGG - Intergenic
970560355 4:17276170-17276192 CCTCGTCTGTAAAATGGGAAGGG + Intergenic
970599453 4:17629359-17629381 CCTCATCTGCAGAATCCAGATGG + Exonic
970991307 4:22216338-22216360 CCTCAGCTATAAAATGAGGATGG + Intergenic
971036895 4:22703387-22703409 CCTTATTTGCAAAATGAGAACGG + Intergenic
971297595 4:25411662-25411684 TCTCATCTGTAAAATGAAGATGG + Intronic
972647070 4:40979059-40979081 TCTCATCTGCACAATGAGTTCGG + Intronic
972654332 4:41050372-41050394 TCTCATCTGTAAAATGGGGATGG - Intronic
972724144 4:41731522-41731544 TCTCATCTGTGAAATGAGGATGG + Intergenic
973158812 4:46991730-46991752 CCTTATCTGTAAAGTGGGGATGG + Intronic
973177962 4:47231366-47231388 TTTCATCTGTAAAATGAGGAGGG + Intronic
973194508 4:47424330-47424352 CCTTATCTATAAAATGGGGATGG + Intronic
973653544 4:53021976-53021998 CCTGGTGTGAAAAATGAGGAGGG + Intronic
973668846 4:53192664-53192686 TCTTATCTACAAAATGGGGATGG + Intronic
973960213 4:56102393-56102415 CCTCATTTGTAAAATGAAGAAGG - Intergenic
974021963 4:56699488-56699510 TCTCATCTCTAAAATGAGCATGG - Intergenic
974084425 4:57244332-57244354 CCTCATCTACAGAAAGAGAAGGG - Intergenic
974744374 4:66051755-66051777 CTTCATTTGAAAAATGATGATGG - Intergenic
975073587 4:70176060-70176082 CCTCATCTTCAAAAAAAAGAAGG + Intronic
975438664 4:74384185-74384207 CTTCATCTGTAAGATGAGGATGG + Intronic
975471351 4:74772689-74772711 CCGCATCTGCAACCTGAGGATGG + Intronic
976071565 4:81246216-81246238 CCTCATCTGTAAAATGAGTGTGG + Intergenic
976218693 4:82738871-82738893 CCTCATCTGTAAAATGGGGTTGG - Intronic
976781901 4:88769461-88769483 CCTCATCTGGAAAATGAAGATGG + Intronic
976793579 4:88907867-88907889 CCTCATCTGTAAAATCAGGGAGG - Intronic
976985725 4:91294531-91294553 CCTGAAATGCAAAATCAGGATGG + Intronic
976995465 4:91426957-91426979 CCTCACCTAGAAAATGGGGATGG - Intronic
977191711 4:94009239-94009261 TCTCAACTGCAAAATTAAGATGG - Intergenic
977415705 4:96730294-96730316 TCTTATCTGCCACATGAGGAAGG - Intergenic
977574754 4:98663891-98663913 CATCCTCTGCAGAAAGAGGAAGG + Intergenic
977638249 4:99325683-99325705 CTTCATCTGTAAAATGTGCATGG - Intergenic
978142634 4:105335029-105335051 TCTCATCTGTACAATGATGAAGG + Intergenic
978308086 4:107354094-107354116 CCTCAGCTGCCAAATAGGGAAGG - Intergenic
978453161 4:108859206-108859228 TCCCATCTACAGAATGAGGATGG - Intronic
978634800 4:110791554-110791576 CATCATCTGCACAATGAGCAGGG + Intergenic
979353218 4:119670423-119670445 CCTTGTCTGTAAAATGAGAATGG + Intergenic
979442526 4:120768338-120768360 CCTCATCTAGAAAATGAGAATGG + Intronic
979465250 4:121029940-121029962 TCTCATTTGTAAAATGAGAAGGG - Intergenic
979973216 4:127163537-127163559 CCTCATTTGTAAATTGGGGAAGG - Intergenic
980254097 4:130353735-130353757 CCTCATCTGTAAAATGAAAGTGG + Intergenic
980794674 4:137665623-137665645 CCACATCAGTAAAATGAAGATGG + Intergenic
982289465 4:153765315-153765337 CTTCATCTGTAAACTGTGGATGG - Intergenic
982462698 4:155690753-155690775 CCTCTGCTGCAAAAAGGGGAGGG - Intronic
983891800 4:173037332-173037354 CTTCATCAGTAAAATGAGGTGGG - Intronic
984408803 4:179369541-179369563 CCTCAACTGCAAAAGGACGAGGG - Intergenic
985000909 4:185481587-185481609 GGCCATCTGCAGAATGAGGAGGG - Intergenic
985139572 4:186825337-186825359 TCTCATCTGCAAAATGGGAGTGG + Intergenic
986394830 5:7318306-7318328 TCTCATCTACAAAATAAGGGTGG + Intergenic
986592994 5:9390920-9390942 CCACATCTGCAAAATGGCAAAGG - Intronic
986633583 5:9798579-9798601 CCCCATCTGTAAAATGCTGAGGG + Intergenic
987305303 5:16631999-16632021 CCCCAGCTGCCAAGTGAGGAAGG - Intergenic
987650659 5:20736338-20736360 CTTCATCAGCAAAATGAGATGGG - Intergenic
987769660 5:22284398-22284420 TCTCATCTGAAGACTGAGGATGG + Intronic
987873663 5:23651632-23651654 CCTCAGCTGCAATATGAGGTTGG - Intergenic
988665401 5:33321860-33321882 CCACTTCTGCATGATGAGGAAGG + Intergenic
988744893 5:34125123-34125145 CTTCATCAGCAAAATGAGATGGG + Intergenic
989110451 5:37902109-37902131 CCTCCTCTCTAAAATGAGGAAGG + Intergenic
989127643 5:38072612-38072634 CTTCATCTGTAAAAGGGGGAGGG + Intergenic
989496830 5:42118590-42118612 CCTCACTTGCAAAATAAAGAAGG - Intergenic
989661426 5:43802486-43802508 ACTAACCTGCAGAATGAGGAAGG + Intergenic
989717310 5:44479426-44479448 CCACATATGCACTATGAGGATGG + Intergenic
990309318 5:54522736-54522758 ACCCAGCTGCAAAATGAGGGTGG + Intronic
990382795 5:55232967-55232989 CTCCATCTGTAAAATGAGGCCGG + Intronic
990510629 5:56486400-56486422 CCTCATCTGTAAAATGGGGAGGG - Intergenic
991006850 5:61836434-61836456 TCTCATCTTTAAAATGAGAAAGG + Intergenic
991086738 5:62654576-62654598 CCTCCTCTGTAAAATGGAGATGG + Intergenic
991503973 5:67305389-67305411 GCTCATCTGCAAATTGCAGAAGG - Intergenic
991513329 5:67404908-67404930 CCTCATCTGTAAAATGTAGATGG + Intergenic
992030388 5:72715287-72715309 CCTCATCAGCAATGTGAGGAAGG - Intergenic
992712613 5:79475186-79475208 CCTCATCTTCAAAAGGGGGATGG - Intronic
993029238 5:82685329-82685351 CTTCAGCTGGAAAATGGGGATGG - Intergenic
993567606 5:89493967-89493989 CCTGATCAGCAAGATAAGGAGGG + Intergenic
993929459 5:93920310-93920332 CCTCATCTGAAAAGGGAAGATGG - Intronic
995035381 5:107528134-107528156 TGTCATCTGCAAAATGGGAATGG + Intronic
995037562 5:107552415-107552437 CCTCACCTATTAAATGAGGATGG - Intronic
995045266 5:107639448-107639470 CCTTAACTGCAAAATGAAGATGG + Intronic
995281417 5:110339918-110339940 CCTGAACTCCAAAAAGAGGAGGG + Intronic
995307263 5:110667689-110667711 CCTCACCTGTAAAATGAGAATGG + Intronic
995435571 5:112131286-112131308 CCTCCTTTGTAAAATGAGTATGG + Intergenic
995441146 5:112193599-112193621 TCTCTTCTGAAAAATGAGGAAGG - Intronic
995476714 5:112555441-112555463 CCTCATCTGCAAAGGAAGGAGGG + Intergenic
996824442 5:127665403-127665425 CCTCATCTGTAAAATGGGCATGG + Intergenic
997357850 5:133275724-133275746 GCTCATCTGTAAAATGGAGAGGG - Intronic
997398370 5:133582344-133582366 CCTCATCTGCAAAATGAGGTAGG + Intronic
998157207 5:139793865-139793887 CCTCATCTGCCCAATGAGGATGG - Intergenic
998178575 5:139918524-139918546 CCTCATCTGCTATGTGAAGATGG - Intronic
998254488 5:140574255-140574277 CCTCATCTGGAAAATGTCGGGGG - Intronic
998417885 5:141958755-141958777 CCTCATCTGTAGAGTGGGGATGG + Exonic
998458054 5:142289001-142289023 CCTCATCTCTAAAATGAGCTTGG + Intergenic
998516954 5:142764976-142764998 CCTTACCTGTAAAATGGGGATGG + Intergenic
998831872 5:146168199-146168221 CTTCATCTGGAAAATCAGGGGGG + Exonic
998906461 5:146910548-146910570 CCTCATCTGCAAAAGGGTGATGG + Intronic
999095850 5:148977590-148977612 CCTCATCTGTAAAATGGGGTTGG - Intronic
999453154 5:151693685-151693707 ACTCATCTTTAAAATGAGAATGG - Intergenic
999456566 5:151721352-151721374 CCTCCTCTGAAAAATGAAAAGGG + Intergenic
999563447 5:152830571-152830593 CCTCAACTGCAGAATGGTGATGG - Intergenic
999571305 5:152923037-152923059 CCTCATCTGTAATATGAGGGTGG - Intergenic
999683821 5:154084697-154084719 CTTAATCAGCAAAATGGGGATGG - Intronic
999861278 5:155649299-155649321 CCTCATCTGTAAAATGGGGATGG + Intergenic
1000104671 5:158048080-158048102 CCTCATCTGCAAAATGGAGACGG + Intergenic
1000171966 5:158711505-158711527 TCTCATCTGTAAAATTGGGAAGG - Intronic
1000173716 5:158729183-158729205 CCTCATCCACTAAATGTGGATGG - Intronic
1000632168 5:163602947-163602969 CCTCATTTGTAAAATAAAGATGG - Intergenic
1000776760 5:165429468-165429490 CTCCATCTAGAAAATGAGGACGG - Intergenic
1001037387 5:168307164-168307186 CCTCATCTGCAGAATGGAGATGG - Intronic
1001109336 5:168882948-168882970 CATCTTCTGTAAAATGGGGATGG - Intronic
1001113731 5:168921328-168921350 CCTCACGTACAAAATGAAGAGGG + Intronic
1001127207 5:169030369-169030391 CCCCATCTGTAAATTGAAGAGGG - Intronic
1001284623 5:170413534-170413556 CTTCATCTGCAAGATGGGAATGG + Intronic
1001308026 5:170589982-170590004 CCCCCTCTGCAAAATGGGAATGG + Intronic
1001401761 5:171450460-171450482 CCTCATCTGTGGAATGGGGATGG - Intronic
1001489376 5:172144852-172144874 CCTCATCTGTAAAAGGGGGTGGG - Intronic
1001583542 5:172817122-172817144 GCTCATCTGCAAAGTGGGGGCGG + Intergenic
1001591426 5:172867920-172867942 ACTCATCAGTAAAATGGGGAGGG - Intronic
1001699117 5:173694054-173694076 CCTCCTCTCTAAAATGGGGATGG - Intergenic
1001752091 5:174139250-174139272 TCTCATCTGTAAAATGGGAATGG + Intronic
1001879992 5:175235017-175235039 CCTCGTCAGCAGAATGAGGTTGG - Intergenic
1001953630 5:175833294-175833316 TCTCATCTGCAAAATCAGGGTGG - Intronic
1001964775 5:175902515-175902537 TCTCATCTGCACCAGGAGGACGG + Intergenic
1002045614 5:176540248-176540270 CCTCATCTGTAAAATGAGGCTGG - Intergenic
1002093616 5:176818284-176818306 CCTCATCTGTAAAACGGGAATGG - Intronic
1002155084 5:177271415-177271437 CCTCATCTGCAAGATCAGGATGG - Intronic
1002252175 5:177936673-177936695 TCTCATCTGCACCAGGAGGACGG - Intergenic
1002295484 5:178228584-178228606 CCCCACCTGTAAAATGAAGATGG + Intronic
1002460570 5:179371510-179371532 TTTCATCTGTAACATGAGGATGG - Intergenic
1002603899 5:180370726-180370748 CCTCATCTGTAAAACGGGGCTGG + Intergenic
1002638751 5:180620608-180620630 CATCTTCTGTAACATGAGGAGGG - Exonic
1002763552 6:219705-219727 CTCCACCTGCAAAATGAGGTGGG - Intergenic
1002827911 6:790479-790501 CCTCATCTGTAAAATGAAGGTGG - Intergenic
1002833271 6:843602-843624 CACCATCTGCAAGCTGAGGACGG - Intergenic
1003458864 6:6310659-6310681 TCTCATCTGCAAAATGAAGTTGG + Intronic
1003550721 6:7100109-7100131 CATCAGCTGCAAAATGGGGGTGG + Intergenic
1003958657 6:11189683-11189705 CCTCATTTGCAAAATGAATGGGG - Intronic
1004007152 6:11647517-11647539 CCTCATCTGTAAAACGAGGAGGG - Intergenic
1004121905 6:12831917-12831939 CCTCCTCCATAAAATGAGGAGGG - Intronic
1004326262 6:14676471-14676493 CCTCACCTGTAAAATGAGAAGGG + Intergenic
1004792901 6:19048255-19048277 CCTAATATGCAAAAAGAGAAAGG - Intergenic
1004900287 6:20187303-20187325 TCTCATCTGTAAAGTGAGGGAGG + Intronic
1004928938 6:20443048-20443070 CCTCATCTGCCAAAAGAAGATGG - Intronic
1005945640 6:30593410-30593432 TCTCATCTGTAAAATGAAGGTGG + Intronic
1006716898 6:36126189-36126211 CCTCCTCACCATAATGAGGATGG - Intergenic
1006808926 6:36807345-36807367 CCTCCTCTGTAAAATGGGAATGG + Intronic
1006946110 6:37785444-37785466 CCTCACCTCCAAAATGAAGCAGG - Intergenic
1007117601 6:39354598-39354620 CCTCATCTGGAAGCTGAGAATGG + Intronic
1007149116 6:39670534-39670556 CCTCATCTTCACATTGAGTAGGG + Intronic
1007162730 6:39805300-39805322 CCTCATCTGTAAAATGGTGATGG + Intronic
1007270630 6:40634213-40634235 CCTCATCTGAATAATGAACATGG + Intergenic
1007452438 6:41950478-41950500 TCTCATTTGCAAAAGGAGGATGG + Intronic
1007791679 6:44312664-44312686 CCTCATCTGTAAAATAGGGGCGG - Intronic
1007897133 6:45374392-45374414 CCTCATTTATAAAATGAAGATGG - Intronic
1007918019 6:45579262-45579284 CCTCATCTGTAAAATGGGGATGG - Intronic
1007940867 6:45780213-45780235 CCTCATCTGCAAAAGGAGAGGGG - Intergenic
1008062492 6:47013355-47013377 CCTCATCTGTAAACTGGGGAAGG - Intronic
1008062586 6:47014171-47014193 TCTGATCTGCAAAATGAGGTTGG + Intronic
1009592747 6:65693525-65693547 CCTCATGTTAAAAATCAGGATGG - Intronic
1010337159 6:74700109-74700131 CTTCCTCCACAAAATGAGGATGG - Intergenic
1010715649 6:79226347-79226369 TCTCATATGTAAAATGAGAACGG + Intronic
1010831098 6:80530519-80530541 TCTCATCTGTAAAATCTGGAAGG - Intergenic
1011274030 6:85610968-85610990 ACTTATCTACAAAATGAGTATGG - Intronic
1011986964 6:93459229-93459251 CCTAATCTATAAAATGAGGTTGG + Intergenic
1012860943 6:104558802-104558824 TCCCATCTGTAAAATGAGGCTGG + Intergenic
1012862141 6:104572521-104572543 CCTCATCTGTAAAATGGGTATGG + Intergenic
1013139054 6:107312521-107312543 CCCCATCTGTTAAATGGGGATGG + Intronic
1013199376 6:107878134-107878156 CCTCATTTACAAAAACAGGAAGG + Intronic
1013290089 6:108712370-108712392 CCTCATCTGTAAAATGGGGGAGG + Intergenic
1013367057 6:109444445-109444467 CCTAAGCTGCCAAATTAGGAGGG + Intronic
1013501935 6:110760784-110760806 CCTCATCTGTATAATGGGGATGG - Intronic
1013691427 6:112649264-112649286 CCTCATCTGGAAAATAAAGAAGG + Intergenic
1015156280 6:130100228-130100250 TTTCATCTGTAAAATGAGGATGG - Intronic
1015178208 6:130334440-130334462 CCTCATCTGTAAAATGAAAGAGG - Intronic
1015531758 6:134227687-134227709 CCTCAACTGTAAAATGGGGATGG - Intronic
1015797510 6:137027728-137027750 ACTAAGCTGTAAAATGAGGATGG - Intronic
1016106701 6:140172150-140172172 CTTCATCAGCAACATGAAGATGG - Intergenic
1016492565 6:144623205-144623227 CTTCATCTGTAATATGAGAAAGG + Intronic
1016840025 6:148516701-148516723 CCTCATTTTCGAAATGAGGATGG - Intronic
1017224097 6:152000175-152000197 CTTCATCTGCAAAATGAGAATGG - Intronic
1017507998 6:155086325-155086347 CTTCATCTGCAAAGTGAACAGGG + Intronic
1017732675 6:157331473-157331495 CTTCCTCTGTAAAGTGAGGAAGG + Intergenic
1017971315 6:159314931-159314953 CCTAATCTGTGAAATCAGGAAGG + Intergenic
1018838571 6:167503031-167503053 CCTCACCTACAAAATGAGGATGG + Intergenic
1018919260 6:168160074-168160096 CCCTATCTATAAAATGAGGAGGG + Intergenic
1018975542 6:168562523-168562545 CCTCACCCCCAAAGTGAGGACGG - Intronic
1019567459 7:1691515-1691537 CCTCATCTGTAAAATGGGCAGGG + Intronic
1019577375 7:1744019-1744041 CCTCATCTGCAAAATGGACGGGG - Intronic
1019609961 7:1931325-1931347 CCTCATCTGGAGAATGGGGAGGG + Intronic
1019972428 7:4551795-4551817 CCTCTTCTGCAAATTGAAGATGG + Intergenic
1020129623 7:5552346-5552368 TCTCATCTGTAAAATGGGGTGGG + Intronic
1020373361 7:7458729-7458751 ACTCATCTGAAAAATGGGGATGG - Intronic
1021459907 7:20874807-20874829 TCTCATCTATAAAATGGGGATGG - Intergenic
1021744682 7:23726979-23727001 CTGCATCTCCAAAATGAGGAGGG - Intronic
1021982319 7:26066889-26066911 CCTCATCTGTAAAATGGGGATGG - Intergenic
1022040764 7:26579351-26579373 CCTCATCTGTAAAATGGAGCTGG + Intergenic
1022185361 7:27962005-27962027 CCTTATCTATAAAATGAAGATGG + Intronic
1022214565 7:28245770-28245792 CCTCATCTGAGAAATGAAGGGGG + Intergenic
1022247196 7:28571717-28571739 CCTTATCCCCAGAATGAGGATGG + Intronic
1022266182 7:28757193-28757215 CCTCCTCTGTAAAATAAGAATGG - Intronic
1022417771 7:30192550-30192572 CCTCATCTATAAAAAGAAGATGG + Intergenic
1022613973 7:31909732-31909754 ACTCATCTGAAAAATGAACATGG - Intronic
1022653074 7:32294504-32294526 TCTCATCTGTAAAATGAACAGGG + Intronic
1022673316 7:32476270-32476292 CCTACTCTGCAAAATGGGGATGG - Intergenic
1023124927 7:36946006-36946028 CCTCTCCTGCCAAAGGAGGATGG + Intronic
1023183134 7:37506175-37506197 TCTCACCTGTAAAATGAGGATGG - Intergenic
1023633252 7:42184011-42184033 CCTCTTCTGTAAAATGGGGAGGG + Intronic
1023661294 7:42473512-42473534 CCTCATAGACAAAATGAAGAAGG + Intergenic
1023821714 7:43984312-43984334 CCCTATCTGTAAAATGAGGATGG - Intergenic
1024194508 7:47045842-47045864 CCTCACTTGCAAAATGAGGATGG + Intergenic
1024218340 7:47266806-47266828 CATGATCTGTAAAATGGGGATGG + Intergenic
1024242247 7:47444640-47444662 CCTCAGCTGCAGAGTGAGAAGGG + Intronic
1024336864 7:48217622-48217644 TCTCATCTTCAAACTGAGGAAGG + Intronic
1024434992 7:49341819-49341841 CCTCACCTGGAAATTGAGAAGGG - Intergenic
1024474089 7:49792288-49792310 TTTTATCTGTAAAATGAGGATGG - Intronic
1024752100 7:52478522-52478544 CCTCATTTGCATAATGATTAGGG - Intergenic
1024803666 7:53110686-53110708 CCTATTCTATAAAATGAGGAAGG + Intergenic
1025273252 7:57546365-57546387 CCTCAGCAGCCACATGAGGAGGG - Intergenic
1025794302 7:64723618-64723640 CTGCATTTGCAAAATGAGGAAGG + Intergenic
1025807110 7:64844532-64844554 CTGCATCCGCAAAATGAGAAAGG + Intergenic
1026052918 7:66961851-66961873 CCTCATCTGTAAAACAAGGATGG + Intergenic
1026104764 7:67411977-67411999 CCTCATCTGTAAAAACAAGAAGG + Intergenic
1026734522 7:72941233-72941255 TCTCATCTGACAGATGAGGAAGG - Intronic
1026784856 7:73296141-73296163 TCTCATCTGACAGATGAGGAAGG - Intergenic
1026854255 7:73742778-73742800 CCTCATCAGCAGAATAAGGACGG - Intergenic
1026928959 7:74212573-74212595 TCTCATCTATAAAATGAGGTCGG - Intronic
1026935877 7:74254945-74254967 CCTCCTCTGCAAAATGGGGTGGG - Intergenic
1026953330 7:74361695-74361717 CCTGATGTGTAAAATGAGAATGG - Intronic
1027109220 7:75423789-75423811 TCTCATCTGACAAATGAGGAAGG + Intronic
1027227406 7:76252782-76252804 TCTCATCTGCAAAATGGAAAGGG + Intronic
1027414836 7:77963879-77963901 CCTCATCTGTAAAATGAGATAGG + Intergenic
1027579120 7:79971046-79971068 ACTCATCTGAAACATGAGCACGG - Intergenic
1028155927 7:87429308-87429330 CCTCACTTGCTAAATGAGCAGGG - Intronic
1028301139 7:89202657-89202679 CCTCATCTGGAAAATGAGGTTGG - Intronic
1028710629 7:93903560-93903582 CCTCATCTGCAAAATGGAATAGG + Intronic
1028745700 7:94323991-94324013 CCTCATCTGCCAAAGGGGAAGGG - Intergenic
1029176793 7:98670252-98670274 CCTCATCTGTAGAATGGAGAAGG + Intergenic
1029349714 7:100004518-100004540 CCTCATCTGTAAAATAGGGATGG - Intergenic
1029527266 7:101102622-101102644 CCTCATCTTTAAAACGAGGATGG - Intergenic
1029749976 7:102537731-102537753 CCCTATCTGTAAAATGAGGATGG - Intergenic
1029767926 7:102636837-102636859 CCCTATCTGTAAAATGAGGATGG - Intronic
1030046802 7:105504548-105504570 CCTCATTTGTAAAATGAAGATGG - Intronic
1030081565 7:105783082-105783104 CCTCGTCTATAAAATAAGGATGG - Intronic
1030676410 7:112390379-112390401 CCTCATCTGTAAAATGGGGATGG + Intergenic
1030697646 7:112603681-112603703 CTTTATCTGTAAAATGGGGATGG - Intergenic
1031018710 7:116603636-116603658 TCTCCTGTGCAAAATGAAGACGG + Intergenic
1031071277 7:117164872-117164894 GCTCATCTGTAAAGTGAGGAGGG + Intronic
1031948171 7:127863046-127863068 CCTTGTTTGCAAAATGAGGGAGG - Intronic
1031977617 7:128103989-128104011 CTTCATCTGTAAAATGGGGGTGG - Intergenic
1032322539 7:130898016-130898038 CCTCATCTGTGAAATGGGGATGG - Intergenic
1032518857 7:132527409-132527431 CCTCATCTGCTCAATGGGGATGG - Intronic
1032658938 7:133961954-133961976 CCTCCTCTGAGAAATGAGGGCGG - Intronic
1032675374 7:134125375-134125397 TCTCATCTGTCTAATGAGGATGG + Intergenic
1032698481 7:134358289-134358311 TCTCATCTGTAAAATGGGGATGG + Intergenic
1032857327 7:135846287-135846309 TCTCATTTGTAAAATGAAGAGGG - Intergenic
1033420624 7:141201579-141201601 CATCATCTGCAAAATACTGATGG - Intronic
1033444618 7:141409452-141409474 CCTCATCTGTATAATGAGGATGG + Intronic
1033466783 7:141598513-141598535 ACTCATCTGTAAAATCAGAAAGG + Intronic
1033724866 7:144104158-144104180 CCCCATCTGCAAAATGGGGTGGG - Intergenic
1033755270 7:144393806-144393828 CTCCAAGTGCAAAATGAGGAGGG + Intergenic
1033881772 7:145893067-145893089 CCTCATCTGTAAGATGATAATGG - Intergenic
1033928626 7:146495486-146495508 CCTCCCCTGCAAAATAATGAAGG + Intronic
1034544802 7:151782717-151782739 CCTCATCTGTAAAATGAGGATGG + Intronic
1034683915 7:152952999-152953021 TCTCATCTAAAAAAGGAGGATGG + Intergenic
1035074169 7:156167499-156167521 CCTCACCTGAGAAACGAGGATGG - Intergenic
1035905851 8:3509497-3509519 CCTCATCTTTAAAATGAAGAAGG + Intronic
1035926828 8:3736778-3736800 CCTCATCTGCAAAGTGGGAGTGG + Intronic
1036408859 8:8479749-8479771 CTTCCCCTGTAAAATGAGGATGG - Intergenic
1036656390 8:10679915-10679937 CCTCAGCTGGAGAGTGAGGAAGG + Intronic
1036729509 8:11249971-11249993 CCTCATCTGAAAAATGGGGATGG - Intergenic
1037041603 8:14243063-14243085 CCTCAGATTCCAAATGAGGAGGG + Intronic
1037589111 8:20298393-20298415 CCTCATCTGCCAAATGGCAAAGG + Intronic
1037744412 8:21631398-21631420 CCTCATTTGTAAAATGGGAATGG + Intergenic
1037801628 8:22039093-22039115 CCTCATCTGGGAAATGGGGCTGG - Intergenic
1037829818 8:22180797-22180819 CCTCATCTGTAAAATAAAGGTGG - Intronic
1038352214 8:26787032-26787054 CCTCATCTGTAAGATGAGGTTGG - Intronic
1038693053 8:29780682-29780704 CCCCATCTGTAAAATGAAGGTGG + Intergenic
1039435496 8:37556753-37556775 GCTCATCTGCAAAATCACCAGGG - Intergenic
1040566930 8:48575925-48575947 CCTCATCTGCAAAACAAGGTGGG - Intergenic
1041045771 8:53884553-53884575 CCTCATCTGTAAAACGAAGGAGG - Intronic
1041062208 8:54045127-54045149 CCTCTTCTGTAAAATCAAGATGG + Intergenic
1041263835 8:56045028-56045050 CCTCAGATGCTAAATTAGGAGGG - Intergenic
1041323946 8:56645014-56645036 CCTGCTCTGCCATATGAGGACGG - Intergenic
1041489212 8:58412766-58412788 CTTCATTTGTAAACTGAGGAAGG + Intronic
1041696045 8:60737466-60737488 TTTCATCTGTTAAATGAGGAGGG + Intronic
1041718156 8:60950709-60950731 CCTCACCTCCAAACTGATGATGG - Intergenic
1041748761 8:61236766-61236788 CCTCATTTGTAAAATGAGGTCGG - Intronic
1042636123 8:70877414-70877436 TGTAATCTGTAAAATGAGGATGG - Intergenic
1042692993 8:71524224-71524246 CCTCATCTGGTAAATTGGGAGGG - Intronic
1042817416 8:72892574-72892596 CCTCATCTACAAAATATGGATGG - Intronic
1042892153 8:73624552-73624574 CCTCATCTGTAAAATGAAGTGGG - Intronic
1043268931 8:78304105-78304127 CCTTATCAGTAAAATGGGGATGG + Intergenic
1043528484 8:81122947-81122969 CTTTATCTGTAAAATGAGAATGG - Intergenic
1044019573 8:87087833-87087855 CCTCATCTGTAAAATGAGAAAGG - Intronic
1044112851 8:88297774-88297796 CCTCATCTGTAAAATGAGTATGG + Intronic
1044128738 8:88493081-88493103 CCTCATTTGCAAAGTGGGGCTGG - Intergenic
1044391759 8:91660669-91660691 CCTCATCTGCAGACTGAGCCAGG + Intergenic
1044843722 8:96360135-96360157 CCTGATCTGTAAAATGGGGAGGG - Intergenic
1044844236 8:96364565-96364587 CCTCATCTGAAATATCTGGAGGG + Intergenic
1044844314 8:96365402-96365424 CCTCATCTATAAAATAGGGATGG - Intergenic
1044928941 8:97233535-97233557 CTTCATCAGTAAAACGAGGACGG + Intergenic
1044954852 8:97469418-97469440 CCTCATCTGTAAAATGGGGACGG + Intergenic
1044999981 8:97870175-97870197 CCTCATCTGTCTAATGAGGATGG + Intronic
1045149654 8:99389905-99389927 CCTCATCTAAAACATAAGGAGGG - Intronic
1045177055 8:99736886-99736908 TCTCATCTGTAAAATAAGAATGG - Intronic
1045375735 8:101572003-101572025 CCTTAGCTGTGAAATGAGGAAGG + Intronic
1045383025 8:101645608-101645630 CCTCATCTGTAAAAAGGAGATGG + Intronic
1045579686 8:103465269-103465291 CCTCATCTGTAAAATGGGTGTGG - Intergenic
1046793141 8:118343079-118343101 CCTCATCTGTAAGATGAGAAGGG + Intronic
1046796048 8:118373296-118373318 CCAAATCTGCAAAATGAGACTGG + Intronic
1047156512 8:122325417-122325439 CCTCATCTTTAAAATGAGGATGG + Intergenic
1047411596 8:124628794-124628816 CCCCATCTTTAAAATGAGGATGG - Intronic
1047448507 8:124941446-124941468 CTTCACCTGTAAAATGAGGATGG - Intergenic
1047521961 8:125601770-125601792 TCTCATCTGCAAAATGGTGATGG + Intergenic
1047555182 8:125921484-125921506 CTTCATCTGCAAAATGAGGTTGG + Intergenic
1047742081 8:127814587-127814609 CAACATCTGTAAAATGAGGATGG - Intergenic
1047761365 8:127957100-127957122 CCACATGTGCAAAATAGGGATGG - Intergenic
1047774642 8:128059755-128059777 CCCCATGTGTAAAATGGGGATGG - Intergenic
1047782634 8:128122664-128122686 CCTCAACTGCAAAGAGAGCAAGG - Intergenic
1047797263 8:128270463-128270485 CCTCATTTGTAAAATGGAGATGG - Intergenic
1048127381 8:131651164-131651186 ATTCATATGAAAAATGAGGATGG + Intergenic
1048160286 8:132014224-132014246 TCTCATCTGTAAAGTGAGCATGG + Intergenic
1048338843 8:133523466-133523488 CCTCCTCTGTAAAGTGAAGATGG + Intronic
1048456932 8:134586907-134586929 CCTCATTGGTAAAATGGGGATGG + Intronic
1048559785 8:135521624-135521646 CCTCATTTGTAATATGAGGTTGG + Intronic
1048590229 8:135814497-135814519 CTGCATCTGTAAAATGATGATGG - Intergenic
1048609845 8:136010249-136010271 TCTCATCTCCAAAATAAGGACGG + Intergenic
1048809468 8:138272954-138272976 CCTCATCTGTGAACTGGGGATGG + Intronic
1048980022 8:139698210-139698232 CCTCATCTGTAAAGTGGGGGAGG + Intronic
1049168573 8:141142787-141142809 CCTCTTCTGTAAAATGTAGATGG + Intronic
1049223764 8:141440048-141440070 CCTCATCTGTAGAATGGGGCAGG - Intergenic
1049245323 8:141559377-141559399 CCTCATCTAGAAAATGGGGACGG - Intergenic
1049419139 8:142509300-142509322 CCTCATCTTTAAAATGGGGGTGG - Intronic
1049450036 8:142655652-142655674 GCTCATCTGTACAATGGGGATGG + Intergenic
1049967257 9:790904-790926 CCTCTTTTTTAAAATGAGGATGG - Intergenic
1049991775 9:998249-998271 CCTCATCTACGAAATGGGAATGG - Intergenic
1050298020 9:4226740-4226762 CCTCTACTGAAAAATGAGTAAGG + Intronic
1050351218 9:4741967-4741989 CCTCTCCTGTAAAATGAGGTAGG - Intronic
1050459662 9:5866880-5866902 CCTCATCTGTAAAATGGGACTGG + Intergenic
1050739392 9:8802748-8802770 CCTCATCTTTAAAATGGAGATGG + Intronic
1051141470 9:13984098-13984120 CCTCATCTGGAAAATAGGGATGG - Intergenic
1051922392 9:22283205-22283227 CCTCTTCTGTAAAATGAAGTTGG - Intergenic
1053308307 9:36999601-36999623 CCTCATCCGAAAAATGGGCAAGG + Intronic
1053350269 9:37409390-37409412 CCTTATCTGTAAGATGGGGATGG + Intergenic
1053419479 9:37968276-37968298 ACTTATCTGTAAAATGGGGATGG - Intronic
1053428330 9:38025637-38025659 CCTCATCTGTGAAATGAGGATGG + Intronic
1053446905 9:38159594-38159616 CCTCATTTGTTAAATGGGGATGG - Intergenic
1053454808 9:38225873-38225895 CCTCATCTGTAAAAGGTGGGGGG + Intergenic
1053481131 9:38417368-38417390 TCTCATCTGTGAAATGGGGATGG - Intronic
1053792030 9:41693472-41693494 CCTCACCTGTAAAAAGAGGGAGG + Intergenic
1054153126 9:61621293-61621315 CCTCACCTGTAAAAAGAGGGAGG - Intergenic
1054180435 9:61905492-61905514 CCTCACCTGTAAAAAGAGGGAGG + Intergenic
1054472920 9:65552497-65552519 CCTCACCTGTAAAAAGAGGGAGG - Intergenic
1054657156 9:67675650-67675672 CCTCACCTGTAAAAAGAGGGAGG - Intergenic
1054769794 9:69072809-69072831 CCTCAGCTGCATAATGAAGCTGG - Exonic
1054828796 9:69600352-69600374 CCTCATCTGTAAAATGGGAGTGG + Intronic
1055106450 9:72518310-72518332 CCTCATACATAAAATGAGGATGG + Intergenic
1055553347 9:77451234-77451256 CCTCATTGGTAAAATGAGGAGGG + Intronic
1055585658 9:77756812-77756834 CCTTATCTGTAAAATGAGAAGGG + Intronic
1056012917 9:82351408-82351430 TATCATCTGTAAAATGGGGATGG + Intergenic
1056071103 9:82987793-82987815 TCTAATCTGTAAAATGAGGGAGG - Intronic
1056296543 9:85198814-85198836 CCTTATCCCTAAAATGAGGATGG + Intergenic
1056461169 9:86810933-86810955 CCTCACATGGAAAAGGAGGAAGG - Intergenic
1056757933 9:89393913-89393935 ACTCATCTGCAAAATGGAAATGG + Intronic
1056948794 9:91025352-91025374 CTTTATCTGTAAAATGTGGATGG + Intergenic
1057184990 9:93052520-93052542 TCCCATCTGTAAAATGGGGATGG + Intergenic
1057695569 9:97320600-97320622 CCTCCTCTGTAAAATAGGGATGG + Intronic
1057702615 9:97374781-97374803 CCTCATCTATGAAATGAGCATGG + Intronic
1057719690 9:97522010-97522032 GCTCATCTGTGAAATGATGATGG - Intronic
1057847908 9:98539545-98539567 CCCCTTCTACAAAATGAGGAGGG + Intronic
1058120634 9:101134969-101134991 CCTCATCTGCAAAATGGGGAAGG - Intronic
1058413609 9:104762862-104762884 CCTCATCTGCCACAGAAGGAAGG + Intergenic
1058420050 9:104824795-104824817 CCTCATCTCTAAAATGGGGATGG - Intronic
1058674535 9:107389184-107389206 CCTCAACTGTAAAATGGAGATGG + Intergenic
1058730634 9:107846641-107846663 CTACATCTGTAAAATGGGGATGG - Intergenic
1058805445 9:108586799-108586821 CCTCATGTGTGAAATGGGGATGG - Intergenic
1059345769 9:113626894-113626916 CCTTTTCTGCAAAACGAGGCTGG + Intergenic
1059515863 9:114894609-114894631 CCTCATCTGCAACATGGGAATGG + Intronic
1059543977 9:115157994-115158016 CCTCATCTGTAAAAAGGAGATGG + Intronic
1059576680 9:115496875-115496897 CTTTATCTACAAAATGAGAAGGG - Intergenic
1059653542 9:116336797-116336819 CCCCATCTTTAAAATGATGATGG + Intronic
1059788643 9:117615628-117615650 CCTAATCTGTAAAATGGGAATGG - Intergenic
1059812882 9:117876064-117876086 CCTCATCTTCAAAAAGAAGTGGG - Intergenic
1059930604 9:119256693-119256715 CCTCATCTGTAAAATGGGGTGGG + Intronic
1060000968 9:119958372-119958394 CCACATCTGCAGAGTGAGGATGG - Intergenic
1060054276 9:120400496-120400518 CCTCATGTGTAGAATGCGGACGG + Intronic
1060141256 9:121212337-121212359 CCTCATCTGTAAAATAGGTATGG + Intronic
1060218602 9:121752881-121752903 CCTCATCTGAAAAAGGAGGAAGG - Intronic
1060392756 9:123291901-123291923 TCTCATCTGTAAAATGTGCAGGG - Intergenic
1060562567 9:124558636-124558658 CCTCATCTGTAAAATGTTGAGGG - Intronic
1060568921 9:124619702-124619724 CCTTATCTGTAAAATAGGGAGGG + Intronic
1060588308 9:124800427-124800449 CCTCATCTGCCAAATGGGCAGGG - Intronic
1060598040 9:124859804-124859826 CCTCATCTGAAAAATGAGCATGG + Intronic
1060611337 9:124968225-124968247 CCTCAGCTGCATAATGAAGCTGG + Intronic
1060732793 9:126048793-126048815 CCACATCTGTAAAATGCGGCTGG + Intergenic
1060825718 9:126686793-126686815 GCTCATCTGTAAAATGGGAATGG + Intronic
1060975673 9:127763648-127763670 TCCCATCTGCAAAATGGGGAGGG + Intronic
1061049335 9:128185404-128185426 CCTCATCTGTAAAATGAGGGGGG - Intronic
1061165372 9:128919297-128919319 TCTCATTTGTAAAATCAGGAAGG + Intergenic
1061390215 9:130313485-130313507 CCTCGTCTGTGAAACGAGGAGGG + Intronic
1061676279 9:132217744-132217766 TCTAATCTGTAAAATAAGGATGG - Intronic
1061807736 9:133145762-133145784 CCTGACCTGCACAATGGGGATGG + Intronic
1061847824 9:133397805-133397827 CCTCATCTGTAAAGTGGGGATGG + Intronic
1062010516 9:134264386-134264408 CCTCATCTCTGAAATGGGGATGG + Intergenic
1062363429 9:136198045-136198067 CCTTGTCTGCAAAATGTGGGTGG - Intronic
1062552456 9:137095874-137095896 AGTCATCTGCAAAGTGAGGCAGG - Intronic
1203624933 Un_KI270750v1:6991-7013 CCTCAGCAGCCACATGAGGAGGG - Intergenic
1185687271 X:1939596-1939618 CCTCATCTGCAAAGTCAGGCAGG - Intergenic
1185935323 X:4250018-4250040 TTTCATCTGTAAAATGGGGAGGG + Intergenic
1186555859 X:10557582-10557604 CCTCATCTGCAGAATGAGGATGG + Intronic
1186578079 X:10787981-10788003 CCTCATCTGTAAAATGATGATGG - Intronic
1186773437 X:12839958-12839980 CCTCATCTGTAAAATAAGATGGG - Intergenic
1186826823 X:13348819-13348841 ATTTATCTGCAAAATAAGGATGG - Intergenic
1187031630 X:15493713-15493735 CCTCCTCTATAAAATGAGGATGG + Intronic
1187121900 X:16417317-16417339 CCTCACCTGTAAAATGAGAATGG - Intergenic
1187256773 X:17650401-17650423 CTTCATCTATAAAATAAGGAGGG - Intronic
1187378431 X:18778551-18778573 CCCAATTTGCAAAATGGGGATGG - Intronic
1187650782 X:21403192-21403214 TCACATCTGCAAAATGAGGTGGG - Intronic
1188696183 X:33194050-33194072 CCTCATCTGACAAGTGAGAATGG + Intronic
1188767984 X:34120763-34120785 CCTCATCTCTAAAATGAAAATGG + Intergenic
1188878834 X:35467032-35467054 CCTCATCTGTTAAATGAAGTTGG + Intergenic
1188928328 X:36073630-36073652 CCTCATCTGTGATATGAGGAAGG + Intronic
1189150962 X:38706184-38706206 CCTCATTTACAAAATGGTGAGGG + Intergenic
1189155083 X:38748770-38748792 CCACATCCACAAAATGAAGATGG + Intergenic
1189277179 X:39795312-39795334 CCTCCGCTGCAAAAAAAGGAAGG - Intergenic
1189280158 X:39815611-39815633 CCTAATCTGAACACTGAGGAAGG + Intergenic
1189298219 X:39934062-39934084 CTTCATCTGTAAAATGTGAAGGG + Intergenic
1189346729 X:40247578-40247600 CCCCATCTGTAAAATGGGGATGG + Intergenic
1189352171 X:40283896-40283918 CCTCATCTGTAAGGTGGGGATGG + Intergenic
1189546019 X:42043358-42043380 CCTATTCTGAAAAATGAGGATGG - Intergenic
1189663697 X:43330638-43330660 CCTCAGTTTCAAAACGAGGAGGG - Intergenic
1190090054 X:47429676-47429698 GCTCACCATCAAAATGAGGAGGG + Intergenic
1190115647 X:47624789-47624811 CCTCATCTGCAAAATGAGAATGG + Intronic
1190227606 X:48558285-48558307 CATCGTCTGTAAAATGAGAATGG + Intronic
1190287763 X:48971992-48972014 CGTCATCTGGAAAATGGGGGTGG + Intergenic
1190397306 X:49998162-49998184 CATCATCTGTAAAATGGGGAGGG - Intronic
1190489405 X:50966347-50966369 CCTCATTTGTAAAATGGAGATGG + Intergenic
1190886283 X:54533077-54533099 CCTCATCTGTAAATTGAGAATGG - Intronic
1190916345 X:54814057-54814079 CCTCAACTGTAAAACGGGGATGG - Intronic
1190983135 X:55475646-55475668 CCTCATCTGTAAGATGAGGATGG + Intergenic
1190985564 X:55497537-55497559 CCTCATCTGTAAGATGAGGATGG - Intergenic
1191955791 X:66641228-66641250 CTTCATCTACAAAATGAGGATGG - Intergenic
1192152109 X:68718862-68718884 CCTCATCTGTAAAGTGAGGGAGG + Intronic
1192157936 X:68760283-68760305 CCTCATCTGTAAAATGGGGATGG + Intergenic
1192208569 X:69112303-69112325 CCTCTTTTTCAAAATGAGGCAGG - Intergenic
1192238263 X:69309892-69309914 CCTCATCTGGAAAACAGGGATGG + Intergenic
1192496251 X:71618199-71618221 TCTCGTCTGCAAAATGGGGGGGG - Intronic
1193602437 X:83524271-83524293 CCCCATCTGCAAAATGAGCAAGG - Intergenic
1193751226 X:85346831-85346853 TTTCATCTGCAAAATTAGTAGGG - Intronic
1193843060 X:86433058-86433080 CCTAATCTGTAAAATGGGGATGG + Intronic
1193931491 X:87558285-87558307 TCTCATTTGTAAAATGAGGACGG + Intronic
1194458045 X:94128953-94128975 CCTCATCTAAAACATGAAGATGG - Intergenic
1195203025 X:102567553-102567575 CCTCATTTGCAAAATGGGGTTGG + Intergenic
1195672519 X:107481924-107481946 ACTTATGTGCAAAATTAGGAAGG - Intergenic
1195755709 X:108196868-108196890 CCTCATCTGTAAAATCAACAAGG - Intronic
1195767770 X:108314777-108314799 TCCTATCTGTAAAATGAGGATGG + Intronic
1195916014 X:109936045-109936067 CCTCATCTGTAATATAGGGATGG + Intergenic
1195979017 X:110558644-110558666 CCCCATCTGGAATGTGAGGAGGG - Intergenic
1196013794 X:110916066-110916088 CCTCACCTATAAAATCAGGATGG - Intergenic
1196189225 X:112777590-112777612 AATCATTTGCAAAGTGAGGAAGG - Exonic
1196794295 X:119489877-119489899 CCTCATCTGTAAAATGGGGAGGG + Intergenic
1196816430 X:119668649-119668671 CCTCATCTATAAAATGTGGAGGG + Intronic
1196889407 X:120277605-120277627 CTTCATCTGTAAAATGTGCATGG - Intronic
1197172397 X:123448965-123448987 CCTCCTCTGAAAAATGGGGATGG - Intronic
1197587889 X:128372126-128372148 CCTCACTTGTAAAATGTGGATGG - Intergenic
1197806184 X:130400796-130400818 CTTCCTCTACAAAATGAGGGTGG + Intergenic
1197918517 X:131562476-131562498 CTTCATCTTTAAAATGAGGGAGG - Intergenic
1198039288 X:132833992-132834014 CTGTATCTGCCAAATGAGGATGG - Intronic
1198388919 X:136154049-136154071 CCTCATCTGTAAAATAATGGGGG - Intronic
1198399681 X:136256802-136256824 CCTCATCTGTAAAATGAGGATGG - Intergenic
1198420651 X:136468315-136468337 TCTCACCTGTAAAATGGGGATGG - Intergenic
1198439506 X:136648661-136648683 CCACATCTGAGAAATGGGGATGG + Intronic
1198551487 X:137749778-137749800 CCTCATCTGAAAAATTGAGAAGG + Intergenic
1198575843 X:138009484-138009506 CCTCATCTGAAAAATGTGGTGGG + Intergenic
1199513063 X:148644429-148644451 CCTCATCCGCAAAATGAGGATGG + Intronic
1199709576 X:150459606-150459628 CCTCATCTGTACAATGAGGGTGG + Intronic
1199722850 X:150555015-150555037 CCTCATCTGCAAAAGAGGGATGG + Intergenic
1199767604 X:150952516-150952538 CCTCATTTCCACAGTGAGGAGGG - Intergenic