ID: 1085626373

View in Genome Browser
Species Human (GRCh38)
Location 11:78076844-78076866
Sequence ACAAAGGAGATACAGTTGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 269
Summary {0: 1, 1: 0, 2: 1, 3: 28, 4: 239}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085626373 Original CRISPR ACAAAGGAGATACAGTTGGG AGG (reversed) Intronic
900997126 1:6128702-6128724 AGCCAGGAGATACAGGTGGGGGG + Intronic
902942537 1:19811086-19811108 ACTAAGGAGATAAAGAAGGGAGG - Intergenic
903317649 1:22521106-22521128 ACACAGGTGTTACAGTTGGAAGG + Intronic
904927591 1:34060925-34060947 ACCCAGGGGATACAGGTGGGTGG - Intronic
907855128 1:58295792-58295814 TCAAAGGGGAGACAGTTGGCTGG + Intronic
910907962 1:92201600-92201622 ACAAAGAAGAAATAGGTGGGAGG - Intergenic
912471928 1:109912108-109912130 AGAGAGGAGATAGAGTTGAGAGG + Intronic
912641738 1:111352699-111352721 ACAAAGGAGAAAAAGGAGGGAGG - Exonic
912819841 1:112858265-112858287 AAAAAGGAAAAACAGTTGGAGGG + Intergenic
914689945 1:150016907-150016929 AGACAGGGGAGACAGTTGGGTGG - Intergenic
915527404 1:156484592-156484614 ACAAATGACATACACTGGGGAGG + Intronic
917263648 1:173196456-173196478 ACGCAGGATATACAGTGGGGAGG - Intronic
917908510 1:179614681-179614703 AGAAAGGAAATGCAGGTGGGTGG - Intronic
919333125 1:196196714-196196736 ACACAAGAGATTCAGTTAGGAGG + Intergenic
921481657 1:215671136-215671158 ACAAAAGAGAAACAGTTGGCTGG + Exonic
922004586 1:221516839-221516861 ACAAAGGAGATACACAAGGAAGG + Intergenic
922034754 1:221837512-221837534 ACAAAGAAAATATAGTTGGAGGG - Intergenic
923787771 1:237084648-237084670 ACCAAGGAAATGCAGCTGGGAGG - Intronic
924711111 1:246530752-246530774 AGGAAGGAAAAACAGTTGGGGGG + Intergenic
1064124247 10:12645738-12645760 ACAAAGGAAAGAGAGTTGGACGG + Intronic
1066981663 10:42422356-42422378 ACAAAGGAAACACAATTTGGAGG - Intergenic
1067211033 10:44260672-44260694 ACAGAGGAGACCCAGTGGGGAGG + Intergenic
1068541735 10:58302412-58302434 ACACAGGTGATAAAGTGGGGTGG - Intergenic
1068629962 10:59288580-59288602 TCAAAGGAGATCTAGTTGTGTGG + Intronic
1068884238 10:62082091-62082113 CCAAAGCAGAAACAGTAGGGGGG - Intronic
1070256690 10:74819039-74819061 AAAAATGAGATAAAGTTGGCTGG - Intergenic
1070495627 10:77019121-77019143 ACAGAGAAGATACATTTGTGAGG + Intronic
1071113539 10:82190816-82190838 ATGCAGGAAATACAGTTGGGAGG - Intronic
1072063225 10:91838211-91838233 AAAGAGGAGATGAAGTTGGGGGG + Intronic
1072794039 10:98340629-98340651 GCAAAGGAGATAGAGCTGAGGGG - Intergenic
1073009913 10:100350968-100350990 AGAAAGGAGGTAGGGTTGGGGGG + Intronic
1073757120 10:106592761-106592783 AAAAAAGAGAAACAGTGGGGAGG - Intronic
1073891594 10:108109036-108109058 ACAAAGGGGCTACAGTCAGGAGG + Intergenic
1076072852 10:127505649-127505671 CCAAGGGAGATACAGGTGTGAGG - Intergenic
1076092500 10:127699915-127699937 ACAAAGCAGGTCCAGCTGGGTGG - Intergenic
1078188903 11:9075524-9075546 TTACAGGAGATACAGCTGGGAGG + Intronic
1079068538 11:17321069-17321091 ACAAAGGATAAACAGTTGAGGGG - Intronic
1079433160 11:20416740-20416762 ATAAAGATGATACATTTGGGAGG + Intronic
1079446230 11:20558604-20558626 ACCCAGGACATAGAGTTGGGAGG - Intergenic
1080815569 11:35753187-35753209 AATAAGGTGATACAATTGGGGGG + Intronic
1082710131 11:56545296-56545318 ATAAAGGAAATACAGTTTTGGGG + Intergenic
1084042442 11:66550071-66550093 ACAAAGCAGATACTCCTGGGAGG - Intronic
1084076485 11:66782099-66782121 ACAGAGGAGATAGAGTTTGGAGG - Intronic
1084371076 11:68743856-68743878 ACAAAGGAGATGCAGGTGGGGGG + Intronic
1085449779 11:76624872-76624894 ACAAAGCAGACGCAGTGGGGTGG - Intergenic
1085626373 11:78076844-78076866 ACAAAGGAGATACAGTTGGGAGG - Intronic
1088554129 11:111044335-111044357 ACAAAGGAGACTCAGAAGGGTGG - Intergenic
1088904619 11:114145099-114145121 AAAAAGGGGATACAGTTCTGAGG - Intronic
1089386245 11:118070025-118070047 ACCAAGGCAATACAGCTGGGAGG + Intergenic
1091039424 11:132262751-132262773 AAGAAGGACATACATTTGGGAGG - Intronic
1091864355 12:3818381-3818403 AGAAAGGAGATAGAGAAGGGTGG - Intronic
1093084256 12:14849099-14849121 ACAAAGAAGCTACAGCTGAGTGG - Intronic
1093568030 12:20632149-20632171 AGAAAGGAGATGCAATTGGTAGG - Intronic
1094306531 12:29026134-29026156 ACTAAGAAGATAAAGTTGAGCGG + Intergenic
1095557469 12:43523895-43523917 ACAAAGGACAGACACTTTGGGGG + Intronic
1096123648 12:49104681-49104703 AGAGAGCAGATAGAGTTGGGTGG - Intronic
1096202777 12:49697403-49697425 ACAAAGGAGGTACAGATAAGTGG + Intronic
1097292142 12:57926338-57926360 GAAAAGGAGATACAGATGTGAGG + Intergenic
1098586533 12:72161021-72161043 AGAAAGGAGATAGAGGTGAGAGG - Intronic
1100450526 12:94701578-94701600 ACATAGGAGTCACACTTGGGTGG - Intergenic
1100594161 12:96057168-96057190 ACTAAGGAGCTACAGTTCAGAGG + Intergenic
1100854170 12:98743676-98743698 ACAAAAGTGATCCAGTTTGGTGG + Intronic
1102074201 12:110047126-110047148 ACCAAGGAGATACAGTGGGAAGG + Intronic
1102926280 12:116828753-116828775 AGAAAGGAAATACAGATGGGTGG + Intronic
1103749447 12:123149679-123149701 ACACAGGAGATACAGATAGCAGG + Intronic
1106485835 13:30171742-30171764 ACAAAGGAGACGCATTTGGGAGG + Intergenic
1107299876 13:38954581-38954603 ACAAAGGAGATACAGGTGTCTGG + Intergenic
1110078122 13:71276048-71276070 ACAAAAGAGATACACTTAGCTGG + Intergenic
1114779930 14:25527693-25527715 ACAAAGGAGATAAAGTTTCAAGG + Intergenic
1115520780 14:34231128-34231150 AGAAAGGACTTAGAGTTGGGAGG - Intronic
1116646823 14:47539404-47539426 ACAAAGGAGAAACACTTGGAGGG + Intronic
1118966570 14:70592453-70592475 ACATAGGAGAGACAGTGGTGTGG - Intronic
1120913326 14:89687799-89687821 CCAAAGTAGATACAGATGGAGGG + Intergenic
1121830041 14:97043648-97043670 CCAAAGGGGATACAGTGTGGAGG + Intergenic
1121903557 14:97718283-97718305 ACAAGGGGGATGCAGTTGGATGG - Intergenic
1122357110 14:101129756-101129778 ACAAAGGAAATTGAGTTGGGTGG + Intergenic
1122714143 14:103683681-103683703 ACAAAGGTGGTGCAGCTGGGAGG - Intronic
1126828985 15:52579867-52579889 AAAAAGGAACTACGGTTGGGAGG - Intergenic
1126875146 15:53033418-53033440 ATAAAGGAAATACAGTTCGGCGG - Intergenic
1127200409 15:56641579-56641601 ACAAAGGATATATAGTTTAGGGG - Intronic
1130028448 15:80290234-80290256 ACAAAGGAAATGCAGTGGGGAGG + Intergenic
1131081459 15:89539908-89539930 AGAAAGGAGGTAAAGTTGAGAGG + Intergenic
1134528564 16:14963941-14963963 ACTCAGGAGATCGAGTTGGGAGG - Intergenic
1135828570 16:25753008-25753030 ACAAAGAAGATTCAGTTAGATGG + Intronic
1135844845 16:25909553-25909575 TCCAAAGAGATACAGTTGGGAGG + Intronic
1136034070 16:27525454-27525476 ACAAAGAAGGAACAGCTGGGAGG - Intronic
1141352055 16:83307056-83307078 ACATATAAGCTACAGTTGGGTGG + Intronic
1141913398 16:87076299-87076321 ACTAAGGAGATTGAGGTGGGAGG + Intergenic
1143078958 17:4367250-4367272 ACTAAGGAGACTCAGATGGGAGG - Intergenic
1144754903 17:17673589-17673611 ACAGAAGAGATGCAGATGGGGGG - Intergenic
1148102885 17:45103427-45103449 ACATAGGAGACACAGTCTGGGGG + Intronic
1149469593 17:56905059-56905081 ATAAGGGAGAAACAGATGGGAGG + Intronic
1149828963 17:59854567-59854589 ACTCAGGAGATAGAGGTGGGAGG + Intergenic
1150322800 17:64230493-64230515 ACAACAGAGGTAGAGTTGGGTGG - Intronic
1153818473 18:8811242-8811264 AGAAAGGAAGTACAGGTGGGCGG + Intronic
1155281264 18:24242312-24242334 ACAAAAAAGATTCAGTTAGGGGG + Intronic
1156751300 18:40459143-40459165 ACGAAGGAGATACCTTTGGAAGG - Intergenic
1156770651 18:40718594-40718616 ACAGTGTAGATAAAGTTGGGAGG - Intergenic
1157814228 18:50719480-50719502 AGAAAGGAGGAACAGGTGGGAGG + Intronic
1158021605 18:52848460-52848482 ACAAAGGACACACATTTTGGTGG + Intronic
1158460259 18:57640140-57640162 AAAAAGGAAATACAATGGGGCGG - Intergenic
1159686626 18:71429559-71429581 ACAAAGGATAAACACTTGAGGGG - Intergenic
1161208958 19:3056489-3056511 AGAAAGGAGAGGCAGGTGGGAGG + Intronic
1162641809 19:12016397-12016419 ACAGAGGAGAGACAGTTGAAAGG + Exonic
1162905943 19:13824079-13824101 AGAAAGGAGAGATAGTAGGGGGG + Intronic
1163655552 19:18543259-18543281 GCAAAGGGGATCCAGTGGGGGGG - Intronic
1164545707 19:29160730-29160752 AAAAAAGACATACAGGTGGGGGG + Intergenic
1165393173 19:35549849-35549871 AGAAAGGAGACACCGCTGGGGGG + Intergenic
1165424865 19:35740149-35740171 TTAAAGGATATAAAGTTGGGAGG - Intronic
1165589393 19:36954242-36954264 ACAAAGGAGATAAAAATAGGGGG + Intronic
1166107456 19:40604339-40604361 GCGAAGGAGACAGAGTTGGGCGG + Intronic
1166426495 19:42683529-42683551 AGAAAGGAGCTACCGGTGGGTGG - Intronic
1166834169 19:45657030-45657052 AAAAAAGAGATCCAGTTGGCTGG - Intergenic
1168067671 19:53927997-53928019 ACAAAGCAGATGTAGTTGAGGGG + Intronic
1168443559 19:56392367-56392389 ACAAATGGGATAGAGTTGGAAGG + Intronic
1168458542 19:56534619-56534641 ACAAAGGAAAAAAAGTTGGGGGG - Intergenic
1168517908 19:57023803-57023825 AAAAAGAAGATTCAGTTGGAGGG - Intergenic
925256004 2:2488918-2488940 TCAAAGGAAATATAGATGGGTGG - Intergenic
928766039 2:34646862-34646884 ACAAAAGTGATACAGTTTGGTGG - Intergenic
931049226 2:58391574-58391596 ACAAAGGAGACACAGCTAAGGGG + Intergenic
934095054 2:88594069-88594091 ACAATGCAGATGCAGGTGGGTGG + Intronic
934640479 2:96024621-96024643 ACGGAGGAGATACTGTTGCGTGG - Exonic
935528765 2:104206290-104206312 ACAAAGGAGATACTGTTCCTAGG + Intergenic
937230076 2:120393082-120393104 AGAAAGCAGAAACAGTTGGGTGG - Intergenic
937565897 2:123288365-123288387 ACAAAGGATTTTCAGTTGGAAGG + Intergenic
939949438 2:148451417-148451439 TCAAAGGTGAAACAGATGGGGGG + Intronic
942406964 2:175666427-175666449 ATAAAGAAGATACAGATGGGAGG + Intergenic
943847061 2:192663937-192663959 ACAAAGTAATTACAGTTTGGGGG - Intergenic
946250494 2:218408453-218408475 ACATAGGAGATAAACTTGGCAGG + Intergenic
947652993 2:231803113-231803135 ACAAAGGAGATGCAGTGGTGTGG + Intronic
947776172 2:232711194-232711216 ACTCAGGAGGTACAGGTGGGAGG - Intronic
1169076469 20:2762916-2762938 ACAGAGGAGGTACAGATGAGGGG + Intergenic
1169122497 20:3105808-3105830 ACAAAGGAGGAAGACTTGGGAGG - Intergenic
1170984716 20:21246890-21246912 GCAAAAGAAATACAGTTGGGAGG + Intergenic
1172325709 20:34032883-34032905 AGAAAGGAGATTCAGTTGAGGGG + Intronic
1175041885 20:56059839-56059861 ACAAAGGAGACGATGTTGGGAGG - Intergenic
1176936846 21:14877210-14877232 TAAAATGAAATACAGTTGGGAGG - Intergenic
1178490334 21:33046714-33046736 ACGGTGGAGATAGAGTTGGGGGG - Intergenic
1178708889 21:34896830-34896852 CCAAAGGAGCTTCAGTTGAGTGG + Intronic
1179954743 21:44732325-44732347 ACAGAGGAGATGCAGGTGAGGGG + Intergenic
1182114562 22:27748215-27748237 AAAAAGGGGATAGAGTTGGGAGG + Intergenic
1182385015 22:29930896-29930918 ACTCAGGAGGTAGAGTTGGGTGG + Intronic
1182448599 22:30404527-30404549 ACAGAGGACATACAACTGGGAGG + Intronic
1184578261 22:45392626-45392648 ATAAAGGAGATGAAGATGGGTGG + Intronic
949181315 3:1134959-1134981 CCAAAGGAGATACAATTTGCAGG - Intronic
949323788 3:2841209-2841231 TCAAAAGAGTTACAGCTGGGTGG + Intronic
949742555 3:7253077-7253099 AGCAAGGAGCTACAGTTGAGGGG + Intronic
950781651 3:15397695-15397717 ACAAAGGTGATTGAGTTTGGGGG - Intronic
951123421 3:18956224-18956246 ACATATGAGATACAGTGGAGTGG - Intergenic
951569154 3:24044096-24044118 ACAAATGAGAAACAGATGGTTGG + Intergenic
954860219 3:53681898-53681920 AGAAAGGAGGTACAGTAGGAAGG + Intronic
956974821 3:74567247-74567269 ACTCAGGAGGCACAGTTGGGAGG - Intergenic
957029292 3:75221494-75221516 ACAAAGGAGACATCGTTGAGGGG - Intergenic
959347385 3:105215819-105215841 ACAAAGCAGATACAAATGAGTGG - Intergenic
959931269 3:111985791-111985813 AAAGCGAAGATACAGTTGGGAGG + Intronic
960514130 3:118584101-118584123 ATTAAGGAAATGCAGTTGGGAGG + Intergenic
961761247 3:129169969-129169991 ACATAGAACATACAGTTGAGTGG - Intronic
962473945 3:135739592-135739614 AAAAAGGAGAGACAGTTGAAGGG - Intergenic
963303089 3:143620616-143620638 AAAAAGGAGAAACAGGGGGGTGG + Intronic
963576917 3:147071914-147071936 ACAAAGGAGGTTGAGGTGGGAGG + Intergenic
964035475 3:152190921-152190943 ACAAAGGAAAGCCTGTTGGGAGG - Intergenic
964268881 3:154933317-154933339 ACAAAGGAGAGATATTTAGGAGG + Intergenic
964411978 3:156407322-156407344 ACAGAGGAGATGCATTTGAGCGG - Intronic
965845203 3:172953266-172953288 ACAATGGAGATTGAGGTGGGAGG - Intronic
967392716 3:188972876-188972898 AGAAAGGAGAAAAAGTTGGTGGG - Intronic
967998865 3:195187385-195187407 ACACAGAAGAGACAGTTGGGAGG - Intronic
968919752 4:3516424-3516446 ACAAAGGAGAAGCAGTTGTTTGG - Intronic
970270517 4:14341561-14341583 ACAAATGAGAAACAGAAGGGAGG - Intergenic
972598922 4:40554735-40554757 AGAAAGGAGAGAGAGATGGGGGG - Intronic
972996639 4:44887235-44887257 ACAAAGGATAGACACTTGAGGGG - Intergenic
973086950 4:46075936-46075958 ACAATGGAGATTCAGGAGGGTGG + Intronic
973129236 4:46629513-46629535 TCAAATGAGATACTCTTGGGAGG - Intergenic
974940468 4:68461717-68461739 ATAAAGGACATTCAGTTGGAGGG - Intronic
976559513 4:86485419-86485441 ACATAGGAGATACAGTGGTGAGG - Intronic
978622561 4:110648262-110648284 ACAGAGGAGCTTGAGTTGGGAGG + Intergenic
978780069 4:112542729-112542751 AAAAAATAGATAAAGTTGGGTGG - Intronic
979779477 4:124632499-124632521 ACAAAAGAGAGACAGTCAGGAGG + Intergenic
980441140 4:132846304-132846326 AAAACTGAGATTCAGTTGGGTGG + Intergenic
980835181 4:138182837-138182859 ACAAAGGAAATACTGATGGTAGG + Intronic
981523353 4:145687819-145687841 ACAAAAGTAATACAGGTGGGAGG + Intronic
982340468 4:154292988-154293010 AAAAAGGAGATTGAGTTGGAGGG - Intronic
982779972 4:159480544-159480566 AAAAAGCAAATACATTTGGGAGG + Intergenic
982868370 4:160545868-160545890 ACAAAGGTGATAGAGTTTGTGGG + Intergenic
984252505 4:177351093-177351115 ACTCAGGAGATTCAGGTGGGAGG + Intronic
984496728 4:180507320-180507342 ACAAAGAAAATAAAGTTGAGGGG + Intergenic
984554935 4:181202307-181202329 ACAGGGGAGTTACAGCTGGGTGG + Intergenic
985076207 4:186217616-186217638 ACAAAGGAGATTTAGTGGGCAGG + Intronic
986243480 5:5982903-5982925 ACAAAGGAGATGAACTTTGGTGG + Intergenic
988094733 5:26591041-26591063 AAAAAGGAGAAGCAGTTGTGAGG - Intergenic
988526000 5:31987927-31987949 CAAAAGGAGCTACAGTTGAGGGG - Intronic
990673506 5:58159062-58159084 ATAAAGAAGATACATTTGTGGGG + Intergenic
990781448 5:59369301-59369323 GGGATGGAGATACAGTTGGGAGG - Intronic
991413403 5:66367212-66367234 AGAAAGCAGAGACAGTGGGGTGG + Intergenic
991776496 5:70090389-70090411 ACAAGTGAGAGACAGTGGGGGGG - Intergenic
991855783 5:70965836-70965858 ACAAGTGAGAGACAGTGGGGGGG - Intergenic
991869798 5:71098614-71098636 ACAAGTGAGAGACAGTGGGGGGG - Intergenic
996225785 5:120994435-120994457 CCAAAGGAGATACAGTCATGTGG - Intergenic
997870736 5:137503131-137503153 ACAAAGGATAAACACTTGAGGGG - Intronic
998540048 5:142972188-142972210 AAAAAAAAGATACAGTTGTGAGG + Intronic
999230272 5:150057595-150057617 ACATAGGAGAGAGGGTTGGGGGG + Intronic
999894997 5:156022933-156022955 ACAAAGAAGTGACAGCTGGGTGG - Intronic
1000836365 5:166159808-166159830 ACAAAGGAGACCAAGGTGGGTGG - Intergenic
1000966378 5:167662059-167662081 ATAAAGGATATAGAGTGGGGTGG + Intronic
1001535506 5:172495158-172495180 ACAATGAGGATACAGTTGGAGGG + Intergenic
1006991624 6:38219715-38219737 AAAAAGCAGATACTGTTGGCTGG + Intronic
1010145869 6:72669028-72669050 AAAAAGGACATACATTTTGGGGG - Intronic
1011045917 6:83082544-83082566 TCAAAGGATATATAGTTAGGAGG + Intronic
1012230688 6:96757888-96757910 ACAAAGAACATAGATTTGGGAGG + Intergenic
1012600786 6:101094142-101094164 ACAAAGGATATACATTTGAGGGG + Intergenic
1012642921 6:101644238-101644260 ATCAAGGAGATCCAGTTGGTTGG + Intronic
1013927325 6:115488959-115488981 AAAAAGGAGATAGAATAGGGTGG - Intergenic
1017218605 6:151939321-151939343 ACAAAAGTTAGACAGTTGGGGGG + Intronic
1017780031 6:157708565-157708587 ACAAAGGAGGTTCAATTTGGGGG + Intronic
1018431711 6:163727958-163727980 ACAAAGTTGAAACAGTTGGTAGG - Intergenic
1023422651 7:39999260-39999282 ATAAAGAATATACAATTGGGTGG + Intronic
1023832170 7:44045666-44045688 ACAAGGGGAAGACAGTTGGGAGG - Intronic
1024151738 7:46578596-46578618 ACACAGGAGAAGCAGTTCGGAGG + Intergenic
1027138343 7:75639688-75639710 AAAAAGGAGGGACAGATGGGGGG + Intronic
1028747596 7:94345694-94345716 TCAAAGGTAATAAAGTTGGGAGG + Intergenic
1029197960 7:98819632-98819654 AAAAAGGAGAAAAAGGTGGGGGG + Intergenic
1030636294 7:111953116-111953138 ACTCAGGAGACACAGGTGGGAGG + Intronic
1033821624 7:145141358-145141380 AAAAAGGAGATGGAGGTGGGGGG - Intergenic
1034052876 7:148001273-148001295 ACCCAGGAGACACAGTTGTGGGG - Intronic
1034981570 7:155481736-155481758 ACAAAGGGGATCCACTTGGGAGG - Intronic
1035419838 7:158718056-158718078 ACTCAGGAGATTGAGTTGGGAGG - Intergenic
1036609989 8:10341338-10341360 GCAAGGGAGAGAGAGTTGGGGGG + Intronic
1036780677 8:11644824-11644846 AAGAGGGAGAGACAGTTGGGTGG - Intergenic
1037554450 8:20008659-20008681 ACAAAGGTGATACAGTTTCGGGG - Intergenic
1038151867 8:24949177-24949199 ACAAAGGAGATGCAGTGAGGTGG + Intergenic
1039897150 8:41724660-41724682 ACAAAGGAGATTTTGATGGGTGG + Intronic
1040476054 8:47778663-47778685 ACAAAAGAGACACAGCTGTGCGG + Intronic
1040575289 8:48646328-48646350 AGAAAGGAGAGAGAGGTGGGGGG - Intergenic
1040879834 8:52192677-52192699 ACAAAAAAGGTACAGTTAGGAGG + Intronic
1041334040 8:56759647-56759669 ACATAGGAGATTAAGTTGTGGGG - Intergenic
1041417831 8:57631545-57631567 ACAGAGTAGATAAAGTTTGGAGG + Intergenic
1042814611 8:72865001-72865023 ACACAGGTGAGACAGGTGGGAGG - Intronic
1043501769 8:80865402-80865424 ACAGAGAAGTAACAGTTGGGTGG + Intronic
1044002562 8:86902160-86902182 AAAAAGTAGATAAAGTTTGGAGG - Intronic
1046065993 8:109197279-109197301 GCAAAAGAGAGATAGTTGGGAGG + Intergenic
1046389670 8:113553754-113553776 ACAGAGGAGATTGAGGTGGGAGG + Intergenic
1046719141 8:117599290-117599312 ACCAAAGAGAAACAGATGGGGGG - Intergenic
1046781315 8:118218486-118218508 TCAAAGGATATAAAGTTAGGAGG - Intronic
1047097733 8:121641875-121641897 CCCAAGGAGGAACAGTTGGGAGG + Intergenic
1047285641 8:123485098-123485120 ACAAAGAAGACAAAGTAGGGTGG + Intergenic
1047378621 8:124332631-124332653 ATAAAGGAGATACAACAGGGAGG + Intronic
1048815412 8:138329157-138329179 AAATAGGAGATACAGATGGATGG + Intronic
1051608784 9:18941965-18941987 ATAGAGGAGAAACAGTTCGGGGG - Intronic
1052226485 9:26094747-26094769 ACTAAGGACATAGAGGTGGGAGG + Intergenic
1054806194 9:69397786-69397808 ACCAAGCAGATACAGTGCGGCGG - Intergenic
1055779231 9:79801197-79801219 ACTGAGGAGGTAAAGTTGGGAGG - Intergenic
1056231328 9:84547463-84547485 ACAAATGAGATATACTTGGTTGG - Intergenic
1056693498 9:88827514-88827536 AAAGAGGAGATACAGTTCTGAGG - Intergenic
1057068459 9:92075866-92075888 ATTAAGGAAATACAGTTGTGTGG - Intronic
1059369112 9:113811019-113811041 ACAAAGGAGATACAGAAACGTGG + Intergenic
1059662356 9:116414705-116414727 AGAAAGGAGCTAGAGTAGGGGGG - Intergenic
1060112164 9:120914113-120914135 ACAAAGGACATCCAGATGAGTGG + Intronic
1060276061 9:122183654-122183676 ACAAAGGGGATAATGTTGGCGGG - Intronic
1187836371 X:23436043-23436065 GCAAGGGAGAGAGAGTTGGGGGG - Intergenic
1188458866 X:30399100-30399122 ACATTGGAGATTCAGTGGGGTGG + Intergenic
1188857815 X:35219189-35219211 ACAAAGGAGAGAGAGGAGGGAGG - Intergenic
1190275455 X:48896535-48896557 ACAGAGGAGCTCCAGTTGGGTGG + Intronic
1190665937 X:52695938-52695960 ACAGAGGTGAAACAGTTGTGGGG - Intronic
1190673481 X:52762472-52762494 ACAGAGGTGAAACAGTTGTGGGG + Intronic
1190677026 X:52791243-52791265 ACAGAGGTGAAACAGTTGTGGGG + Intergenic
1191025915 X:55913269-55913291 GCAAAGGACATACAGATTGGAGG - Intergenic
1191150856 X:57220124-57220146 AAAAAAGAGGTACGGTTGGGAGG - Intergenic
1195821091 X:108946173-108946195 AGGAAGGACATACACTTGGGTGG - Intergenic
1195992764 X:110699010-110699032 ATAAAGCAGATAGAGTTGGGTGG + Intronic
1201619229 Y:15937030-15937052 AAAAAGGAGATACAGATAGTGGG - Intergenic